Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Поколение клоны клеток рака для визуализации Telomeric повтор содержащие РНК Терра выразил от одного теломер в живых клеток

doi: 10.3791/58790 Published: January 17, 2019

Summary

Здесь мы представляем протокол для создания клоны клеток рака, содержащий MS2 последовательности тег в одной subtelomere. Этот подход, опираясь на системе MS2-GFP, позволяет визуализации эндогенного стенограммы из telomeric повтор содержащие РНК (Терра) выразил от одного теломер в живых клетках.

Abstract

Теломеры транскрибируется, рождая telomeric повтор содержащих длиной некодирующих РНК (Терра), которой было предложено играть важную роль в биологии теломер, включая формирование гетерохроматин и гомеостаза Длина теломер. Последние результаты показали, что молекулы Терра также взаимодействовать с внутренней хромосомных регионов для регулирования экспрессии генов в мышиных эмбриональных стволовых (ES) клеток. С учетом этих доказательств, РНК флуоресценции в situ гибридизация (РНК-рыбы) анализы показали, что только подмножество Терра стенограммы локализовать на концах хромосомы. Лучшего понимания динамики молекул Терра поможет определить их функции и механизмы действия. Здесь мы описываем метод ярлык и визуализировать сингл теломеры Терра стенограммы в раковых клетках, с использованием системы MS2-GFP. С этой целью мы представляем протокол для создания стабильной клоны, используя линии клеток рака человеческого желудка AGS, содержащий MS2 последовательности, интегрированных в один subtelomere. Транскрипция Терра с меткой MS2 теломер приводит выражение с тегами MS2 Терра молекул, которые визуализируются микроскопии флуоресцирования клеток после совместного выражение MS2 RNA-связывая протеинов, сливается с GFP (MS2-ГФП). Этот подход позволяет исследователям изучить динамику одного теломеры Терра молекул в раковых клетках, и он может быть применен к другим клеточных линий.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Длиной некодирующих Терра РНК транскрибируется из региона subtelomeric хромосом и его транскрипции приступает к концам хромосомы, завершение в течение1,telomeric повторить тракта2. По этой причине Терра стенограммы состоят из subtelomeric производные последовательностей в конце их 5' и прекратить с telomeric повторяется (UUAGGG позвоночных)3. Важные роли были предложены для TERRA, включая формирование гетерохроматин теломеры4,5, ДНК репликации6, поощрение гомологичная рекомбинация среди хромосома заканчивается7,8 , 9, регулирующих теломер структуры10и теломер длина гомеостаза2,11,12,13. Кроме того Терра стенограммы взаимодействуют с многочисленными extratelomeric сайтов для регулирования экспрессии генов широко в мыши эмбриональных стволовых (ES) клетки14. С учетом этих доказательств, флуоресценции в situ гибридизация РНК (РНК-рыбы) анализы показали что только подмножество Терра стенограммы локализовать теломеры1,2,15. Кроме того Терра сообщалось в форме ядерного агрегатов, локализация на X и Y хромосомы в мыши клетки2,16. Эти результаты показывают, что Терра стенограммы пройти сложную динамику в ядре. Понимание динамики молекул Терра поможет определить их функции и механизмы действия.

MS2-GFP системы широко используется для визуализации молекул РНК в живых клетках различных организмов17,18. Эта система использовалась ранее тег и визуализировать сингл теломеры Терра молекул в S. cerevisiae12,19. С помощью этой системы, недавно было показано, что дрожжи Терра стенограммы локализовать в цитоплазме во время пост diauxic сдвиг фазы, предполагая, что Терра могут оказывать extranuclear функций20. Недавно мы использовали MS2-GFP системы для изучения одного теломеры Терра стенограммы в раковых клетках21. С этой целью мы заняты средство редактирования генома ТРИФОСФАТЫ/Cas9 для интеграции MS2 последовательности в одном теломер (теломеры 15q, далее Tel15q) и получены клоны, выражая MS2-тегами эндогенного Tel15q TERRA (Терра-MS2 клоны). Сопредседатель выражение GFP-кварцевое MS2 RNA-связывая белка (MS2-GFP), что признает и связывает MS2 РНК последовательности позволяет визуализации одного теломеры Терра стенограмм в живых клетках21. Цель Протокола, показанные здесь является подробно описать шаги, необходимые для создания клонов Терра-MS2.

Для создания клонов Терра-MS2, мс2 кассету интегрирован в регионе subtelomeric теломер 15q, ниже по течению Терра промоутер региона и транскрипции запуск сайта. Кассета MS2 содержит ген сопротивления неомицин, обрамленная аргона p сайты, и ее интеграции в subtelomere 15q осуществляется с помощью системы ТРИФОСФАТЫ/Cas922. После того, как выбираются трансфекции MS2 Кассетный сингл клоны и subtelomeric интеграции кассеты проверяется методом ПЦР, ДНК последовательности и Южные помарки. Позитивные клоны были заражены Cre выражая аденовирус, чтобы удалить маркер выделения в кассету, оставив только MS2 последовательности и один жидкий кислород p сайта на subtelomere 15q. Выражения с меткой MS2 Терра транскрипты от Tel15q проверяется по RT-ПЦР. И наконец, выражается MS2-GFP синтез белка в Терра-MS2 клоны через ретровирусной инфекции для того, чтобы визуализировать MS2-Терра стенограммы микроскопии флуоресцирования. Терра стенограммы могут быть легко обнаружены РНК-рыба и клеток изображений с использованием telomeric повтор конкретных зондов1,2,15,23. Эти подходы обеспечивают важную информацию о локализации всего населения Терра молекул в одну ячейку резолюции. Поколение клонов, содержащих MS2 последовательности в одном subtelomere позволит исследователей для изучения динамики сингл теломеры Терра стенограмм в живых клетках, которые помогут определить функции и механизмы действия Терра.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Выбор неомицин устойчивостью клонов

  1. Растут AGS клеток в среде Хам F-12_K (Kaighn), с 10% плода Bovine сыворотки (ФБС), 2 мм L-глютамина, пенициллин (0,5 единиц / мл среды) и стрептомицин (0,2 мкг / мл среды) при 37 ° C и 5% CO2. Transfect клетки на 50-60% слияния с sgRNA/Cas9, выражая вектора и MS2 кассету в 1:10 молярное соотношение21.
    Примечание: В параллельных эксперимент, проверьте эффективность трансфекции, transfecting GFP-выражая вектора (то есть, Cas9-GFP вектор). По крайней мере 60-70% эффективность трансфекции должно быть достигнуто.
  2. Следующий день, замените средство культивирования носитель, содержащий неомицин в конечной концентрации 0,7 мкг/мл (селективной среде).
    Примечание: Разделение клетки и заполнения их в селективной среде на следующий день после трансфекции ускорит процесс отбора. Все номера transfected клеток немедленно умрет. Если трансфекции осуществляется в 6 хорошо пластины, в этом случае каждой скважины на 60% слияния будет содержать около 0,7 х 106 клеток, на следующий день, что клетки могут быть разделены из одной скважины до 10 см блюдо содержащие селективной среде.
  3. Держите клетки в селективной среде для 7-10 дней, изменение среды, каждый из, или два дня, до тех пор, пока один клоны являются видимыми.
  4. Выбор ячейки клонов
    1. Подготовьте 96 хорошо пластины, содержащие 10 мкл трипсин 0.25% в каждой скважине.
      Примечание: Подготовить два 96 хорошо плиты в случае более чем 96 клоны, как ожидается, будут собраны.
    2. С использованием микроскопа отметьте положение каждого клона видимым в 10 см блюдо, делая точки в нижней части блюдо с помощью маркера. Каждая точка будет соответствовать колонии быть собраны.
    3. Замените средство культивирования с достаточно фосфат буфер солевой (PBS) образуют тонкую пленку жидкости на клонов и не позволить клетки сухой во время подбора клон.
    4. Выберите один колоний, с помощью пипетки 10 мкл. Присоедините наконечник, содержащий 5 мкл трипсина в колонию и медленно отпустите трипсина, который останется локализованным на колонии. Разрешить трипсина отсоединить клетки за 1 мин, затем очистите колонии с наконечником и всосите его вверх в наконечник.
      Примечание: Во время этой процедуры, листать блюдо немного на одной стороне, поэтому для уменьшения громкости PBS вокруг колонии взял поможет процесс комплектации, избегая разбавления трипсина вокруг колонии. С помощью клон кольцо может также помочь поднимая один клонов.
    5. Место клетки из колонии в колодец 96 хорошо пластины, содержащие 10 мкл трипсин 0.25%.
    6. Инкубировать 5 мин при комнатной температуре, а затем заполнить колодец с 150 мкл селективной среде (ветчина в F - 12K (Kaighn) средний с 10% FBS, 2 мм L-глютамином, пенициллин (0,5 единиц / мл среды), стрептомицин (0,2 мкг / мл среды) и содержащий неомицина на концентрации 0,7 мкг/мл.
      Примечание: Во время инкубации можно выбрать другие клоны. Рекомендуется выбрать столько клоны как можно скорее. Взял больше клонов тем выше будет вероятность выявления положительных.
    7. После того, как все клоны собраны и переданы в 96 хорошо пластины, позволяют клеткам расти в течение нескольких дней в селективной среде среднего Хэм в F - 12K (Kaighn), с 10% FBS, 2 мм L-глютамином, пенициллин (0,5 единиц / мл среды), стрептомицин (0,2 мкг / мл из среды) и содержащий неомицин при концентрации 0,7 мкг/мл при 37 ° C и 5% CO2, до достижения 90% слияния.
  5. Расщепление клонов
    1. Подготовить три 96 также пластины с покрытием с желатином, добавив 100 мкл желатина в колодец, Инкубируйте 30 мин при комнатной температуре, затем промыть два раза с PBS. Эти пластины будет использоваться для экстракции ДНК (ДНК плита) и клонов, блокирование (замораживание пластины).
      Примечание: Желатин будет способствовать вложение из клетки и ДНК к скважинам. В частности желатин покрытие позволит ДНК придерживаться в нижней части скважины во время экстракции ДНК и мыть процедур (см. ниже). Во время процедуры клон расщепление желательно использовать многоканальные пипетки.
    2. После того, как клоны достигают 90% слияния, аспирационная среднего от каждой скважины 96 хорошо плиты, мыть с PBS, 30 мкл трипсин 0.25% в колодец и инкубировать в течение 5 минут при 37 ° C.
      Примечание: Клоны будут растут с разной скоростью, которые также будет зависеть от числа клеток, взял за клон. Таким образом этот шаг будет выполняться в течение нескольких дней, когда различные клоны достигают 90% слияния.
    3. 70 мкл селективной среде за хорошо, срывать скопления клеток, закупорить вверх и вниз внутри скважины, а затем передать пластину gelatinized ДНК, заполнено автоматически с 120 мкл селективной среде за хорошо и 30 мкл gelatinized замерзания пластин преднаполненных именно 30 мкл, 100 мкл h 50 мкл среднего (без выделения).
    4. Место пластину ДНК в инкубаторе и позволяют клеткам расти при 37 ° C и 5% CO2 до 90% слияния.
    5. Добавить что 80 мкл ледяной свежеприготовленные 2 x замораживание среднего (80% FBS и 20% диметилсульфоксида (ДМСО)) в каждой скважине замораживанию пластину, добавить парафина (распыляется с 70% этиловом спирте) поверх плиты так, чтобы запечатать каждой скважины, поместите крышку на вершине и обернуть тарелку с алюминиевой фольгой. Поместите пластины для замораживания при температуре-80 ° C.
    6. 90 мкл селективной среде в колодец, оригинальные 96 хорошо пластины, содержащие клоны, которые были разделены и держать его в культуре до PCR скрининг результаты. Эта пластинка будет использоваться в качестве резервного пластины.

2. Скрининг устойчивых неомицин клонов

  1. Экстракции ДНК от 96 хорошо пластины ДНК.
    1. После того, как клоны, культивируемых в пластину ДНК достигают 90% слияния, вымыть 2 раза с PBS, а затем лизируют с 50 мкл буфера lysis (10 мм трис рН 7,5, 10 мм ЭДТА, 10 NaCl, 0,5% SDS и 1 мг/мл протеиназы K). Крышка с парафина, уплотнение каждый хорошо, положить крышку на обложке с Саран wrap и место при 37 ° C на ночь.
    2. 100 мкл холодного этанола (Et-OH) / раствор NaCl (0,75 М NaCl в 100% этиловом спирте) каждому хорошо и осадка за 6 часов или на ночь при комнатной температуре.
      Примечание: Протокол может быть приостановлена здесь.
    3. Удалите раствор Et-OH/NaCl, инвертирование пластину и мыть 3 раза с 200 мкл 70% этанола в колодец.
    4. 25 мкл раствора РНКазы A в дистиллированной воде и инкубировать при 37 ° C в течение 1 ч.
  2. Используйте 3 мкл геномной ДНК для амплификации PCR. Выполняйте PCR скрининг выбранного клонов с праймерами, отжиг внутри гена неомицина сопротивления и subtelomere 15q. Амплификации PCR осуществляется с помощью стандартных полимеразы ферментов и протоколы PCR21.
    Примечание: Условия PCR для грунтовки мс2 (MS2-subtel15q-грунт S и MS2 праймер как) и CTR грунтовки (CTR премьер S и CTR праймер как) являются следующие: 98 ° C 20 s шага denaturation, а затем 34 циклов на 98 ° C 10 s, 58° C 20 s, s 72 ° C 15 , используя полимераза фермент в 25 мкл реакция смеси (см. Таблицу материалы). Грунтовка последовательности, указаны в таблице 1.
  3. Запустите ПЦР-реакции на геле агарозы и извлекать диапазоны PCR, полученные из положительных клоны с использованием стандартного геля добыча процедур (см. Таблицу материалы для извлечения гель реагентов).
  4. Анализ ДНК последовательности продукта PCR гель извлекается для подтверждения наличия MS2 последовательности21.
    Примечание: Анализ последовательности могут выполняться с помощью грунтовки, используемые для PCR скрининг.
  5. Южная помарка скрининг ПЦР позитивные клонов
    1. Расти положительных на ПЦР и последовательности блокировки от оригинального 96 хорошо пластины (резервного пластины) 6 хорошо пластин в среде Хэм в F - 12K (Kaighn), с 10% FBS, 2 мм L-глютамином, пенициллин (0,5 единиц / мл среды), стрептомицин (0.2 мкг на клонов Мл среды) и содержащий неомицин при концентрации 0,7 мкг/мл при 37 ° C 5% CO2.
      Примечание: в качестве альтернативы, если некоторые из этих клонов были утрачены, размораживание их от одной из замораживания пластин (см. Протокол 2.6).
    2. Как только клонов при впадении 90% в 6 хорошо плиты, мыть ячейки с PBS и 250 мкл буфера lysis, содержащий 0,5 мкг протеиназы K за хорошо.
    3. Скрип клетки, клетки скребком и передачи lysate в 1,5 мл.
    4. Инкубируйте при 37 ° C для 16 h.
    5. Добавьте 1 mL 100% этанола, встряхнуть и позволить ДНК осадка по крайней мере 2 часа или на ночь при-20 ° C.
      Примечание: Протокол может быть приостановлена здесь.
    6. Спина в 13400 x g при 4 ° C на 10 мин, отбросить супернатанта и мыть окатышей с 70% этиловом спирте. Пусть воздух гранул сухого при комнатной температуре. В качестве альтернативы используйте вакуумные концентраторы.
    7. Ресуспензируйте ДНК окатышей в 50 мкл дистиллированной воды, содержащей РНКазы A и инкубировать 1 час при температуре 37 ° C.
    8. Дайджест 5-10 мкг геномной ДНК с помощью энзимов ограничения NcoI и BamHI (два независимых пищеварения) в 100 мкл реакции объем инкубации пищеварение реакции при 37 ° C на ночь.
    9. Запуск 4 мкл пищеварение на геле агарозы (0,8% агарозном) для подтверждения полного переваривания.
    10. Добавить 1/10 объема натрия ацетата 3 M раствор pH 5,2 и 2 томов 100% этанола в реакции пищеварение ограничения и инкубировать по крайней мере 2 h или на ночь при 20 ° C до осадок ДНК.
      Примечание: Протокол может быть приостановлена здесь.
    11. Центрифуга в 13400 x g при 4 ° C в течение 20 мин, отбросить supernatants и мыть окатышей с 70% этиловом спирте. Дайте высохнуть гранулы воздуха при комнатной температуре. В качестве альтернативы используйте вакуумные концентраторы.
    12. Ресуспензируйте окатышей в 20 мкл дистиллированной воды и нагрузки переваривается ДНК на 0,8% агарозном геле.
      Примечание: Для лучшего разрешения переваривается ДНК, подготовить гель минимум 15 см длиной и ночь работать при низком напряжении (̴30 вольт). Электрофорез, настройки должны быть оптимизированы.
    13. На следующий день, пятно гель с ДНК маркировки агентом, например бромид ethidium в конечной концентрации 1 мкл/10 мл, за 30 мин при комнатной температуре и сфотографироваться с правителем недалеко от геля на геле изображений инструмент.
    14. Значение передачи ДНК мембраны нейлона и выполнять мембраны гибридизации с зондом последовательность конкретных MS2, используя стандартные процедуры21.
    15. Оттепель клоны, которые являются положительными на ПЦР, ДНК, последовательности и Южной пятно от одной из двух пластин замораживания (см. следующий шаг).
  6. Размораживание клонов
    1. Подготовка одной тубы 15 мл 5 мл из подогретым Хэм F - 12 K (Kaighn) средний с 10% FBS, 2 мм L-глютамином, пенициллин (0,5 единиц / мл среды) и стрептомицин (0,2 мкг / мл среды) для каждого клона быть разморожен.
    2. Удалите один из замораживания пластин от-80 ° и 100 мкл подогретым F12K полного среднего хорошо содержащие положительные клон быть разморожен.
      Примечание: Эта процедура должна быть выполнена быстро и 96 также плиты должно уделяться сухого льда после того, как каждый клон таял, с тем чтобы другие клоны оставаться замороженными. Это особенно важно, если несколько клонов нужно разморозить от же 96 хорошо пластины.
    3. Трансфер клетки в 15 мл пробирку, содержащую 5 мл среднего и центрифуги на 800 x g 5 мин при комнатной температуре.
    4. Аспирационная среднего, Ресуспензируйте клетки в 500 мкл подогретым полного среднего F12K и передавать каждый клон один колодец 12 хорошо плиты.
  7. Ликвидация гена неомицина сопротивления от кассеты MS2 интегрирована в subtelomere 15q.
    1. Разрешить клоны расти от 12 хорошо пластины до 10 см блюдо в полной F12K среде.
      Примечание: Неомицин не должны включаться в средне-и если не указано иное.
    2. Добавьте Cre выражая аденовирус клетки культивировали в 10 см блюдо при впадении 70% 10 мл полного среднего F12K.
      Примечание: Использование Cre-GFP выражая аденовирус позволит оценки эффективности инфекции, которая должна подходить к 100%. Аденовирусы репликации дефектные будут потеряны после нескольких проходов в культуре.
    3. 48 часов после заражения, разбить ячейки в трех блюд 10 см. Два блюда будет использоваться для проверки удаления гена неомицина негативный выбор, клетки в неомицин содержащих среднего (первый блюдо) и на юге блот (второе блюдо).
    4. Культура третье блюдо, содержащие клон клеток замораживания и извлечение RNA.

3. Проверка Терра MS2 Стенограмма выражения RT-ПЦР

  1. После подтверждения удаления гена неомицина выполните общее извлечение RNA от Терра-MS2 клоны с использованием органических растворителей (раствор фенола и гуанидина isothiocynate)21.
    1. Ресуспензируйте РНК, извлеченные из 10 см блюдо в 100 мкл диэтиловым pyrocarbonate (DEPC) воды.
    2. Запуск 3 мкл РНК на denaturating (1% формальдегида содержащие) 1 x 3-(N-Morpholino) propanesulfonic кислоты (МОПЫ) гель для проверки концентрации и целостность РНК. Также анализ концентрации РНК с помощью спектрофотометра.
    3. Я использую 1 единица DNAse лечения 3 мкг РНК с DNAse я фермента в 60 мкл окончательной реакции тома.
    4. Инкубировать реакции в течение 1 ч при 37 ° C.
  2. Обратный анализ реакции и ПЦР транскрипции
    1. Добавьте следующие компоненты в свободной от нуклеиназы microcentrifuge трубку: 2 мкл праймер конкретных Терра 1 мкм, 1 мкл дНТФ смеси (по 10 мм), 6 мкл DNAse я лечил РНК (соответствующий ̴300ng РНК). Отрегулируйте громкость до 13 мкл с 4 мкл DEPC воды.
      Примечание: Для каждого РНК необходимо проанализировать, вторая трубка, содержащая же реагентов, но ссылка конкретных грунт, вместо конкретных грунтовка Терра, должен быть подготовлен.
    2. Нагрейте смесь до 65 ° C за 5 мин и инкубировать в ice для по крайней мере 1 мин.
    3. Собирать содержание трубы краткий центрифугированием и 4 мкл 5 X RT фермента буфера, 1 мкл 0,1 М Дитиотреитол (DTT), 1 мкл (4 единицы) битор РНКазы и 1 мкл обратной транскриптазы (см. Таблицу материалы).
    4. Проинкубируйте образцы при 42 ° C 60 мин, а затем использовать 2 мкл реакции RT для ПЦР анализа.
  3. Подготовьте смесь реакции ПЦР в окончательном объеме 20 мкл, состоящий из 10 мкл 2 x qPCR Мастер микс, 2 мкл cDNA шаблона, 1 мкл вперед праймера (10 мкм), 1 мкл обратного праймера (10 мкм) и 6 мкл воды.
  4. Выполните ПЦР-реакции в Термоциклер, используя стандартные протоколы21.

4. производство ретровирусом выражая MS2-GFP

  1. Чтобы создать MS2-GFP выражая ретровируса, transfect 80% вырожденная Феникс упаковка клетки с MS2-GFP синтез белка, выражая ретровируса вектор (pBabe-MS2-GFP PURO) и env гена, выражая вектора (например, pCMV-VSVG) с помощью молярное соотношение 4:1 два вектора.
  2. На следующий день замените свежей средних содержащий 10 мм натрия бутират среды культивирования (DMEM дополнена 10% FBS, 2 мм L-глютамина и пера/Strep).
  3. Проинкубируйте 8 ч при 37 ° C, 5% CO2, а затем заменить средство с свежими культивирования средой, из которой вирус будет собрана.
  4. После 48 ч удалите ретровируса содержащих среднего из клеток Феникс. Это средство может использоваться непосредственно для инфекции Терра-MS2 клонов, в этом случае фильтр среды через фильтр 0,45 мкм, добавить Полибрен (конечная концентрация 30 мкг/мл) и добавить его в клетки (в этом случае протокол продолжается в шаге 5). Кроме того ретровируса может химически осажденный в 50 мл трубки сокола, добавив 1/5й объем 50% ПЭГ-8000/900 мм раствор NaCl и инкубации на ночь при 4 ° C на колесе ротатора.
  5. На следующий день, Пелле ретровируса частицы центрифугированием в 2000 x г за 30 мин, удалить супернатант и Ресуспензируйте гранулы в F12K среде без сыворотки.
    Примечание: В 1/100th оригинального супернатанта тома можно высокомобильна частицы вируса. Тест на инфекции должны быть выполнены для того, чтобы проверить минимальный объем ретровируса, обязаны эффективно заразить клетки.

5. Визуализация Терра MS2 стенограммы в живых клеток

  1. Пластина Терра-MS2 клоны и WT AGS клетки в блюда с прозрачным дном. В день инфекции добавьте Полибрен в средних (конечная концентрация 30 мкг/мл) и выражая ретровируса MS2-GFP.
  2. После 24 часов удалить вирус содержащих среднего и добавить свежие среднего без фенола красный.
  3. Анализируйте клетки на инвертированного микроскопа с помощью параметра соответствующий микроскопа. Изображения клетки с 100 X или 60 X целей с большим числовой апертуры (1.4 X) и с помощью чувствительной камеры (EMCCD). Используете систему экологического управления для поддержания образцов при 37 ° C и 5% CO2 во изображений.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Рисунок 1 представляет собой обзор экспериментальной стратегии. Основные этапы протокола и ориентировочные сроки для поколения Терра-MS2 клонов в клетках AGS показываются (рис . 1А). В день 1 несколько скважин 6 хорошо плиты являются transfected MS2 кассету и sgRNA/Cas9, выражая вектора (показано на рисунке 1B). Две разные subtelomere руководство 15q специфичные РНК последовательности клонируются в Cas9 nickase выражая вектора pX335, генерации двух векторов sgRNA-pX335, которые совместно transfected с кассетой MS2. Один хорошо пластины можно transfected с GFP, выражая вектора, чтобы проверить эффективность трансфекции. На 2 день клетки trypsinized и переведены из одной скважины в 10 см блюдо, содержащие селективной среде. На 3 день среда следует изменить как наиболее untransfected клетки будет мертв. Клетки выращивают в отборе пока клоны являются видимыми и готовы быть собраны. В это время, клетки не должно быть trypsinized и культивирования среднего должны быть изменены каждые 1-2 дня для первой недели и затем каждые 2-3 дня после этого. После одного клоны являются видимыми, они собраны и переведены в 96 хорошо плиты, где они могут расти до достижения 80-90% слияния. На данный момент клоны разделены в 4 различных 96 хорошо пластины, которые отмечены на рисунке 1 с цветовым кодом. Как только клоны, культивируемых в пластину ДНК (зеленый) достигают 80% слияния, они будут анализироваться и геномной ДНК, извлеченные для PCR скрининг; клоны в пластину резервного копирования (синий) будут храниться в культуре до результаты скрининга PCR, в то время как красный замерзания пластин замороженные при температуре-80 ° C. Рисунок 2 B показывает представитель результаты PCR скрининг неомицин устойчивостью клонов. Для этого скрининга, используются два набора грунты: одна грунтовка пара (MS2 грунтовки) отжиг в пределах последовательности гена и subtelomere 15q неомицин используется для проверки наличия MS2 кассеты (представитель изображение грунтовки локализации показано в Рисунок 2A). Вторая пара (CTR грунтовки) отжига праймера на внутренней хромосомных регион используется для проверки наличия ложных отрицательных клонов (грунтовка последовательности указаны в таблице 1). Негативные клонов для интеграции кассеты должно быть отрицательным для амплификации MS2 грунты и позитивные для усиления CTR грунтовки. Технические проблемы в геномной ДНК добычи, обусловило отсутствие геномной ДНК или ее загрязнение будет препятствовать амплификации PCR от MS2 и CTR грунтовка реакций. В этих случаях связанных клонов можно повторно проверяться методом ПЦР после извлечения геномной ДНК из резервного пластины. Полос, полученные от MS2 грунтовки усиления позитивных клонов может быть извлечено гель и последовательного использования MS2 грунтовки, для того, чтобы подтвердить наличие десяти MS2 последовательностей.

Клоны, которые являются положительными в PCR скрининг культивировали от 96 хорошо резервного пластины (синюю тарелку на рис . 1) 6 хорошо пластины, а затем лизированы геномной ДНК извлечения и анализа Южная помарка. Рисунок 2 D показывает представитель изображения гель (слева) и мембраны, гибридизированных с радиоактивно меченных MS2 последовательности конкретного ПЭП (справа) Южная помарка скрининга ПЦР положительных клонов. Для подтверждения MS2 последовательности интеграции в subtelomere 15q геномной ДНК, извлеченные из каждого клона следует переваривается с двумя различными энзимами ограничения (NcoI и BamHI) в двух отдельных пищеварение реакциях. NcoI и BamHI энзимов ограничения подходят для проверки интеграции кассеты MS2 на subtelomere 15q. Могут также использоваться другие ферменты. Гель показывает полное переваривание геномной ДНК с помощью энзима ограничения BamHI, как указано наличие мазок. Результаты от Южная помарка указывают что один клон является положительным для интеграции MS2 кассеты на subtelomere 15q, в то время как несколько клонов показать несколько событий интеграции кассеты, как указано на наличие нескольких полос. Позитивные клон должны быть проанализированы второй Южная помарка после NcoI пищеварение геномной ДНК21. Представитель изображение кассету subtelomere 15q содержащие MS2 и положение BamHI и NcoI энзима ограничения сайтов это показано на рисунке 2C.

Клоны положительные ПЦР и Южная помарка анализы заражены Cre-GFP выражая аденовирус, чтобы удалить гена неомицина в кассету MS2. Рисунок 3 A изображает MS2-меткой subtelomere 15q до и после выражения Cre. Образ положительный для интеграции кассеты MS2 на subtelomere 15q клон инфицированных Cre-GFP, выражая аденовирус показано на рисунке 3B. Для полного удаления гена неомицина во всех клетках инфекции эффективность должна достичь примерно 100%. Как показано на рис . 3C, с целью проверки ликвидации гена неомицина, КРР-GFP зараженные клетки делятся на три пластины после 48 часов от инфекции. Одна пластина будет культивированный присутствии неомицина. Все ячейки в этой пластинке должен умереть в течение 6-7 дней. В второй пластины клетки будет позволено расти до 80-90% слияния в полной среды без выбора. На данный момент извлекается и проанализированы Южная помарка геномной ДНК. Третий пластина культивировали в полной средней разрешить подготовку замороженные запасы клона и извлечение RNA и RT-ПЦР анализ терра-MS2 Стенограмма выражения. Рисунок 3 D показывает представитель изображения Южная помарка анализов положительные клона до и после Cre-GFP инфекции. Гель агарозы ДНК (изображение слева) подтверждает полное переваривание геномной ДНК с помощью фермента NcoI ограничения. Южная помарка анализ проводился с помощью радиоактивно меченного MS2-последовательности конкретного ПЭП (изображение справа). Этот анализ подтверждает удаление гена неомицина. Присутствие мазок в образце Cre-GFP инфицированных подтверждает telomeric интеграции MS2 последовательностей. Положение места ограничения NcoI в пределах subtelomere 15q показано на рисунке 3A.

После подтверждения ликвидации сопротивление гена неомицина, клоны могут быть проверены за выражение Терра-MS2 стенограмм. С этой целью всего РНК извлекается из каждого клона и на геле denaturating швабры для подтверждения его целостности (рис . 4A). Рибосомной РНК полос должен быть виден на 4700 базах (28S рРНК) и 1900 баз (18S рРНК). Retrotranscription реакция осуществляется с помощью telomeric повтор специфического праймера и ссылка ген специфического праймера (Рисунок 4B, сверху) во время ПЦР анализ терра выражения выполняются с использованием двух наборов грунты: одна грунтовка пара отжига в пределах последовательности MS2 и subtelomere 15q последовательности; Вторая пара праймеров, отжиг в пределах subtelomere 15q. Грунтовка последовательности, указаны в таблице 1. На графике представлены на рисунке 4B показано RT-ПЦР анализ терра выражения из АГС WT клетки и два разных клонов Терра-MS2. Эти анализы подтверждают выражение Терра-MS2 стенограммы в двух клонов на уровнях, которые сопоставимы с Терра стенограммы выразил от subtelomere 15q в клетках WT. Эти данные указывают, что два клонов Терра-MS2 выбран пригодны для анализа Терра-MS2 стенограммы на живых клеток.

Для того, чтобы визуализировать Терра-MS2 стенограммы в живых клетках, выбранный клоны заражены ретровируса, выражая MS2-GFP синтез белка. Рисунок 5 A показана процедура создания MS2-GFP выражая ретровируса, как описано в шаге 4 протокола. AGS WT клетки и Терра-MS2 клоны инфицированы в блюда с прозрачным дном. После 24 часов от инфекции клетки анализируются микроскопии флуоресцирования. Специфика сигнал подтверждается наличие очагов Терра-MS2-GFP, обнаружен в ядре Терра-MS2 клонов и не AGS WT клеток (рис . 5B). В популяции MS2-GFP ожидается, выражая клетки, неоднородность MS2-GFP уровнях среди клеток и клеток, выражая низкий уровень должен быть выбран для анализа изображений. Кроме того выражая клетки MS2-GFP могут быть отсортированы по СУИМ микроскопии предварительного анализа для того, чтобы собирать субпопуляцию клеток, выражая низкий уровень GFP. Ранее мы обнаружили, Терра-MS2-GFP очагов в 40% до 60% клеток AGS Терра-MS2 клоны21. В этих клетках одного до четырех очагов Терра-MS2-ГФП были образы в клетку. Терра-MS2-GFP очагов, показаны различные размеры и динамика может быть обнаружены21. Терра-MS2 клонов может использоваться для изучения динамики сингл теломеры Терра стенограммы в живых клетках. В качестве примера этого приложения рис . 5C показывает представитель изображения из анализа микроскопии Терра-MS2 клона, выражая MS2-GFP синтез белка и теломер связывающий белок, который TRF2 сливается с mCherry для того чтобы Визуализация с тегами MS2 Терра стенограммы и теломеры в живых клетках. Используя этот подход, мы ранее наблюдали что Терра-MS2-GFP очагов локализации совместно с теломер в 44% клеток, указав, что Терра стенограммы только временно совместно локализации с концами хромосомы в АГС клетки21.

Figure 1
Рисунок 1 . Обзор экспериментальных стратегии и ориентировочные сроки для поколения Терра-MS2 клонов в клетках AGS. A) показаны шаги, описанные в протокол и ориентировочные сроки для отбора Терра-MS2 клонов. Клетки являются transfected в 6 хорошо пластины с линеаризованного MS2 кассету и sgRNA/Cas9, выражая вектора. Цветовой код используется для различения пластину ДНК резервного пластины и замерзания пластин, указанные в разделе протокол. B) MS2 кассета состоит из 800 последовательности длиной subtelomere 15q nt, следуют 10 повторов последовательностей MS2 и гена сопротивления неомицин, обрамленная аргона p сайтов и завершается с 300 долго telomeric повторить тракта nt 3' концу. sgRNA/Cas9 выражая вектора были получены путем клонирования subtelomere руководство 15q специфичные РНК последовательности в pX335 вектора с использованием BbsI ограничение сайта21,22. Были созданы два разных sgRNA-pX335 векторов и 1:1 смесь двух векторов использовался для transfection. Последовательности sgRNAs, указаны в таблице 1. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2 . Представитель изображения PCR и Южной пятно Скрининг устойчивых неомицин клонов. A) представитель образ subtelomere 15q содержащие MS2 кассеты. Указывается положение праймеров мс2 (MS2-subtel15q-грунт S и MS2 праймер как), используемые для PCR скрининг. LoxP сайты, присутствующие в кассете показаны красным цветом. B) представитель изображения PCR скрининг неомицин устойчивостью клонов, используя два набора грунты, мс2 грунтовки и CTR грунтовки (CTR премьер S и CTR праймер как). C) представитель образ subtelomere 15q содержащие MS2 кассеты. BamHI и NcoI места ограничения и MS2 зонд, используемый для проверки Южная помарка показаны. D) слева: 10 мкг геномной ДНК за клонов были переваривается с BamHI и запустить на геле агарозы. Снимок сделан после ночь на 30 вольт. Справа: геномной ДНК, переваривается с BamHI энзима ограничения был передан мембрана положительно заряженный нейлона и гибридизированных с зондом радиоактивно меченного последовательность конкретных MS2. Красный флажок указывает ожидаемый размер Позитив Бэнд. Красная стрелка указывает один положительный клон. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3 . Ликвидация неомицин сопротивления гена и проверки экспериментов. A) представитель образ subtelomere 15q содержащие MS2 кассету до и после выражения Cre. MS2 конкретных зонд, используемый для анализа Южная помарка и NcoI энзима ограничения сайтов показываются. LoxP сайты, присутствующие в кассете показаны красным цветом. B) анализ микроскопии флуоресцирования Терра-MS2 клона инфицированных Cre-GFP выражая аденовирус. Показано представитель изображение, приобретенных в одной фокальной плоскости. МВД, обилие инфекции, является соотношение между количество используемых для инфекции вирусов и количество клеток хозяина. Линейки: 30 мкм C) обзор экспериментальных стратегия используется для проверки ликвидации гена неомицина. Cre-GFP зараженные клетки делятся на три пластины после 48 часов для i) негативный выбор, ii) Южная помарка анализов и iii) подготовка запасов замороженных клеток и извлечение RNA от инфекции. D) Южная помарка анализ терра-MS2 клонировать до и после Cre-GFP аденовирусной инфекции. 10 мкг геномной ДНК были переваривается с энзима ограничения NcoI. Геля агарозы подтверждает, что полное переваривание достигается в обоих клонов (слева). Усваивается геномной ДНК был передан мембрана положительно заряженный нейлона и гибридизированных с помощью зонда последовательность конкретных MS2. Полная ликвидация гена неомицина подтверждается отсутствие конкретной группы. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 4
Рисунок 4 . RT-ПЦР анализ Тель15q-TERRA и Тель15Q-TERRA-МС2 стенограммы выражение. A) представитель изображение MOPS геля, показаны всего РНК, извлеченные из АГС WT клетки и Терра-MS2 клонов. Соответствующие диапазоны для рибосомной РНК 28S и 18S указаны. B) Top: схема MS2-меткой subtelomere 15q выражая Терра стенограмм. Праймеры для TERRA retrotranscription (желтый) и ПЦР анализ Tel15q-Терра (синий) и Tel15q-MS2 Терра (красный) отображаются. LoxP сайт отображается красным цветом. Внизу: Клоны RT-ПЦР анализ экспрессии Tel15q-TERRA и Tel15q-MS2 Терра стенограммы в AGS WT клетки и Терра-MS2. p < 0,05, непарные t-теста. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 5
Рисунок 5 . Живые клетки изображений анализ терра-MS2 клонов. A) обзор процедуры производить MS2-GFP выражая ретровируса, как описано в шаге 4 протокола. Схема с тегами MS2 subtelomere 15q и Терра стенограммы, признанные MS2-GFP синтез белка показано справа. B) представитель флуоресценции микроскопия image AGS WT и два Терра-MS2 клоны, выражая MS2-GFP. Терра-MS2-GFP очагов обозначаются стрелками. Изображения были приобретены с помощью спиннинг диск Конфокальный микроскоп, оснащенный камерой EMCCD. Изображения были получены с помощью 100 X / 1,46 Апохромат цель в тепловизионной камере поддерживается при 37 ° C с 5% CO2. 488 лазер был использован как источник света. Линейки: 5 мкм. C) живой клетки изображений анализ терра-MS2-GFP очагов и TRF2-mCherry помечены теломеры. Показано совместное локализации событий между Терра-MS2-GFP фокус и один теломер. Изображения были приобретены как и B, используя 488 и 520 лазеров в качестве источника света. Максимальная проекция z эксперимента стек, выполняется за один раз, проявленную точки покадровой изображений эксперимента. Линейки: 5 мкм. пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Грунтовка имя Грунтовка последовательность Применение
MS2-subtel15q-грунт S TGCATTAAAGGGTCCAGTTG Грунтовка MS2 вперед используется для PCR Скрининг устойчивых неомицин клонов
MS2 праймер как CCTAACTGACACACATTCCACAGA MS2 грунт обратный используется для PCR Скрининг устойчивых неомицин клонов
CTR грунт S TGT ACG ОСО ACA CAG ТГК TG CTR грунт вперед используется в PCR Скрининг устойчивых неомицин клонов
CTR праймер как GCT GGA ОБЩ TGG ACA ГКГ A CTR грунт обратный используется в PCR Скрининг устойчивых неомицин клонов
Tel15q-S1 GCAGCGAGATTCTCCCAAGC Смысл грунтовка используется для обнаружения Tel15q и Tel15q-MS2 Терра выражение ПЦР
hTel15q-AS TAACCACATGAGCAATGTGGGTG Антисмысловые грунтовка используется для обнаружения Tel15q и Tel15q-MS2 Терра выражение ПЦР
Tel15q-MS2-AS ATGTTTCTGCATCGAAGGCATTAGG Антисмысловые грунтовка используется для обнаружения Tel15q-MS2 Терра выражение ПЦР
Терра-RT-грунт CCCTAACCCTAACCCTAACCCTAACCCTAA Грунтовка для retrotranscription Терра стенограммы
sgRNA1 TTGGGAGAATCTCGCTGGCC Последовательность краткое руководство РНК 1 клонирован в векторе pX335 и используется для прямого Cas9 nickase энзимную активность в subtelomere 15q
sgRNA2 TGCATTAAAGGGTCCAGTTG Последовательность краткое руководство РНК 2 клонированные в векторе pX335 и используется для прямого Cas9 nickase энзимную активность в subtelomere 15q

Таблица 1 : Список грунты, используемые в данном исследовании. Предоставляется список праймеры и последовательности sgRNAs, используемые в настоящем Протоколе. Последовательности, 5' к 3'.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

В этой статье мы представляем метод для создания человеческих раковых клеток клоны, содержащие MS2 последовательности в рамках subtelomere 15q. Используя эти клоны, мс2 тегами Терра молекул, трансляции из subtelomere 15q распознаются микроскопии флуоресцирования выражением совместного MS2-GFP синтез белка. Этот подход позволяет исследователям изучить динамику Терра, выразил от одного теломер в живых клетках21. В этом протоколе Терра-MS2 клоны выбираются в строке ячейки AGS, который представляет собой интересную модель систему для изучения Терра, поскольку выражение Терра является upregulated в человеческого желудка рак образцы24. Тем не менее протокол, описанные здесь могут быть адаптированы для отбора Терра-MS2 клонов в других клеточных линий. MS2 последовательностей можно в принципе поощрять интеграцию в subtelomere отличается от теломер 15q с помощью конкретных MS2 кассету и ТРИФОСФАТЫ стратегии. В методе, представленные здесь чтобы увеличить специфика интеграции22используются фермента nickase Cas9 и двойной руководство РНК. Используя эту стратегию, общий 2% положительных клонов, как ожидается, определены в клетках AGS. Другие версии Cas9 фермента может испытываться в попытке увеличить успех скорость отбора клонов25. Кроме того следующие шаги протокола являются критические принимать во внимание для обеспечения максимальной эффективности селекции клонов:

I) с целью увеличить шансы отбора Терра-MS2 клонов, это важно для достижения высокой transfection эффективности MS2 кассету и ТРИФОСФАТЫ векторов. Плохо transfected клеток линии скорее всего потребует несколько раундов трансфекции, клон отбора и отбора для того чтобы выбрать позитивные клонов.

II) важно определить точную концентрацию неомицин использовать для отбора клонов. Действительно использование низкой концентрации препарата приведет к ложных положительных клонов в то время как высокая концентрация может исключать выявление положительных клонов. Неомицин концентрации, указанные в настоящем Протоколе смертоносных AGS клетки в течение 6-7 дней от добавления в среде культивирования.

III) собирание клон является важным шагом. Действительно, во время этой процедуры требуется только один клоны выбираются. По этой причине, колоний, которые являются слишком близко к друг другу следует избегать во избежание смешивания клеток от различных клонов, обусловило выбор смешанного населения клонов, которые могут содержать MS2 последовательности интегрировать несколько геномной сайтов. Эти события должны быть определены в ходе скрининга Южная помарка.

IV количество геномной ДНК, извлеченные из притока 96 хорошо ДНК пластины (протокол 2) оценивается в около 5 мкг и должно хватить на экране каждый клон ПЦР и Южный blotting с пищеварением энзима одного ограничения. Однако для того, чтобы подтвердить интеграции кассеты на ожидаемый теломер, будет важно, чтобы экран каждый клон, Южная помарка, переваривание геномной ДНК с двумя различными энзимами ограничения. С этой целью как указано в протоколе, клоны положительных в PCR скрининг должно быть культивировали в 6 хорошо пластин. Количество геномной ДНК, извлеченные из колодца 6 хорошо плиты будет достаточно для по крайней мере два пищеварения ограничения, необходимые для анализа Южная помарка.

В протоколе, описанные здесь, мс2 последовательности интегрированы в subtelomere 15q для целого ряда причин: i) Терра промоутер региона и Терра транскрипции начала сайты были определены на этом subtelomere26,27; II) Терра выражение из subtelomere 15q был проверен с помощью в vitro методы4,27,28,,2930; III виртуализированных регион subtelomeric хромосомы 15q и содержит уникальный регион, прилегающих к telomeric повторить путей, которые могут быть направлены для интеграции MS2-кассета21. PCR и Южная помарка подходы были разработаны для того, чтобы подтвердить один интеграции MS2 последовательностей в пределах subtelomere 15q в Терра-MS2 клонов. Было бы интересно выполнять также ДНК-рыба эксперименты на хромосоме спреды для того, чтобы визуализировать хромосомных локализации MS2 последовательностей в фиксированных метафаза хромосом. Однако, длина 10xMS2 последовательностей (450 bp) предусматривает использование очень короткий ПЭП по сравнению с зондами, обычно используемая в экспериментах по ДНК-рыбы на хромосоме спреды (бактериальных искусственных хромосом (Bac), cosmids или плазмиды)31. Эта техническая задача помешало нам Визуализация последовательностей MS2 на хромосоме спреды, которые представляет ограничение протокола. Один дополнительные ограничения метода является время и усилия, необходимые для выбора Терра-MS2 клонов. Кроме того требуются конкретные лаборатории созданы и оборудования для использования вирусов, радиоактивных материалов и микроскопии анализов.

Метод, описанный здесь могут быть реализованы для поколения Терра-MS2 клонов в различных клеточных линиях для того, чтобы определить динамику Терра в различных биологических контекстах, таких, как во время теломер дисфункции или сотовой старение, помогая нам понять функция от Терра в этих процессах. Интересным событием этого подхода будет поколения Терра-MS2 клонов, содержащие Тето повторяет интегрированной в конкретных subtelomere, включая теломер MS2-тегами. Выражение тетр белка, сливается с флуоресцентный белок (т.е. mCherry) позволит визуализации этого конкретного теломер в живых клетках32. Этот подход позволит расследование ли человека Терра стенограммы локализовать и действовать в СНГ в TERRA, переписывание теломер и хромосомы или в транс от переезда в другие хромосомы. Этот вопрос в биологии Терра предстоит уточнить.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы заявляют не конкурирующих финансовых интересов

Acknowledgments

Мы благодарны сотрудникам передовой визуализации объекта CIBIO в университете Тренто и Фондом BioOptics свет микроскопия на Макс ф Perutz лабораторий (MFPL) в Вене. Исследований, приведших к эти результаты получил финансирование от Mahlke-Оберманн Stiftung и седьмой рамочной программы Европейского союза для исследований, технологических разработок и демонстрации соглашению Грант не 609431 в ЕС. EC поддерживается Рита Леви Монтальчини стипендий от итальянского министерства образования университета и исследования (MIUR).

Materials

Name Company Catalog Number Comments
AGS cells - - Gift from Christian Baron (Université de Montréal).
F12K Nut Mix 1X GIBCO 21127022 Culturing medium for AGS cells
L-Glutamine  CORNING MT25005CI Component of cell culturing medium
Penicillin Streptomycin Solution CORNING 30-002-CI Component of cell culturing medium
Fetal Bovine Serum Sigma Aldrich F2442 Component of cell culturing medium
DMEM 1X GIBCO 21068028 culturing medium for phoenix cell
CaCl2 Sigma Aldrich C1016 used in phoenix cell transfection
HEPES Sigma Aldrich H3375 used in phoenix cell transfection (HBS solution)
KCl Sigma Aldrich P9333 used in phoenix cell transfection (HBS solution)
Dextrose Sigma Aldrich D9434 used in phoenix cell transfection (HBS solution)
NaCl Sigma Aldrich S7653 used in phoenix cell transfection (HBS solution) and retrovirus precipitation
Na2HPO4 Sigma Aldrich S3264 used in phoenix cell transfection (HBS solution)
TRYPSIN EDTA SOLUTION 1X CORNING 59430C used in cell split
DPBS 1X GIBCO 14190250 Dulbecco's Phosphate Buffered Saline
DMSO Sigma Aldrich D8418 Component of cell freezing medium (80% FBB and 20% DMSO)
G-418 Disulphate Formedium G4185 selection drug for 
Gelatin solution Bioreagent Sigma Aldrich G1393 cotaing of 96 well DNA plate and freezing plate
Tris-base Fisher BioReagents 10376743 Component of Cell lysis buffer for genomic DNA extraction
EDTA Sigma Aldrich E6758 Component of Cell lysis buffer for genomic DNA extraction
SDS Sigma Aldrich 71729 Component of Cell lysis buffer for genomic DNA extraction
Proteinase K Thermo Fisher AM2546 Component of Cell lysis buffer for genomic DNA extraction
RNAse A Thermo Fisher 12091021 RNA degradation during DNA extraction
Agarose Sigma Aldrich A5304 DNA gel preparation
Atlas ClearSight Bioatlas BH40501 Stain reagent used for detecting DNA and RNA samples in agarose gel
ethanol Fisher BioReagents BP28184 DNA precipitation
Sodium Acetate  Sigma Aldrich 71196 Used for DNA precipitation at a 3M concentration pH5.2
Wizard SV Gel and PCR clean-Up system Promega A9282 Extraction of PCR fragments from agarose gel during PCR screening of neomycin positive clones
Trizol AMBION 15596018 Organic solvent used for RNA extraction
Dnase I THERMO SCIENTIFIC 89836 degradation of genomic DNA from RNA 
dNTPs mix Invitrogen 10297018 used in RT and PCR reactions
DTT Invitrogen 707265ML used in RT reactions
diethyl pyrocarbonate Sigma Aldrich D5758 used to inactivate RNAses in water (1:1000 dilution)
Ribolock Thermo Fisher EO0381 RNase inhibitor
MOPS Sigma Aldrich M9381 preparation of RNA gel
Paraformaldehyde Electron Microscopy Sciences 15710 preparation of denaturating RNA gel (1% PFA in 1x MOPS)
Superscript III Reverse transcriptase Invitrogen 18080-093 Retrotranscription reaction
Pfu DNA polymerase (recombinant) Thermo Scientific EP0501 PCR reaction
2X qPCRBIO SyGreen Mix Separate-ROX PCR BIOSYSTEMS PB 20.14 qPCR reaction
Cre-GFP adenovirus https://medicine.uiowa.edu/vectorcore 1174-HT used to infect TERRA-MS2 clones in order to remove the neomycn gene
Sodium Butyrate Sigma Aldrich B5887 used to promote retrovirus particles production in phoenix cells
PEG8000 Sigma Aldrich 89510 Precipitation of retrovirus partcles
35µ-Dish Glass Bottom Ibidi 81158 used in live cell imaging analyses of TERRA-MS2 clones

DOWNLOAD MATERIALS LIST

References

  1. Azzalin, C. M., Reichenbach, P., Khoriauli, L., Giulotto, E., Lingner, J. Telomeric repeat containing RNA and RNA surveillance factors at mammalian chromosome ends. Science. 318, (5851), 798-801 (2007).
  2. Schoeftner, S., Blasco, M. A. Developmentally regulated transcription of mammalian telomeres by DNA-dependent RNA polymerase II. Nature Cell Biology. 10, (2), 228-236 (2008).
  3. Diman, A., Decottignies, A. Genomic origin and nuclear localization of TERRA telomeric repeat-containing RNA: from Darkness to Dawn. FEBS Journal. (2017).
  4. Arnoult, N., Van Beneden, A., Decottignies, A. Telomere length regulates TERRA levels through increased trimethylation of telomeric H3K9 and HP1alpha. Nature Structural & Molecular Biology. 19, (9), 948-956 (2012).
  5. Montero, J. J., et al. TERRA recruitment of polycomb to telomeres is essential for histone trymethylation marks at telomeric heterochromatin. Nature Communications. 9, (1), 1548 (2018).
  6. Beishline, K., et al. CTCF driven TERRA transcription facilitates completion of telomere DNA replication. Nature Communications. 8, (1), 2114 (2017).
  7. Arora, R., et al. RNaseH1 regulates TERRA-telomeric DNA hybrids and telomere maintenance in ALT tumour cells. Nature Communications. 5, 5220 (2014).
  8. Balk, B., et al. Telomeric RNA-DNA hybrids affect telomere-length dynamics and senescence. Nature Structural & Molecular Biology. 20, (10), 1199-1205 (2013).
  9. Graf, M., et al. Telomere Length Determines TERRA and R-Loop Regulation through the Cell Cycle. Cell. 170, (1), 72-85 (2017).
  10. Lee, Y. W., Arora, R., Wischnewski, H., Azzalin, C. M. TRF1 participates in chromosome end protection by averting TRF2-dependent telomeric R loops. Nature Structural & Molecular Biology. (2018).
  11. Moravec, M., et al. TERRA promotes telomerase-mediated telomere elongation in Schizosaccharomyces pombe. EMBO Reports. 17, (7), 999-1012 (2016).
  12. Cusanelli, E., Romero, C. A., Chartrand, P. Telomeric noncoding RNA TERRA is induced by telomere shortening to nucleate telomerase molecules at short telomeres. Molecular Cell. 51, (6), 780-791 (2013).
  13. Moradi-Fard, S., et al. Smc5/6 Is a Telomere-Associated Complex that Regulates Sir4 Binding and TPE. PLoS Genetics. 12, (8), e1006268 (2016).
  14. Chu, H. P., et al. TERRA RNA Antagonizes ATRX and Protects Telomeres. Cell. 170, (1), 86-101 (2017).
  15. Lai, L. T., Lee, P. J., Zhang, L. F. Immunofluorescence protects RNA signals in simultaneous RNA-DNA FISH. Experimental Cell Research. 319, (3), 46-55 (2013).
  16. Zhang, L. F., et al. Telomeric RNAs mark sex chromosomes in stem cells. Genetics. 182, (3), 685-698 (2009).
  17. Gallardo, F., Chartrand, P. Visualizing mRNAs in fixed and living yeast cells. Methods in Molecular Biology. 714, 203-219 (2011).
  18. Querido, E., Chartrand, P. Using fluorescent proteins to study mRNA trafficking in living cells. Methods in Cell Biology. 85, 273-292 (2008).
  19. Cusanelli, E., Chartrand, P. Telomeric noncoding RNA: telomeric repeat-containing RNA in telomere biology. Wiley Interdisciplinary Reviews: RNA. 5, (3), 407-419 (2014).
  20. Perez-Romero, C. A., Lalonde, M., Chartrand, P., Cusanelli, E. Induction and relocalization of telomeric repeat-containing RNAs during diauxic shift in budding yeast. Current Genetics. (2018).
  21. Avogaro, L., et al. Live-cell imaging reveals the dynamics and function of single-telomere TERRA molecules in cancer cells. RNA Biology. 1-10 (2018).
  22. Ran, F. A., et al. Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell. 154, (6), 1380-1389 (2013).
  23. Yamada, T., et al. Spatiotemporal analysis with a genetically encoded fluorescent RNA probe reveals TERRA function around telomeres. Scientific Reports. 6, 38910 (2016).
  24. Deng, Z., et al. Formation of telomeric repeat-containing RNA (TERRA) foci in highly proliferating mouse cerebellar neuronal progenitors and medulloblastoma. Journal of Cell Science. 125, (Pt 18), 4383-4394 (2012).
  25. Casini, A., et al. A highly specific SpCas9 variant is identified by in vivo screening in yeast. Nature Biotechnology. 36, (3), 265-271 (2018).
  26. Nergadze, S. G., et al. CpG-island promoters drive transcription of human telomeres. RNA. 15, (12), 2186-2194 (2009).
  27. Porro, A., et al. Functional characterization of the TERRA transcriptome at damaged telomeres. Nature Communications. 5, 5379 (2014).
  28. Farnung, B. O., Brun, C. M., Arora, R., Lorenzi, L. E., Azzalin, C. M. Telomerase efficiently elongates highly transcribing telomeres in human cancer cells. PLoS One. 7, (4), e35714 (2012).
  29. Flynn, R. L., et al. Alternative lengthening of telomeres renders cancer cells hypersensitive to ATR inhibitors. Science. 347, (6219), 273-277 (2015).
  30. Scheibe, M., et al. Quantitative interaction screen of telomeric repeat-containing RNA reveals novel TERRA regulators. Genome Research. 23, (12), 2149-2157 (2013).
  31. Bolland, D. J., King, M. R., Reik, W., Corcoran, A. E., Krueger, C. Robust 3D DNA FISH using directly labeled probes. Journal of Visualized Experiments. (78), (2013).
  32. Masui, O., et al. Live-cell chromosome dynamics and outcome of X chromosome pairing events during ES cell differentiation. Cell. 145, (3), 447-458 (2011).
Поколение клоны клеток рака для визуализации Telomeric повтор содержащие РНК Терра выразил от одного теломер в живых клеток
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Avogaro, L., Oss Pegorar, C., Bettin, N., Cusanelli, E. Generation of Cancer Cell Clones to Visualize Telomeric Repeat-containing RNA TERRA Expressed from a Single Telomere in Living Cells. J. Vis. Exp. (143), e58790, doi:10.3791/58790 (2019).More

Avogaro, L., Oss Pegorar, C., Bettin, N., Cusanelli, E. Generation of Cancer Cell Clones to Visualize Telomeric Repeat-containing RNA TERRA Expressed from a Single Telomere in Living Cells. J. Vis. Exp. (143), e58790, doi:10.3791/58790 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter