Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Forbereder utvikle perifere Olfactory vev for molekylær og Immunohistochemical analyse i Drosophila

doi: 10.3791/57716 Published: June 13, 2018

Summary

Her presenterer vi en protokoll for scenen og dissekere utvikle olfactory vev fra Drosophila arter. Dissekert vevet kan senere brukes til molekylær analyser, som kvantitative RT PCR (omvendt transkripsjon-polymerasekjedereaksjons) eller RNA sekvensering (RNAseq), samt i vivo analyser som immunohistochemistry eller i situ hybridisering.

Abstract

Olfactory systemet Drosophila er en mye brukt system i utviklingsmessige nevrobiologi, systemer nevrovitenskap, samt nevrofysiologi, atferd og opptreden utviklingen. Drosophila olfactory vev huset olfactory reseptor neurons (ORNs) oppdage flyktige kjemiske signaler i tillegg til hydro - og thermo-sensoriske neurons. I denne protokollen beskriver vi Disseksjon av utvikle perifere olfactory vev av voksen Drosophila arter. Vi først beskrive hvordan scenen og alder Drosophila larvene, etterfulgt av Disseksjon av antennal platen fra tidlig pupal fase, etterfulgt av Disseksjon av antenner fra midt-pupal stadier og voksne. Vi viser også metoder der preparater kan benyttes i molekylær teknikker, som RNA utvinning qRT PCR, RNAseq eller immunohistochemistry. Disse metodene kan også brukes til andre Drosophila arter etter artsspesifikke pupal utvikling ganger fastsettes, og respektive stadier er beregnet for riktig aldring.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Olfactory systemet Drosophila er en mye brukt system i utviklingsmessige nevrobiologi, systemer nevrovitenskap, samt nevrofysiologi, atferd studier og atferdsmessige utviklingen1,2,3, 4. Drosophila olfactory vev huset olfactory reseptor neurons (ORNs) oppdage flyktige kjemiske signaler i tillegg til hydro - og thermo-sensoriske neurons1,5,6. Det overordnede målet med dette manuskriptet er å scenen og dissekere utvikle pupal og voksen olfactory vev i Drosophila arter. Begrunnelsen for denne teknikken er å generere prøver fra ulike pupal stadier for molekylær og utviklingsmessige analyser eksterne olfactory systemet, som RNAseq og kvantitative RT PCR, i tillegg til i vivo vev merking teknikker . Denne teknikken kan være spesielt nyttig å identifisere dynamikken i transcriptional profiler i utviklingsland voksen olfactory systemet fra ikke -melanogaster Drosophila arter som ikke har alle celle type bestemt transgene reagensene merking og analyser. I dette manuskriptet viser vi hvordan å analysere antennal plater og antenner fra pupal og voksen Drosophila arter. Først viser vi hvordan du identifiserer Drosophila 0t blodsugende formasjonen (APF, hvit pupae eller prepupae) for utviklingsmessige staging og artsspesifikke aldring. Deretter viser vi hvordan å analysere antennal plater og tredje antennal segmentet; spesielt hvordan å distansere seg fra øye platen og andre antennal segmentet for vev renheten kreves for RNAseq eller RT-PCRene. Stadier i D. melanogaster beskrevet i denne protokollen omtrent tilsvarer pre mønstret antennal platen (prepupae), valg av prekursorer fra den antennal plate (8 h APF), starter terminal differensiering for ORNs (40 h APF), og voksen antenne. Til slutt, vi gir eksempler for en kvantitativ RT PCR fra voksen antenner isolert med metoden og i vivo immunohistochemistry. Denne metoden kan brukes til å generere prøver for en RNA/DNA-analyse og immunohistochemistry på å utvikle perifere olfactory vev fra ulike Drosophila arter.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Følgende protokollen er i samsvar med etiske retningslinjene som er fastlagt ved Duke University Research etikk.

1. vev forberedelse og utviklingsmessige oppsetning av Drosophila melanogaster puppe

  1. Først identifisere hvor mange fluer vil være nødvendig for dissection. RT PCR og RNAseq, samle 100-200 antennal plater og antenner fra enkeltpersoner som er nødvendige på skallet, 8 h APF, 40 h APF, og voksen stadier. For immunohistochemistry, dissekere 10-20 individuelle.
  2. Rengjør alle materialer, inkludert disseksjon pads og tang, kluter med 70% EtOH. Hvis dissekert materialet skal brukes for RNA utdrag, rydde alt med RNase neutralizers og gjøre alle løsninger ved hjelp nuclease-fri eller diethyl pyrocarbonate (DEPC) behandlet vann.
    Merk: Denne protokollen bruker silikon disseksjon pads glass for disseksjoner. Silikon pads er vennlig mot ultra-fine tang og fremme rask og høy kvalitet disseksjoner.
  3. Samle puppe på 0 h APF/skallet scenen.
    1. For å sikre den mest nøyaktige iscenesettelsen, overvåke Larvene 30 minutter til 1 h intervaller.
      Merk: Vandrende tredje skikkelsen larver i en moderat overfylt flaske vil trolig forpuppe seg i noen timer.
    2. Når Larvene bli immobile og er omgitt av en veldig lys (nesten hvit) farget pupal sak, overføre dem i en liten 2 - i Petriskål med fuktig filter papir.
    3. Fortsett i 1-2 h, og til overvåking, identifisere og overføre prepupae.
      Merk: Alternativt, fjerne en flaske alle pupae og tillate Larvene å utvikle for 2T. Alle pupae samlet etter 2t vil være innenfor et 0 - 2 h APF.
  4. Umiddelbart går videre til trinn 3.1 å dissekere skallet antennal platen for 0t APF scenen. Hvis prepupa må være i alderen, samle dem i en parabol, dekke fatet og plassere en parafin film rundt kantene å hemme tørrhet og plassere Petriskål på 25 ° C.
    Merk: Pupae kan nå være alderen til eclosion.
  5. For pupae i mange 2t, alder prepupae for 2t mindre enn ønsket år for å sikre at pupae ikke tilleggskostnader.
  6. Bruk ultra-fine tang (Dumont 55) som vevet er veldig liten og skjør.

2. vev forberedelse og utviklingsmessige oppsetning av puppe fra andre Drosophila arter

  1. Avgjøre pupal utviklingen i andre Drosophila arter, plassere prøvene ved optimal temperatur, registrere datoene når prepupae er observert, sortere dem i en ny medisinglass og registrere antall dager fra prepupa til voksen alder.
  2. Registrere forholdet mellom tid for pupal utvikling for ikke -melanogaster arter og melanogaster. Multiplisere forholdet mellom utviklingsmessige tiden på antall timer brukt for iscenesettelsen melanogaster for å få antall timer til alder ikke -melanogaster arter.

3. Disseksjon av D. melanogaster Pupal Antennal plate

Merk: Alle aldring ganger og disseksjon protokoller er beskrevet for Drosophila melanogaster. For alle andre arter, vil en endring av aldring protokollen basert på artsspesifikke utviklingsmessige tidspunkt være nødvendig, som beskrevet ovenfor.

  1. For pupal antennal plate disseksjoner, samle 50-100 0 - 2 h eller 6-8 h gamle pupae ved hjelp av en slikkepott og plassere dem på en disseksjon pad.
  2. Pipetter 150 µL av RNA isolasjon løsning i en RNase gratis 1.5-mL microfuge rør med en 200-µL pipette og sett røret på is.
  3. Dissekere pupae i 150-200 µL av 1 x PBS (fosfat bufret saltvann, nuclease-fri). Plass flere dråper av PBS (150-200 µL per slippverktøy) på disseksjon puten.
  4. På disseksjon puten, sett 0 - 2 h eller 6-8 h alderen pupae (en puppe per slipp) være dissekert i ett av 1 x PBS dråper. Bruk tang i den ene hånden til å stabilisere kroppen.
  5. For 0 - 2 h alderen pupae, ved hjelp av pinsett i den andre hånden, hold på til den mest fremre delen (munn kroker) av prepupa og rykk den ut for å avsløre hjernen og imaginal plater knyttet til fremre pupal saken.
  6. For de 8 h APF pupae, først forsiktig løsner pupal tilfelle fra mest fremre kvartal av puppe, utsette hodet i membranen sekk som omgir kroppen.
    Merk: Kroppen, på dette stadiet, ser ut som en degenereres larve.
  7. Fjerne hodet på halsen felles.
    Merk: Dette sikrer at antennal plater ikke vil gå tapt, som på dette stadiet er knyttet primært til optikk lobes av hjernen.
  8. Overføre vevet med hjernen og imaginal platene til en annen 1 x PBS slippverktøy tang eller en 20-µL pipette.
  9. Identifisere øye-antennal platen koplet å hjernen på optikk lobes. Ved hjelp av pinsett, koble øye-antennal platen fra hjernen og pupal saken. Overføre det til en ny 1 x PBS slippverktøy tang eller en 20-µL pipette.
    Merk: Skallet øye-antennal platen er en flat vev. Men av de 8 h pupae, er øye platene rotert Kopping antennal skiven, som sitter anterior sentrale hjernen.
  10. Ved hjelp av pinsett, kuttet vev på stedet av forbindelsen mellom øyet og antennal platen. Bruk en 20 µL Pipetter forsiktig overføre dissekert vevet til RNA isolasjon løsning reagensen. Minimere mengden av væske overført av pipettering et beløp så liten som mulig.
  11. Gjenta til alle pupae har blitt dissekert.

4. Disseksjon av D. melanogaster midt-pupal og voksen antenner

Merk: Ved 40 h APF, fleste forvandlingen er fullført, og voksne strukturer blir tydelige, men er fremdeles hvit og ubestemmelig. På denne utviklingsmessige punkt, voksen antennen har tatt sin endelige form, men er gjennomsiktig og fleste av olfactory reseptorer, med unntak av noen, ikke har startet uttrykk.

  1. For pupal antennal disseksjoner, samle 50-100 prepupae som beskrevet i trinn 1 og alder dem for 40 h på 25 ° C.
  2. Pipetter 150 µL av RNA isolasjon løsning til en RNase gratis 1.5-mL microcentrifuge rør med en 200-µL Pipetter og sett røret på is.
  3. Disseksjon puten, plasser puppe å være deles opp i en 1 x PBS dråper. Bruk tang i den ene hånden til å stabilisere kroppen. Ved hjelp av pinsett i den andre hånden, forsiktig løsner pupal tilfelle fra mest fremre kvartal av puppe, utsette hodet i membranen sekk som omgir kroppen.
  4. Ved hjelp av pinsett, forsiktig kutte hodet fra resten av pupal kroppen ved å holde kroppen med ett sett med tang og ripping hodet av ved halsen felles med et annet sett med tang. Forsiktig overføre hodet til en annen 1 x PBS slippverktøy ved hjelp av pinsett. Pipetter opp og ned for å rense innholdet i hodet (hjernen, etc.) vil ha en klar membranen som omgir utvikle Drosophila hodet.
    Merk: På 40-50 h APF, antennene er koblet til den fremre mest delen av membranen. De vil bli tydelig for disseksjon når innholdet i hodet fjernes med pipettering.
  5. Ved hjelp av pinsett, koble pupal antenner fra membranen. Koble 2nd segmentet av antenne fra 3rd bruke tang til stykke på Segmentinformasjon felles, som bare 3rd segmentet vil huset olfactory reseptor neurons.
  6. Bruk en 20 µL Pipetter forsiktig overføre dissekert vevet til RNA isolasjon løsning reagensen. Minimere mengden av væske overført av pipettering et beløp så liten som mulig. Gjenta til alle pupae har blitt dissekert.
  7. For voksen antennal disseksjoner, samle ca 50 voksne og alder dem for en uke etter eclosion.
    Merk: Uttrykket av olfactory reseptor gener og andre gener peak en uke etter eclosion. Voksne er alderen i uken for å sikre biologisk relevante gener med lav overflod transkripsjoner å stige over oppdagelsen terskelen.
  8. Dissekere fluer for RNA utdrag, mens de er fortsatt i live på en CO2 pute. Behandle CO2 puten med RNase hemmere. For AC confocal bildebehandling, dissekere fluene på en disseksjon pute i 1 x PBS eller PBS + 0,2% Triton.
  9. Først, ta de voksne å sove på CO2 stasjon puten under disseksjon omfanget. På CO2 stasjon puten, ved hjelp av pinsett i den ene hånden for å stabilisere kroppen, bruk tang i den andre hånden til forsiktig trekk/klemme ut tredje antennal segmentet fra andre.
  10. Overfør antenner til en RNA isolasjon løsning ved hjelp av pinsett for å plassere antennene direkte inn i væsken. Gjenta til alle voksne har blitt dissekert.
    Merk: Kontroller at antennene er neddykket i RNA isolasjon løsning. Antenner kan bli sittende fast på siden av røret. Dette fører til en økt nedbrytning av det å redusere RNA kvalitet og kvantitet.
  11. Direkte fortsette til RNA utvinning eller sett røret ved-80 ° C for langtidslagring.

5. RNA isolasjon fra dissekert vev

  1. Fjern alle prøvene fra-80 ° C lagring og tiner dem på isen.
  2. Kort spinn (5-6 s, ~ 6000 x g) hver prøve å samle materiale på bunnen av røret.
  3. Slipe hvert utvalg bruker en autoklaveres plast pistil og en elektrisk motor for 10 s på is.
  4. Gjenta 5.2 og 5,3 4.
  5. Utføre RNA utvinning hjelp kommersielt tilgjengelig kits og følge produsentens protokoller for en optimal avkastning.
  6. Utføre qRT PCR bruke kommersielt tilgjengelige reagenser og bestemt primere mot gener av interesse og etter produsentens protokoller.
    1. Utføre alle PCR reaksjoner med følgende: 95 ° C rødsprit i 10 min etterfulgt av 40 sykluser av 95 ° C for 15 s, 55 ° C for 30 s og 60 ° C for 30 s.
      Merk: Primer par for DUKKERT og dpr gener er oppført i tabell 1, og primere for olfactory reseptor gener er oppført i Hueston CE et al. 8.

6. fiksering av Pupal Antennal plater og antenner for Immunohistochemistry

Merk: Fikse vev i grupper fra 10-20 personer å sikre vev er løst for samme mengde tid. Minimere tiden prøvene bo i PBT (PBS med vaskemiddel) før du overfører dem til et bindemiddel å maksimere integriteten til vev.

  1. Samle dissekert antennal plater eller pupal antenner i et 200-µL PCR rør som inneholder 200 µL på 0,2% PBT på isen for å opprettholde vev integriteten og unngå prøven seg fast til veggen av 200-µL PCR rør som vil føre til en ufullstendig fiksering.
    Merk: Pupal antenner og antennal plater kan være vanskelig å se som de er ganske gjennomsiktig. Det anbefales å bruke et disseksjon område for alle vask skritt for å hindre tap av vev. 96-brønnen Terasaki plater kan eventuelt være brukes til fiksering og flekker beste spore vevet.
  2. Fix dissekert antennal plate og antennal prøver fra pupae i ca 200 µL på 4% PFA (Paraformaldehyde) i 30 min ved romtemperatur. For dette og påfølgende holde trinn, rør med eksemplene på en nutator til riktig blanding prøvene i løsningen. Fremdriften til trinn 6.7.
  3. Voksen antennen, analysere hele hodet først og fikse det i ca 200 µL på 4% PFA (paraformaldehyde) 1t ved romtemperatur.
  4. Vask 3 x med 200 µL på 0,2% PBT i 10 min. Holde prøvene på nutator under incubation.
  5. Gå tilbake til disseksjon mikroskop for en finere Disseksjon av det andre antennal segmentet fra fast hodet. Ved hjelp av pinsett å stabilisere hodet, forsiktig trekk/klemme ut tredje antennal segmentet fra andre.
  6. Overføre dissekert tredje antennal segmentene til ca 200 µL på 4% PFA (paraformaldehyde) og fikse dem i 30 min ved romtemperatur.
  7. Vask 3 x med 200 µL på 0,2% PBT i 10 min. Holde prøvene på nutator under incubation.
  8. Lagre prøver på 4 ° C eller fortsette direkte med hele fjellet immunohistochemistry.
    Merk: Effektiviteten av flekker kan endres når antistoffer. Denne metoden bør være egnet for mindre rikelig protein koder eller svakere antistoffer. Men til tider kan det kreve en optimalisering av protokollen (enten identitet eller mengden av bindemiddel eller tidspunktet for fiksering).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Dissekert utvikle olfactory vevet kan brukes for RNA utvinning etterfulgt av RT PCR for å vurdere genuttrykk eller kan tas immunohistochemistry protokoller til å bestemme sin uttrykksmønster den sub mobilnettet lokaliseringen av gener av interesse. I denne delen presenterer vi representant resultater fra begge protokollene. Figur 1 er representant kvantitative RT-PCR viser transkripsjon av celle overflaten reseptor og olfactory reseptor gener i vill-type voksne antenner. Figur 2 viser 6-8 h og 12t APF antennal plate stainings på Rn-EGFP transgene fluer med anti-GFP (1:1000) og anti-ved antistoffer (1: 100) (figur 2A og 2B). RN-EGFP etiketter bestemte regioner i antennal platen under tidlig pupal fase. Vi viser også 40 h APF pupal antennal anti-GFP antistoff farging av Or67d-GAL4 UAS-CD8GFP transgene fluer og voksen antennal anti-elav (1: 100) antistoff farging av ORNs (figur 2). Andre eksempler kan også finnes i litteratur7,8,9,10.

Figure 1
Figur 1 . Kvantitativ RT PCR fra vill-type voksne antennal RNA eksempler for ulike gener. Disse panelene viser kvantitative RT PCR resultater for (A) DUKKERT-alpha, DIP-eta, dpr5, dpr8, kug, beatIIIb (for primer par se tabell 1), og (B) olfactory og ionotropic reseptor (eller / Ir) gener fra voksen antennal RNA prøver. De viser en standard feil av gjsnitt (SEM). Eller / Ir gener er lav overflod RNAs som fortsatt kan gjenkjennes av qRT PCR. Uttrykk for hver genet ble analysert i tre eksemplarer. CT verdier som ble brukt til å beregne fortynning faktorene for hver genet basert på standard kurver som er opprettet for hver genet. Fortynning faktorene ble deretter normalisert for hver genet til gjennomsnittlig uttrykk for alle gener målt som beskrevet før8. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2 . Immunohistochemistry bruker forskjellige antistoffer på utvikle olfactory vev. Disse skjermbildene viser anti-GFP (grønn) og anti-ved (rød) antistoff stainings på (A) 6 h APF pupal antennal plater og (B) 12t APF pupal antennal plater. (C) dette panelet viser en 40 h APF antenne fra Or67d GAL4 UAS-CD8GFP transgenics farget med kanin anti-GFP (grønn) antistoffer. (D) dette panelet viser voksen antenner beiset med anti-CD2 antistoffer, som etikett Or47b-CD2 positive ORNs (rosa). Klikk her for å se en større versjon av dette tallet.

Fremover primer Omvendt primer Lengde
CGGAGAGGAGGTTATGAGCA GGAAGTGCACAACTAGCGTT 143
CGCGAATCGTTGTGTCAGTA TGTCGATAGCGTGAACCTGA 129
AGGAGTGGACGTTGAGTTACA CAATCATGTCCTCGTGACCG 146
TAGAGTCCGAGCAGCAGATG GTCAGAATTCGAGTTGTCCGC 104
GGCGCTAAGTAGCAGGACG GGCCAAGTCTGTTTGTGAGG 215
TAAGACCCTAGCGCCCTCTT AGGGAGATGCGCTTTGAGAC 129

Tabell 1. Liste over PCR primere brukt i qRT PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Denne protokollen er en nyttig ressurs for labs interessert i å identifisere genetiske og transcriptional programmene i utvikle Drosophila olfactory vev, samt en komparativ analyse av disse programmene over Drosophila arter. Det er spesielt nyttig hvis systemer nivå transcriptional profiler fra forskjellige utviklingsstadier er nødvendig som en primer for framtidige studier. Protokollen beskrevet her demonstrerer hvordan å iscenesette og isolere utvikle olfactory vev fra Drosophila hente prøver fra fire viktige stadier av olfactory systemutvikling fra før mønstre til terminal differensiering, i molekylære og immun-histologiske studier. Dissekert Drosophila antennal plater og antenner på ulike pupal stadier kan brukes til å identifisere genet uttrykket profiler under olfactory systemet utviklingen på systemnivå av RNA-seq eller nivået av enkelte gener av kvantitative RT PCR. Eksempler kan også brukes for immunohistochemistry og i situ hybridisering for å identifisere i vivo mønstre av vev-spesifikke genuttrykk. En ekstra fordel av denne protokollen er at dissekert prøver kan bli ytterligere dissosiert bruker standardmetoder og FAC-sortert å få renset mobilnettet innbyggere (eller enkeltceller) for celle type-spesifikk molekylær analyser, som kvantitative RT PCR eller RNAseq.

Selv om protokollen viser disseksjoner antennal plater og antenner fra pupal (på 0 h/prepupa 8 timer og 40 h APF) og voksne stadier, kan det tilpasses til andre pupal tidspunkt. Det er også verdt å nevne at lære disse disseksjoner tar tid og praksis. En ekspert skal kunne analysere 50 prøver en time. Det er viktig å ikke overage pupae. Derfor en time før du begynner disseksjon, kontroller at ingen pupae er eldre enn alderen som ønsket. Disseksjoner kan ta tid å lære, så en periode av praksis for hvert trinn er nødvendig før du starter eksperimenter. Disseksjoner blitt vanskeligere fra 9-12 h APF skyldes morfologiske endringer. Er det mulig å sortere pupae alder når prepupae (av kroppen farge, med mørkere farger blir eldre). Først å sortere prepupae tillater disseksjon for alder å hindre overaging.

Protokollen beskrevet ovenfor kan brukes på andre Drosophila arter. Tidspunktet for de pupal disseksjoner av andre arter kan være basert både på forholdet mellom pupal utviklingen av artene ved 25 ° C til D. melanogaster og komparativ observasjoner av antenner/antennal plate morfologi under disseksjoner, med en prioritert morfologiske hensyn å være så like som mulig. Drosophila melanogastertar pupal scenen ca 4 dager. D. sechellia og D. erecta pupal utviklingsmessige iscenesettelse ligner D. melanogaster; D. virilis pupal utvikling er imidlertid 1,3 x lengre11,12. Når andre arter er forberedt disseksjon, bør iscenesettelsen være basert på begge timing av pupal perioden og komparativ observasjoner av scenen-spesifikke antenner/antennal plate morfologi, med morfologiske likheten som høyeste prioritet. Først må du finne optimal håndtering temperatur for arten du er interessert i. Mange arter vokser godt ved 25 ° C, men informasjon om vedlikehold forhold kan fås fra UC San Diego Drosophila arter lager center.

De viktigste trinnene i protokollen er riktig staging og riktig Disseksjon av vevet rundt i tilstrekkelig antall fra ulike arter. Når dette er på plass, protokollen gir en effektiv måte av vev samling slike analyser og kan tilpasses nesten alle utviklingsland imaginal plate vev under pupal stadier i noen Drosophila arter.

En begrensning av denne protokollen er at den ikke inneholder celle type-spesifikk prøver. En mer detaljert forståelse av cellulære funksjoner og morfologi krever celle type-spesifikk profilering transkripsjon på systemnivå, i tillegg til standard molekylær prosedyrer som kvantitative RT PCR eller immunohistochemistry. Celle type-spesifikk profilering har vært vanskelig, spesielt på grunn av mangel på celle type-spesifikk reporter transgenics i ikke -melanogaster arter. Med gjeldende fremskritt i mobilnettet profilering, transgenics og CRISPR-Cas9 mediert genomet redigering i ikke -melanogaster arter, er det nå mulig å merke og sortere ut enkeltceller interesse profil transkripsjon13.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne ikke avsløre.

Acknowledgments

Denne studien ble støttet av et stipend fra National Science Foundation å Pelin C. Volkan (DEB-1457690).

Materials

Name Company Catalog Number Comments
10X Phosphate-buffered Saline Gibco 70011-044 Dilute to 1X in RNase free water
CO2 tank Air Gas CD R200
Two sharp forceps (Dumont #55) Fine Science Tools 11255-20
Trizol Invitrogen 15596-026 RNA isolation solutions
Dissecting Microscope
Small bucket with ice
P20 and P200 micropipettes and tips
1.7 mL Microfuge tubes Purchase nuclease free for best results
0.2 mL PCR tubes
Paraformaldehyde powder Polysciences 380
10% Triton X-100 Teknova T1105 Dilute to 0.2% v/v in 1X PBS
2" petri dishes
55mm filter paper Whatman 1001-055 Wet with water and place in a petri dish to keep pupae moist
25 C incubator
deionized H2O Purchase nuclease free or treat with DEPC
Sylgard 184 Silicone Elastomer Kit Dow Corning to be used for making dissection pads from Terizaki plate covers.
MicroWell Mini Trays with lids Nunc 438733 Lids can be used to make silicone dissection pads
Rabbit anti-GFP antibody MBL international corpor PM005 primary antibody
Mouse anti RAT CD2 AbD seroTec MCA154RHDL primary antibody
ADL195 (anti lamin, mouse) Dev studies hydoma ban ADL195-s primary antibody
Alexa Fluor® 488 goat anti-rabbit IgG (H+L) invitrogen A11008 Secondary antibody
Cy3 Goat Anti-Mouse IgG Jackson ImmunoResearch 115-166-003 Secondary antibody
Triton X-100, Protein Grade Detergent, 10% Solution, Sterile-Filtered CALBIOCHEM 648463 detergent
Lab Rotator Thermo scientific Rotator
Nuclease Free Water Growcells.com NUPW-0125 Water
Light-Duty Tissue Wipers VWR 82003-822 For cleaning dissection supplies
Superscript II invitrogen 18064014 Reverse Transcriptase 
QIAshredder (50) RNA extraction QIAGEN 79654
Oligo(dT)12-18 Primer RT life technologies 18418012
RNeasy MinElute Cleanup Kit (50) RNA extraction QIAGEN 74204
FASTSTART UNIV SG MASTER (5 ML)(500 RXN) qPCR Roche 04913850001
FASTSTART ESSENTIAL GREEN DNA MASTER  qPCR Roche 06402712001
LIGHTCYCLER 480 - MULTIWELL PLATE 96 qPCR Roche 04729692001
NEBNext High-Fidelity 2X PCR Master Mix qPCR NEB M0541S

DOWNLOAD MATERIALS LIST

References

  1. Barish, S., Volkan, P. C. Mechanisms of olfactory receptor neuron specification in Drosophila. Wiley Interdisciplinary Reviews. Developmental Biology. 4, (6), 609-621 (2015).
  2. Pan, J. W., Volkan, P. C. Mechanisms of development and evolution of the insect olfactory system. Cell and Developmental Biology. 2, 130 (2013).
  3. Ramdya, P., Benton, R. Evolving olfactory systems on the fly. Trends in Genetics. 26, (7), 307-316 (2010).
  4. Bellen, H. J., Tong, C., Tsuda, H. 100 years of Drosophila research and its impact on vertebrate neuroscience: a history lesson for the future. Nature Reviews Neuroscience. 11, (7), 514-522 (2010).
  5. Knecht, Z. A., et al. Distinct combinations of variant ionotropic glutamate receptors mediate thermosensation and hygrosensation in Drosophila. eLife. 5, 44-60 (2016).
  6. Enjin, A., et al. Humidity sensing in Drosophila. Current Biology. 26, (10), 1352-1358 (2016).
  7. Li, Q., Barish, S., Okuwa, S., Volkan, P. C. Examination of endogenous rotund expression and function in developing Drosophila. olfactory system using CRISPR-Cas9-mediated protein tagging. G3: Genes|Genomes|Genetics. 5, (12), 2809-2816 (2015).
  8. Hueston, C. E., et al. Chromatin modulatory proteins and olfactory receptor signaling in the refinement and maintenance of fruitless expression in olfactory receptor neurons. PLoS Biology. 14, (4), 1002443 (2016).
  9. Li, Q., et al. Combinatorial rules of precursor specification underlying olfactory neuron diversity. Current Biology. 23, (24), 2481-2490 (2013).
  10. Li, Q., et al. A functionally conserved gene regulatory network module governing olfactory neuron diversity. PLoS Genetics. 12, (1), 1005780 (2016).
  11. Pan, J. W., et al. Patterns of transcriptional parallelism and variation in the developing olfactory system of Drosophila species. Scientific Reports. 7, (1), 8804 (2017).
  12. Pan, J. W., et al. Comparative analysis of behavioral and transcriptional variation underlying CO2 sensory neuron function and development in Drosophila. Fly. 11, (4), 239-252 (2017).
  13. Stern, D. L., et al. Genetic and transgenic reagents for Drosophila simulans, D. mauritiana, D. yakuba, D. santomea, and D. virilis. G3: Genes|Genomes|Genetics. 7, (4), 1339-1347 (2017).
Forbereder utvikle perifere Olfactory vev for molekylær og Immunohistochemical analyse i <em>Drosophila</em>
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Barish, S., Volkan, P. C. Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila. J. Vis. Exp. (136), e57716, doi:10.3791/57716 (2018).More

Barish, S., Volkan, P. C. Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila. J. Vis. Exp. (136), e57716, doi:10.3791/57716 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter