Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Génération de Clones de cellules de Cancer de visualiser contenant répétition télomérique RNA TERRA exprimée à partir d’un seul télomères dans les cellules vivantes

doi: 10.3791/58790 Published: January 17, 2019

Summary

Nous présentons ici un protocole visant à générer des clones de cellules de cancer contenant une balise de séquence MS2 à un subtélomère unique. Cette approche, en s’appuyant sur le système de MS2-GFP, permet la visualisation des transcriptions endogènes de télomérique répétition contenant RNA (TERRA) exprimée à partir d’un seul télomères dans les cellules vivantes.

Abstract

Télomères sont transcrits, donnant lieu à télomérique contenant répéter longtemps non codantes RNAs (TERRA), qui ont été proposées à jouer un rôle important en biologie du télomère, y compris la formation de l’hétérochromatine et homéostasie longueur du télomère. Des découvertes récentes ont révélé que les molécules TERRA interagissent aussi avec les régions chromosomiques internes pour réguler l’expression génique dans les cellules souches embryonnaires (ES) de souris. Conformément à cette preuve, RNA fluorescence in situ hybridation RNA-analyses ont montré que seul un sous-ensemble de TERRA transcriptions localiser aux extrémités des chromosomes. Une meilleure compréhension de la dynamique des molécules TERRA aidera à définir leurs fonctions et mécanismes d’action. Nous décrivons ici une méthode pour étiqueter et visualiser les transcriptions TERRA single-télomères dans les cellules cancéreuses en utilisant le système de MS2-GFP. Dans ce but, nous présentons un protocole visant à générer des clones stables, à l’aide de la lignée de cellules cancéreuses humaines estomac AGS, contenant des séquences de MS2 intégrés à un subtélomère unique. Transcription de TERRA du télomère MS2-tag se traduit par l’expression de molécules TERRA MS2-tag qui sont visualisées par microscopie de fluorescence des cellules vivantes sur la co-expression d’une protéine de liaison à l’ARN MS2 fusionnée à la GFP (MS2-GFP). Cette approche permet aux chercheurs d’étudier la dynamique des molécules TERRA single-télomères dans les cellules cancéreuses, et elle peut être appliquée à d’autres lignées cellulaires.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Le TERRA de RNA longue non codantes est transcrit à partir de la région subtélomériques des chromosomes et sa transcription se dirige vers les extrémités des chromosomes, se terminant au sein du tractus répétition télomérique1,2. Pour cette raison, transcriptions TERRA se composent de séquences subtélomériques dérivées à leur extrémité 5' et se terminer par des répétitions télomériques (UUAGGG chez les vertébrés)3. Important de rôles ont été proposées pour TERRA, incluant la formation de l’hétérochromatine télomères4,5, DNA réplication6, promotion de la recombinaison homologue entre les chromosomes termine7,8 , 9, réglementer les télomères structure10et télomères longueur homéostasie2,11,12,13. En outre, transcriptions TERRA interagissent avec nombreux sites d’extratelomeric à réguler l’expression des gènes très répandue dans les souris de cellules souches embryonnaires (ES)14. Conformément à ces témoignages, RNA fluorescence in situ hybridation (RNA-poisson) analyses ont montré que seul un sous-ensemble des transcriptions TERRA localiser à télomères1,2,15. En outre, TERRA a été signalé pour former des agrégats nuclear localisation sur les chromosomes X et Y dans les cellules de souris2,16. Ces résultats indiquent que les transcriptions TERRA subissent une dynamique complexe dans le noyau. Comprendre la dynamique des molécules TERRA aidera à définir leurs fonctions et mécanismes d’action.

Le système MS2-GFP a été largement utilisé pour visualiser des molécules d’ARN dans les cellules vivantes de divers organismes17,18. Ce système a servi antérieurement de tag et de visualiser des molécules TERRA single-télomère dans S. cerevisiae12,19. Grâce à ce système, il a été montré récemment que les transcriptions TERRA de levure localiser dans le cytoplasme en phase post-diauxique Maj, suggérant que TERRA peut exercer des fonctions extranucléaire20. Nous avons récemment utilisé le système MS2-GFP pour étudier les transcriptions TERRA single-télomères dans les cellules de cancer du21. Dans ce but, nous avons employé l’outil d’édition du génome CRISPR/Cas9 pour intégrer des séquences MS2 à un télomère unique (télomérique 15 q, ci-après Tel15q) et clones exprimant MS2-tag endogènes Tel15q TERRA (TERRA-MS2 clones) a obtenu. La co-expression d’une protéine de liaison à l’ARN MS2 fusionnée à la GFP (MS2-GFP) qui reconnaît et se lie MS2 RNA séquences permet visualisation des transcriptions TERRA single-télomère vie cellules21. Le but du protocole illustré ici est de décrire en détail les étapes requises pour la génération de clones de TERRA-MS2.

Pour générer des clones de TERRA-MS2, une cassette de MS2 est intégrée au sein de la région subtélomériques télomérique 15 q, en aval du site TERRA de promoteur région et transcription de départ. La cassette de MS2 contient un gène de résistance de néomycine flanqué de sites de saumon fumé-p et son intégration à subtélomère 15 q est effectuée en utilisant le système CRISPR/Cas922. Après transfection de la MS2 cassette, seul les clones sont sélectionnés et subtélomériques intégration de la cassette est vérifiée par PCR, ADN, séquençage et Southern blot. Les clones positifs sont infectés par un adénovirus exprimant le Cre afin de supprimer le marqueur de sélection dans la cassette, laissant seulement les séquences MS2 et un site unique de saumon fumé-p à la subtélomère 15 q. Expression des transcriptions de MS2-tag TERRA de Tel15q est vérifiée par la RT-qPCR. Enfin, la protéine de fusion de GFP-MS2 est exprimée chez TERRA-MS2 clones par infection rétrovirale afin de visualiser les transcriptions MS2-TERRA en microscopie par fluorescence. Transcriptions TERRA peuvent être facilement détectées par RNA-poissons et imagerie de cellules vivantes avec répétition télomérique spécifiques sondes1,2,15,23. Ces approches fournissent des informations importantes sur la localisation de la population totale des molécules TERRA à résolution de cellule unique. La génération de clones contenant des séquences de MS2 à un subtélomère unique permettra aux chercheurs d’étudier la dynamique des transcriptions TERRA single-télomères dans les cellules vivantes, qui aideront à définir la fonction et les mécanismes d’action de TERRA.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Sélection des Clones résistants néomycine

  1. La croissance de cellules AGS dans le milieu F-12_K du jambon (Kaighn) additionné de 10 % de sérum bovin fœtal (SVF), 2 mM de L-glutamine, pénicilline (0,5 unités par mL de milieu) et la streptomycine (0,2 µg / mL de milieu) à 37 ° C et 5 % de CO2. Transfecter les cellules à une confluence de 50-60 % avec le sgRNA/Cas9 exprimant le vecteur et la cassette de MS2 à un 01:10 rapport molaire21.
    Remarque : Dans une expérience parallèle, vérifier l’efficacité de transfection par transfectants un vecteur exprimant le GFP (c.-à-d. Cas9-GFP vecteur). Au moins 60-70 % efficacité de transfection devrait être atteints.
  2. Le jour suivant, remplacer le milieu de culture avec un milieu contenant la néomycine à concentration finale de 0,7 µg/mL (milieu sélectif).
    NOTE : Fractionnement des cellules et leur ensemencement en milieu sélectif, le lendemain de transfection permettra d’accélérer le processus de sélection. Toutes les cellules non transfectées mourront immédiatement. Si la transfection est effectuée en 6 assiettes bien, auquel cas chaque puits à un 60 % confluence contiendrait environ 0,7 x 106 cellules, le jour suivant, que les cellules peuvent être divisées dans un puits unique à un milieu sélectif contenant plat de 10 cm.
  3. Garder les cellules dans un milieu sélectif pendant 7 à 10 jours, en changeant de milieu, tout le monde ou deux jours, jusqu'à ce que seul les clones sont visibles.
  4. Cueillette des clones de cellules
    1. Préparer une plaque bien 96 contenant 10 µL de 0,25 % de trypsine dans chaque puits.
      NOTE : Préparez deux 96 plaques bien dans le cas où plus de 96 clones sont censés être cueillies.
    2. Avec l’utilisation d’un microscope, marquer la position de chaque clone visible dans le plat de 10 cm en faisant un point au fond du plat à l’aide d’un marqueur. Chaque point correspond à une colonie à prélever.
    3. Remplacer le milieu de culture avec juste assez Phosphate Buffered Saline (PBS) pour former un mince film de liquide sur les clones et pas sécher les cellules pendant la cueillette de clone.
    4. Prélever des colonies unique à l’aide d’une pipette de 10 µL. Fixez l’embout contenant 5 µL de trypsine à la colonie, puis relâcher lentement la trypsine qui restera localisée sur la colonie. Permettre la trypsine détacher les cellules pendant 1 min, puis grattez la colonie avec la pointe et sucer dans la pointe.
      Remarque : Au cours de cette procédure, renversant le plat un peu d’un côté donc pour diminuer le volume de PBS autour de la colonie étant choisi aidera le processus de cueillette en évitant les diluer la trypsine autour de la colonie. À l’aide d’un anneau de clone peut également aider à ramasser des clones unique.
    5. Placer les cellules de la colonie dans un puits de la plaque bien 96 contenant 10 µL de 0,25 % de trypsine.
    6. Incuber 5 min à température ambiante, puis remplir le puits avec 150 µL de milieu sélectif (moyenne F - 12K de Ham (Kaighn) additionné de 10 % FBS, 2 mM de L-glutamine, pénicilline (0,5 unités par mL de milieu), streptomycine (0,2 µg / mL de milieu) et contenant la néomycine à une concentration de 0,7 µg/mL.
      Remarque : Au cours de la période d’incubation autres clones peuvent être choisies. Il est recommandé de sélectionner des clones autant que possible. Les clones plus sont cueillis plus les chances seront d’identifier les critères positifs.
    7. Une fois que tous les clones sont sélectionnés et transférés dans la plaque 96 puits, laisser les cellules à se développer pendant plusieurs jours dans un milieu sélectif F - 12K de Ham (Kaighn) additionné avec 10 % FBS, 2 mM de L-glutamine, pénicilline (0,5 unités par mL de milieu), streptomycine (0,2 µg / mL du milieu) et contenant la néomycine à une concentration de 0,7 µg/mL à 37 ° C et 5 % de CO2, jusqu’au confluent de 90 %.
  5. Fractionnement des clones
    1. Préparer trois plaques bien 96 enduits avec de la gélatine en ajoutant 100 µL de gélatine / puits, incuber 30 min à température ambiante, puis laver deux fois avec du PBS. Ces plaques serviront pour l’extraction d’ADN (plaque d’ADN) et clone gel (gel plaques).
      NOTE : Gélatine favorisera l’attachement des cellules et de l’ADN dans les puits. En particulier, l’enduit de gélatine permettra à l’ADN de coller au fond des puits lors de l’extraction de l’ADN et laver les procédures (voir ci-dessous). Pendant la procédure de fractionnement du clone, il est conseillé d’utiliser une pipette multicanaux.
    2. Une fois que les clones atteignent 90 % confluence, aspirer le milieu de chaque puits de la plaque 96 puits, laver avec du PBS, ajouter 30 µL de 0,25 % de trypsine / puits et incuber pendant 5 min à 37 ° C.
      NOTE : Clones grandiront à des rythmes différents, qui dépendront aussi du nombre de cellules cueillies par clone. Ainsi, cette étape se fera au cours des plusieurs jours quand les différents clones atteignent 90 % confluence.
    3. Ajouter 70 µL de milieu sélectif par puits, perturber des amas de cellules en pipettant également monter et descendre dans les puits, puis transférer 30 µL de la 100 µL dans la plaque ADN gélatinisée préremplie avec 120 µL de milieu sélectif par bien et 30 µL à l’esprit de préremplie plaques gel gélatinisé h 50 µL de milieu (sans sélection).
    4. Placer la plaque de l’ADN dans l’incubateur et laisser les cellules à se développer à 37 ° C et 5 % de CO2 jusqu’au confluent de 90 %.
    5. Ajouter 80 µL de glacée fraîchement préparés 2 x gel moyen (80 % FBS et 20 % le diméthylsulfoxyde (DMSO)) dans chaque puits de la plaque de gel, ajouter parafilm (pulvérisé avec l’éthanol à 70 %) sur le dessus de la plaque de manière à sceller chaque puits, placez le couvercle sur le dessus et envelopper la plaque avec du papier aluminium. Placer les plaques de congélation à-80 ° C.
    6. Ajouter 90 µL de milieu sélectif / puits de la plaque 96 puits d’origine contenant les clones qui ont été divisés et gardez-le en culture jusqu’au PCR résultats de dépistage. Cette plaque servira de plaque de sauvegarde.

2. dépistage des Clones résistants néomycine

  1. Extraction de l’ADN de la plaque d’ADN bien 96.
    1. Une fois que les clones cultivés dans la plaque de l’ADN atteint 90 % confluence, laver 2 fois avec du PBS, puis lyse avec 50 µL de tampon de lyse (10 mM Tris pH 7.5, 10 mM EDTA, 10 mM NaCl, SDS de 0,5 % et de protéinase K 1 mg/mL). Couvrir la plaque avec du parafilm, chaque puits, mettez le couvercle d’étanchéité sur, recouvrir d’une pellicule saran et placer une nuit à 37 ° C.
    2. Ajouter 100 µL d’éthanol froid (Et-OH) / solution de NaCl (0,75 M de NaCl dans 100 % d’éthanol) pour chaque bien et précipiter pendant 6 heures ou toute la nuit à température ambiante.
      Remarque : Le protocole peut être suspendu ici.
    3. Enlever la solution de NaCl-OH/Et en inversant la plaque et laver 3 fois avec 200 µL d’éthanol à 70 % par puits.
    4. Ajouter 25 µL de solution de RNAse A dans l’eau distillée et incuber à 37 ° C pendant 1 h.
  2. Utiliser 3 µL de l’ADN génomique pour l’amplification par PCR. Effectuer le dépistage de la PCR des clones sélectionnés à l’aide d’amorces recuit au sein du gène de résistance de néomycine et subtélomère 15 q. L’amplification par PCR est réalisée à l’aide d’enzymes polymérase standard et de protocoles PCR21.
    Remarque : Des conditions d’amplification pour amorces MS2 (MS2-subtel15q-primer-S et MS2 amorce comme) et amorces CTR (CTR prime S et apprêt CTR comme) sont les suivants : 98 ° C pendant 20 s comme étape de dénaturation et ensuite 34 cycles à 98 ° C 10 s, 58° C, 20 s, 72 ° C 15 s , à l’aide d’enzyme polymérase dans un 25 µL réaction mélanger (voir Table des matières). Séquences d’amorces sont indiqués dans le tableau 1.
  3. Exécuter des réactions de PCR sur gel d’agarose et extraire les bandes PCR obtenus à partir des clones positifs à l’aide de procédés d’extraction gel standard (voir Tableau des matériaux réactifs d’extraction de gel).
  4. Effectuer des analyses de séquençage de l’ADN du produit PCR extraites à l’aide de gel pour la confirmation de la présence des séquences MS221.
    Remarque : Les analyses de séquence peuvent être effectuées en utilisant les amorces utilisées pour le dépistage de la PCR.
  5. Dépistage de la tache méridionale clones positifs PCR
    1. Cultiver les clones positifs à la PCR et le séquençage dépistage de la plaque de 96 puits original (la plaque de sauvegarde) à 6 plats dans Ham F - 12K (Kaighn) additionné avec 10 % FBS, 2 mM de L-glutamine, pénicilline (0,5 unités par mL de milieu), streptomycine (0,2 µg / mL de milieu) et contenant la néomycine à une concentration de 0,7 µg/mL à 37 ° C 5 % CO2.
      Remarque : Par ailleurs, si certaines de ces clones ont été perdues, décongeler parmi les plaques de gel (voir protocole 2.6).
    2. Une fois que les clones sont à 90 % confluent dans la plaque 6 puits, laver les cellules avec du PBS et ajouter 250 µL de tampon de lyse contenant 0,5 µg protéinase K / puits.
    3. Grattez les cellules à l’aide d’un grattoir de cellules et transférer le lysat dans un tube de 1,5 mL.
    4. Incuber à 37 ° C pendant 16 h.
    5. Ajouter 1 mL d’éthanol à 100 %, agiter vigoureusement et laisser l’ADN précipité au moins 2 h ou jusqu’au lendemain à-20 ° C.
      Remarque : Le protocole peut être suspendu ici.
    6. Filer à 13 400 g à 4 ° C pendant 10 min, jeter le liquide surnageant et laver les boulettes avec l’éthanol à 70 %. Laissez l’air pellets sécher à température ambiante. Vous pouvez également utiliser une pompe à vide.
    7. Remettre en suspension les boulettes d’ADN dans 50 µL d’eau distillée contenant la RNAse A et incuber pendant 1 heure à 37 ° C.
    8. Digérer les 5-10 µg d’ADN génomique à l’aide d’enzymes de restriction NCOL et BamHI (deux digestions indépendantes) en volume de réaction 100 µL en incubant les réactions de digestion à 37 ° C pendant la nuit.
    9. Exécuter 4 µL de la digestion sur gel d’agarose (0.8 % d’agarose) pour confirmation de la digestion complète.
    10. Ajouter 1/10 volume de sodium acétate 3M solution pH 5,2 et 2 volumes d’éthanol à 100 % pour les réactions de digestion de restriction et incuber pendant au moins 2 heures ou toute la nuit à-20 ° C à précipiter l’ADN.
      Remarque : Le protocole peut être suspendu ici.
    11. Centrifuger à 13 400 g à 4 ° C pendant 20 min, jeter le surnageant et laver les boulettes avec l’éthanol à 70 %. Laisser les boulettes à l’air sec à température ambiante. Vous pouvez également utiliser une pompe à vide.
    12. Remettre les boulettes dans 20 µL d’eau distillée et charger l’ADN digéré sur un gel d’agarose 0,8 %.
      Remarque : Pour une meilleure résolution de l’ADN digéré, préparer un gel au moins 15 cm de long et exécuter toute la nuit à basse tension (v ̴30). L’électrophorèse mis en place doit être optimisé.
    13. Le lendemain, souillez le gel avec un ADN étiquetage, comme le bromure d’éthidium à concentration finale de 1 µL/10 mL, pendant 30 min à température ambiante et prendre une photo avec une règle proche du gel sur un gel d’imagerie instrument.
    14. Définir le transfert d’ADN d’une membrane de nylon et effectuer le membrane hybridation avec une sonde de séquences spécifiques de MS2 à l’aide de procédures standard21.
    15. Décongeler les clones qui sont positifs à la PCR, ADN, séquençage et Southern blot de l’une des deux plaques gel (voir étape suivante).
  6. Dégel des clones
    1. Préparer un tube de 15 mL contenant 5 mL de préchauffé Ham F - 12 K moyen (de Kaighn) additionné de 10 % FBS, 2 mM de L-glutamine, pénicilline (0,5 unités par mL de milieu) et la streptomycine (0,2 µg / mL de milieu) pour chaque clone à décongeler.
    2. Enlevez une des plaques congélation de-80 ° et ajouter 100 µL de milieu complet de pré chauffé F12K dans la cupule contenant le clone positif à décongeler.
      Remarque : Cette procédure doit être effectuée rapidement et la plaque 96 puits devrait être placés sur glace sèche après que chaque clone est décongelée, afin de permettre les autres clones à restent gelés. Cela est particulièrement important si plusieurs clones doivent être décongelés dans la même assiette bien 96.
    3. Les cellules de transfert dans le tube de 15 mL contenant 5 mL de milieu et centrifuger à 800 x g pendant 5 min à température ambiante.
    4. Aspirez le milieu, remettre en suspension les cellules de 500 µL de milieu de F12K complet pré chauffé et transférer chaque clone à un seul puits d’une plaque bien 12.
  7. Élimination du gène de résistance à la néomycine de la cassette de MS2 intégré à subtélomère 15 q.
    1. Laissez les clones passera d’une plaque bien 12 à un plat de 10 cm au milieu de F12K complet.
      Remarque : Néomycine ne devrait pas être inclus dans le milieu sauf indication contraire.
    2. Ajouter l’adénovirus exprimant le Cre aux cellules cultivées dans un plat de 10 cm à 70 % confluence dans 10 mL de milieu de F12K complet.
      NOTE : À l’aide d’un adénovirus exprimant sa Cre-GFP permettra l’évaluation de l’efficacité de l’infection, qui devrait avoisiner les 100 %. L’adénovirus de réplication défectueux seront perdus après quelques passages dans la culture.
    3. 48 heures après l’infection, fractionner les cellules dans les trois plats de 10 cm. Deux plats seront utilisés pour la vérification de la suppression de gène de néomycine par sélection négative, les cellules de néomycine contenant de plus en plus moyen (premier plat) et par Southern blot (second plat).
    4. Culture le troisième plat contenant le clone pour la congélation de cellules et d’extraction de l’ARN.

3. vérification d’Expression de transcription de TERRA-MS2 par RT-qPCR

  1. Après vérification du retrait de gène de néomycine, effectuer l’extraction d’ARN totale de clones de TERRA-MS2 à l’aide de solvants organiques (solution isothiocynats de phénol et de guanidine)21.
    1. Remettre en suspension l’ARN extrait d’un plat de 10 cm dans 100 µL d’eau de diéthyl pyrocarbonate (DEPC).
    2. Exécuter 3 µL d’ARN sur un gel de dénaturation (1 % contenant du formaldéhyde) 1 x 3-(N-Morpholino) le produit acide (MOPS) afin de vérifier la concentration et l’intégrité de l’ARN. Analyse également la concentration d’ARN à l’aide d’un spectrophotomètre.
    3. Traiter 3 µg d’ARN à la DNAse I à l’aide de 1 unité de DNAse I enzyme dans réactionnel final de 60 µL.
    4. Incubez la réaction pendant 1 h à 37 ° C.
  2. Inverser les analyses de réaction et de qPCR transcription
    1. Ajoutez les composants suivants dans un tube de microcentrifuge exempte de nucléase : 2 µL d’une amorce spécifique de 1 µM TERRA, 1 µL du mélange dNTPs (10 mM), 6 µL de DNAse j’ai imprégnées d’ARN (correspondant à l’ARN ̴300ng). Réglez le volume à 13 µL avec 4 µL d’eau DEPC.
      Remarque : Pour chaque ARN pour être analysés, un deuxième tube contenant les mêmes réactifs mais une amorce spécifique de référence, au lieu des amorces spécifiques de TERRA, doit être préparé.
    2. Porter le mélange à 65 ° C pendant 5 min et laisser incuber dans la glace pendant au moins 1 minute.
    3. Recueillir le contenu des tubes de centrifugation courte et ajouter 4 µL d’enzyme 5 X RT tampon, 1 µL 0,1 M le dithiothréitol (DTT), de 1 µL (4 unités) de l’inhibiteur de RNAse et 1 µL de la transcriptase inverse (voir Table des matières).
    4. Incuber les échantillons à 42 ° C pendant 60 min, puis utilisez 2 µL de la réaction de RT pour les analyses de qPCR.
  3. Préparer le mélange réactionnel de qPCR dans un volume final de 20 µL composé de 10 µL du mélange principal de 2 x qPCR, 2 µL de matrice d’ADNc, 1 µL d’apprêt avant (10 µM), 1 µL d’apprêt inverse (10 µM) et 6 µL d’eau.
  4. Effectuer la réaction de qPCR dans un thermocycleur à l’aide de protocoles standard21.

4. production d’un rétrovirus exprimant de MS2-GFP

  1. Pour générer des rétrovirus exprimant MS2-GFP, transfecter 80 % phoenix confluentes emballage des cellules avec une protéine de fusion de GFP-MS2 exprimant des rétrovirus vecteur (pBabe-MS2-GFP PURO) et un gène env exprimant vecteur (par exemple le cmvp-VSVG) à l’aide d’un rapport molaire de 1:4 les deux vecteurs.
  2. Le jour suivant, remplacez frais moyen butyrate de sodium 10mM contenant le milieu de culture (DMEM supplémenté de 10 % de BF, 2 mM de L-glutamine et Pen/Strep).
  3. Incuber pendant 8 h à 37 ° C, 5 % de CO2, puis remplacez le milieu par milieu de culture frais d'où le virus sera obtenue.
  4. Après 48 h, enlever le milieu contenant du rétrovirus provenant des cellules de phoenix. Ce milieu peut être utilisé directement pour l’infection de clones de TERRA-MS2, auquel cas le support de filtration à travers un filtre de 0,45 µm, ajouter polybrene (concentration finale de 30 µg/mL) et l’ajouter aux cellules (dans ce cas le protocole continue à l’étape 5). Par ailleurs, rétrovirus peut être précipité dans un tube falcon de 50 mL en ajoutant 1/5ème volume de 50 % PEG-8000/900 mM NaCl solution et en incubant pendant la nuit à 4 ° C sur une roue de rotator.
  5. Le lendemain, particules rétrovirus culot de centrifugation à 2 000 x g pendant 30 min, retirez le surnageant et resuspendre le culot dans un milieu sans sérum F12K.
    Remarque : Les particules de virus peuvent être remis en suspension dans 1/100ème du surnageant volume original. Un test de l’infection doit être effectué afin de vérifier le volume minimal de rétrovirus pour infecter efficacement les cellules.

5. visualisation de TERRA-MS2 transcrits dans les cellules vivantes

  1. Plaque de clones de TERRA-MS2 et cellules WT AGS dans les plats à fond de verre. Le jour de l’infection, ajoute polybrene au milieu (concentration finale de 30 µg/mL) et le rétrovirus exprimant MS2-GFP.
  2. Après 24 heures, jeter le support contenant le virus et ajouter un milieu frais sans rouge de phénol.
  3. Analyser les cellules au microscope inversé en utilisant le réglage approprié de microscope. Image de cellules avec un 100 X ou 60 X, objectif à grande ouverture numérique (1. 4 X) et à l’aide d’une caméra sensible (EMCCD). Utiliser un système de contrôle de l’environnement pour maintenir les échantillons à 37 ° C et 5 % de CO2 en imagerie.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Figure 1 représente une vue d’ensemble de la stratégie expérimentale. Les principales étapes du protocole et un calendrier indicatif pour la génération de TERRA-MS2 clones dans les cellules AGS apparaissent (Figure 1A). Au jour 1, plusieurs puits d’une plaque 6 puits sont transfectées avec la cassette de MS2 et sgRNA/Cas9 exprimant des vecteurs (illustrés à la Figure 1B). Deux séquences de 15 q spécifiques guide RNA subtélomère différents sont clonés dans le Cas9 exprimant nickase pX335 vector, générant deux vecteurs de sgRNA-pX335 qui sont conjointement transfectées avec la cassette de MS2. Un puits de la plaque peut être transfecté avec un GFP exprimant vecteur pour vérifier l’efficacité de transfection. Au jour 2, les cellules sont trypsinisées et transférés d’un puits unique dans une boîte de 10 cm contenant un milieu sélectif. Au 3e jour, moyenne doit être changé car plus celllulaire cellules seront morts. Les cellules sont cultivées en sélection jusqu'à ce que les clones sont visibles et prêts à être cueillis. Pendant ce temps, les cellules ne devraient pas être trypsinisées et de milieu de culture doit être changé tous les jours 1-2 pour la première semaine et puis chaque 2-3 jours plus tard. Une fois que les clones unique sont visibles, ils sont cueillis et transférés dans une plaque 96 puits où ils sont autorisés à se développer jusqu'à atteindre 80-90 % de confluence. À ce stade, les clones sont divisés en 4 96 puits plaques différentes, qui sont indiquées à la Figure 1 avec un code couleur. Une fois que les clones cultivés dans la plaque de l’ADN (vert) atteint 80 % confluence, elles sont lysées et l’ADN génomique extrait pour l’ACP de dépistage ; les clones dans la plaque de sauvegarde (bleu) seront conservés dans la culture jusqu'à ce que les résultats de la présélection de PCR, alors que les plaques de gel rouges sont congelés à-80 ° C. Figure 2 B montre des résultats représentatifs d’un dépistage de la PCR de clones résistant à la néomycine. Pour cette projection, deux ensembles d’amorces sont utilisées : une amorce paire (MS2 amorces) recuit au sein de la séquence de 15 q néomycine gène et subtélomère est utilisée pour vérifier la présence de la cassette de MS2 (une image représentative de la localisation des amorces est indiquée en Figure 2A). Une deuxième paire (amorces CTR) amorce recuit à une région chromosomique interne est utilisé pour vérifier la présence de fausses clones négatifs (séquences d’amorces sont indiqués dans le tableau 1). Des clones négatives pour l’intégration de la cassette devraient être négatif à une amplification des amorces de la MS2 et positive à l’amplification des amorces de la CTR. Des problèmes techniques dans l’extraction d’ADN génomique résultant en l’absence de l’ADN génomique ou de sa contamination n’empêcherait l’amplification par PCR de réactions d’apprêt MS2 et CTR. Dans ces cas, les clones impliqués peuvent subir un dépistage par PCR sur l’extraction de l’ADN génomique de la plaque de sauvegarde. Bandes obtenues de l’amplification des amorces MS2 clones positifs peuvent être extraites à l’aide de gel et séquencée en utilisant les amorces MS2, afin de confirmer la présence de séquences de dix MS2.

Les clones qui sont positifs au dépistage de la PCR sont cultivées à partir de la plaque bien sauvegarde 96 (la plaque d’immatriculation bleue dans la Figure 1) pour une plaque 6 puits, puis lysées pour l’extraction d’ADN génomique et analyses par transfert Southern. Figure 2 D montre des images représentatives d’un gel (à gauche) et la membrane hybridé avec marqués radioactivement MS2 séquence sonde spécifique (à droite) d’une projection de Southern blot clones positifs de PCR. Pour la confirmation de l’intégration de séquences MS2 à subtélomère 15 q, ADN génomique extrait de chaque clone devrait être digéré avec deux enzymes de restriction différentes (NCOL et BamHI) dans deux réactions distinctes de la digestion. Les enzymes de restriction NCOL et BamHI ne conviennent pas pour la vérification de l’intégration de cassette MS2 à subtélomère 15 q. Autres enzymes peuvent également être utilisées. Le gel montre une digestion complète de l’ADN génomique à l’aide de l’enzyme de restriction BamHI, comme en témoigne la présence d’un frottis. Les résultats du Southern blot indiquent qu’un clone est positif pour l’intégration de la cassette de MS2 au subtélomère 15 q, tandis que plusieurs clones multiples événements d’intégration de la cassette, comme en témoigne la présence de plusieurs bandes. Un clone positif devrait être analysé par un deuxième transfert Southern NCOL digestion de l’ADN génomique21. Une image représentative d’une cassette de subtélomère 15 q contenant la MS2 et la position des sites d’enzyme de restriction BamHI et NCOL sont illustrés à la Figure 2C.

Les clones positifs pour PCR et Southern blot analyses sont infectées par un adénovirus exprimant sa Cre-GFP afin de supprimer le gène de la néomycine présent dans la cassette de MS2. Figure 3 A dépeint un MS2-le tag subtélomère 15 q avant et après l’expression de la Cre. Une image d’un clone positif pour l’intégration de cassette MS2 à subtélomère 15 q infectés par un Cre-GFP exprimant des adénovirus sont illustré à la Figure 3B. Pour une élimination complète du gène néomycine dans toutes les cellules, l’efficacité de l’infection devrait atteindre environ 100 %. Comme illustré à la Figure 3C, afin de vérifier l’élimination du gène néomycine, cellules de Cre-GFP infecté sont divisés en trois plaques après 48 heures de l’infection. Une plaque sera être mis en culture en présence de néomycine. Toutes les cellules de cette plaque devraient mourir dans les 6-7-jours. Dans une deuxième assiette, cellules pourront grandir dans un milieu complet sans sélection au confluent de 80 à 90 %. À ce stade, l’ADN génomique est extrait et analysé par Southern blot. La troisième plaque est cultivée dans un milieu complet pour permettre la préparation des stocks figés du clone et d’extraction de l’ARN et la RT-qPCR analyses d’expression de transcription de TERRA-MS2. Figure 3 D montre des images représentatives des analyses par transfert Southern d’un clone positif avant et après l’infection de Cre-GFP. Gel d’agarose de l’ADN (image de gauche) confirme la digestion complète de l’ADN génomique à l’aide de l’enzyme de restriction NCOL. Une analyse Southern a effectué un marqué radioactivement MS2-séquence sonde spécifique (image de droite). Cette analyse confirme la suppression du gène néomycine. La présence d’un frottis de l’échantillon de Cre-GFP infecté confirme l’intégration télomérique des séquences MS2. La position des sites de restriction NCOL au sein de la subtélomère 15 q est indiquée dans la Figure 3A.

Une fois l’élimination du gène de résistance à la néomycine est confirmée, les clones peuvent être testés pour l’expression des transcriptions de TERRA-MS2. Dans ce but, l’ARN total est extrait de chaque clone et courir sur un gel de VADROUILLES de dénaturation de confirmer son intégrité (Figure 4A). ARN ribosomique bandes doivent être visibles à 4 700 bases (ARNr 28 s) et 1 900 bases (ARNr 18 s). Réaction fut est effectuée en utilisant une amorce spécifique répétition télomérique et amorce de gène-spécifique de référence (Figure 4B, en haut) tout en qPCR analyses d’expression TERRA sont effectuées au moyen de deux ensembles d’amorces : une amorce paire de recuit au sein de la séquence de MS2 et la séquence subtélomère 15 q ; une deuxième paire d’amorces recuit au sein de la subtélomère 15 q. Séquences d’amorces sont indiqués dans le tableau 1. Le graphique présenté dans la Figure 4B montre RT-qPCR analyses d’expression TERRA de cellules AGS WT et deux différents clones de TERRA-MS2. Ces analyses confirment l’expression de TERRA-MS2 transcrits dans les deux clones à des niveaux qui sont comparables aux transcriptions TERRA exprimées à partir de subtélomère 15 q dans les cellules WT. Ces données indiquent que les deux clones de TERRA-MS2 sélectionnés sont adaptés pour les analyses de TERRA-MS2 transcriptions par imagerie de cellules vivantes.

Afin de visualiser les transcriptions de TERRA-MS2 dans les cellules vivantes, les clones sélectionnés sont infectés par un rétrovirus exprimant la protéine de fusion de GFP-MS2. Figure 5 A montre la procédure pour générer des rétrovirus exprimant MS2-GFP, tel que décrit à l’étape 4 de la protocole. Les cellules AGS WT et TERRA-MS2 clones sont infectés dans les plats à fond de verre. Après 24h de l’infection, les cellules sont analysés par microscopie à fluorescence. La spécificité du signal est confirmée par la présence de foyers de TERRA-MS2-GFP détectés dans le noyau des clones de TERRA-MS2 et non dans les cellules AGS WT (Figure 5B). Dans une population de MS2-GFP exprimant des cellules, l’hétérogénéité en termes de niveaux de MS2-GFP entre les cellules est prévu et cellules exprimant des niveaux faibles devraient être choisis pour les analyses d’imagerie. Par ailleurs, les cellules exprimant MS2-GFP peuvent être triés par analyses préalables microscopie FACS afin de recueillir la sous-population de cellules exprimant des niveaux faibles de GFP. Précédemment, nous avons détecté des foyers de TERRA-MS2-GFP dans 40 à 60 % des cellules de l’AGS TERRA-MS2 clones21. Dans ces cellules, une à quatre foyers de TERRA-MS2-GFP ont été imagées par cellule. Foyers de TERRA-MS2-GFP montrant la dynamique et tailles différentes peuvent être détectés21. TERRA-MS2 clones peuvent être utilisés pour étudier la dynamique des transcriptions TERRA single-télomères dans les cellules vivantes. Comme exemple de cette application, Figure 5C montre des images représentatives des analyses de microscopie d’un clone de TERRA-MS2 exprimant la protéine de fusion de GFP-MS2 et la protéine liant le télomère de que trf2 fusionnée à mCherry afin visualiser les transcriptions TERRA MS2-tag et des télomères dans les cellules vivantes. En utilisant cette approche, nous avons déjà observé que des foyers de TERRA-MS2-GFP localiser conjointement avec des télomères dans 44 % des cellules, indiquant que transcriptions TERRA seulement transitoirement co localiser avec extrémités chromosomiques dans les cellules AGS21.

Figure 1
Figure 1 . Vue d’ensemble de la stratégie expérimentale et un calendrier indicatif pour la génération de TERRA-MS2 clones dans les cellules de l’AGS. A) les étapes décrites dans le protocole et un calendrier indicatif pour la sélection de TERRA-MS2 clones apparaissent. Les cellules sont transfectées dans une plaque 6 puits avec le linéarisé MS2 cassette et sgRNA/Cas9 exprimant des vecteurs. Un code couleur est utilisé pour distinguer la plaque de l’ADN, la plaque de sauvegarde et les plaques de gel a indiqué dans la section protocole. B) MS2 la cassette se compose d’une séquence de longue subtélomère 15 q 800 nt suivie de 10 répétitions des séquences MS2 et un gène de résistance de néomycine flanqué de saumon fumé-p sites et se termine avec une étendue de répétition télomérique long 300 nt à son extrémité 3'. sgRNA/Cas9 vecteurs exprimant ont été générés par clonage des séquences spécifiques à 15 q guide RNA subtélomère dans pX335 vector à l’aide de la BbsI restriction site21,22. Deux vecteurs de différents sgRNA-pX335 ont été générés et un mélange de 1:1 des deux vecteurs a été utilisé pour la transfection. Les séquences de la sgRNAs sont indiqués dans le tableau 1. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 . Images représentatives du PCR et Southern blot dépistage de clones résistants néomycine. A) une image représentative des subtélomère 15 q contenant la cassette MS2. La position des amorces MS2 (MS2-subtel15q-primer-S et MS2 amorce comme) utilisés pour le dépistage de la PCR est indiquée. Les sites loxP présents au sein de la cassette sont indiquées en rouge. B) image représentative du dépistage de la PCR de clones résistants néomycine en utilisant deux ensemble des apprêts, des amorces de MS2 et amorces CTR (CTR prime S et apprêt CTR comme). C) une image représentative des subtélomère 15 q contenant la cassette MS2. Les sites de restriction BamHI et NCOL et la sonde de MS2 utilisé pour le dépistage de Southern blot sont indiquées. D) gauche : 10 µg d’ADN génomique par clone ont été digérés avec BamHI et exécuter sur gel d’agarose. L’image a été acquise après une nuit à 30 volts. A droite : ADN génomique digéré par les enzymes de restriction BamHI a été transféré sur une membrane de nylon chargé positivement et hybridé avec une sonde de séquences spécifiques marquées radioactivement MS2. La zone rouge indique la taille attendue de la bande positive. La flèche rouge indique un clone positif. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3 . Élimination des néomycine résistance gène et validation des expériences. A) une image représentative des subtélomère 15 q contenant la cassette MS2 avant et après l’expression de la Cre. La sonde spécifique de MS2, utilisée pour les analyses par transfert Southern et sites d’enzyme de restriction NCOL apparaissent. Les sites loxP présents au sein de la cassette sont indiquées en rouge. B) analyse de microscopie de Fluorescence d’un clone de TERRA-MS2 infecté par l’adénovirus exprimant sa Cre-GFP. Image représentant acquise dans un seul plan focal est montré. MOI, multiplicité de l’infection, est le rapport entre le nombre de virus utilisés pour l’infection et le nombre de cellules de l’hôte. Echelle : 30 µm C) aperçu de la stratégie expérimentale permettant de vérifier l’élimination du gène néomycine. Cellules Cre-GFP infecté sont divisées en trois plaques après 48 heures de l’infection pour sélection i) négative, analyses ii) Southern blot et iii) préparation des stocks de cellules congelées et extraction de l’ARN. Analyses par transfert Southern D) d’un TERRA-MS2 clone avant et après l’infection à adénovirus Cre-GFP. 10 µg d’ADN génomique ont été digérés avec l’enzyme de restriction NCOL. Gel d’agarose confirme que digestion complète est obtenue dans les deux clones (à gauche). L’ADN génomique digéré a été transféré sur une membrane de nylon chargé positivement et hybridés avec une sonde de séquences spécifiques de MS2. L’élimination complète du gène néomycine est confirmée par l’absence de la bande spécifique. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 4
Figure 4 . Analyses de la RT-qPCR de Tel15q-TERRA et Tel15q-TERRA-MS2 expression de transcriptions. A) une image représentative d’un gel de VADROUILLES montrant l’ARN total extrait des cellules AGS WT et clones de TERRA-MS2. Bandes correspondant à l’ARN ribosomique 28 s et 18 s sont indiqués. B) haut : une représentation schématique de la MS2-le tag subtélomère 15 q exprimant des transcriptions TERRA. Amorces utilisées pour TERRA fut (jaune) et des analyses de qPCR de Tel15q-TERRA (bleu) et TERRA Tel15q-MS2 (rouge) sont indiquées. Le site loxP est indiqué en rouge. En bas : RT-qPCR analyses d’expression de transcriptions Tel15q-TERRA et TERRA Tel15q-MS2 en cellules AGS WT et TERRA-MS2 clones. p < 0,05, non apparié t-test. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 5
Figure 5 . Analyses de TERRA-MS de l’imagerie de cellules vivantes2 clones. A) une vue d’ensemble de la procédure pour produire un rétrovirus exprimant MS2-GFP, tel que décrit à l’étape 4 de la protocole. Une représentation schématique de la MS2-le tag subtélomère 15 q et transcriptions TERRA reconnues par la protéine de fusion de GFP-MS2 est indiquée à droite. B) image de microscopie fluorescence représentatif d’AGS WT et deux TERRA-MS2 clones exprimant MS2-GFP. TERRA-MS2-GFP foyers sont indiqués par des flèches. Les images ont été acquises à l’aide d’un microscope confocal de rotation disque équipé d’une caméra EMCCD. Les images ont été capturées à l’aide d’un 100 X / 1.46 objectif apochromat dans une chambre d’imagerie maintenu à 37 ° C, avec 5 % de CO2. Un laser à 488 a été utilisé comme source lumineuse. Barre d’échelle : 5 µm. C) analyses des foyers de TERRA-MS2-GFP et TRF2-mCherry d’imagerie de cellules vivantes étiqueté télomères. Un événement de co-localisation entre un focus de TERRA-MS2-GFP et un télomère unique s’affiche. Les images ont été acquises comme dans B, à l’aide de lasers 488 et 520 comme source de lumière. Une projection maximale d’une expérience de pile z effectuée en une seule fois point de time-lapse expérience d’imagerie s’affiche. Barre d’échelle : 5 µm. s’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Nom de l’apprêt Séquence d’amorce Application
MS2-subtel15q-primer-S TGCATTAAAGGGTCCAGTTG Apprêt de MS2 avant utilisé pour le dépistage de la PCR de clones résistants néomycine
MS2 apprêt comme CCTAACTGACACACATTCCACAGA MS2 apprêt inverse utilisé pour le dépistage de la PCR de clones résistants néomycine
Apprêt CTR S TGT ACG CCA ACA CAG TGC TG Apprêt CTR avant utilisé dans le dépistage de la PCR de clones résistants néomycine
Apprêt CTR comme GCT GGA AGG TGG ACA GCG A Apprêt CTR inverse utilisé dans le dépistage de la PCR de clones résistants néomycine
Tel15q-S1 GCAGCGAGATTCTCCCAAGC Amorce sens utilisé pour détecter l’expression Tel15q et Tel15q-MS2 TERRA par qPCR
hTel15q-AS TAACCACATGAGCAATGTGGGTG Amorce antisens utilisée pour détecter l’expression Tel15q et Tel15q-MS2 TERRA par qPCR
Tel15q-MS2-AS ATGTTTCTGCATCGAAGGCATTAGG Amorce antisens utilisée pour détecter l’expression Tel15q-MS2 TERRA par qPCR
TERRA-RT-apprêt CCCTAACCCTAACCCTAACCCTAACCCTAA Apprêt utilisé pour fut de transcriptions TERRA
sgRNA1 TTGGGAGAATCTCGCTGGCC Séquence du guide abrégé 1 ARN clonés dans le vecteur pX335 et utilisé pour diriger l’activité enzymatique de Cas9 nickase à subtélomère 15 q
sgRNA2 TGCATTAAAGGGTCCAGTTG Séquence du guide abrégé ARN 2 clonés dans le vecteur pX335 et utilisé pour diriger l’activité enzymatique de Cas9 nickase à subtélomère 15 q

Tableau 1 : Liste des amorces utilisées dans cette étude. Une liste des séquences de le sgRNAs utilisé dans le présent protocole et les amorces sont fournies. Les séquences sont 5'-3'.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Dans cet article, nous présentons une méthode pour générer des clones de cellules cancéreuses humaines contenant des séquences de MS2 intégrées au sein de subtélomère 15 q. À l’aide de ces clones, les molécules TERRA MS2-tag transcrits à partir de la subtélomère 15 q sont détectés par microscopie de fluorescence par co-expression d’une protéine de fusion de GFP-MS2. Cette approche permet aux chercheurs d’étudier la dynamique de TERRA exprimée à partir d’un seul télomère vie cellules21. Dans ce protocole, TERRA-MS2 clones sont sélectionnés dans la lignée de cellules AGS, qui représente un système modèle intéressant pour l’étude de TERRA, puisque l’expression TERRA est augmentée dans l’estomac humain cancer échantillons24. Toutefois, le protocole décrit ici peut être adapté pour la sélection de clones de TERRA-MS2 dans les autres lignées cellulaires. L’intégration des séquences MS2 peut en principe être promue à un subtélomère différent de télomérique 15 q en utilisant une cassette de MS2 spécifique et la stratégie CRISPR. Dans la méthode présentée ici, une enzyme nickase de Cas9 et double guide RNAs sont employées afin d’augmenter la spécificité de l’intégration,22. En utilisant cette stratégie, un ensemble 2 % des clones positifs devraient être identifiés dans les cellules de l’AGS. D’autres versions de l’enzyme de Cas9 peuvent être testées dans la tentative d’augmenter le taux de réussite de la sélection de clones25. En outre, les étapes suivantes du protocole sont essentiels à prendre en compte pour maximiser l’efficacité de la sélection du clone :

I) afin d’augmenter les chances de la sélection des clones de TERRA-MS2, il est important de parvenir à une efficacité de transfection haute de la cassette de MS2 et les vecteurs CRISPR. Cellules transfectées mal exigera probablement plusieurs séries de transfection, sélection de clone et le dépistage afin de sélectionner des clones positifs.

II) il est important de déterminer la concentration précise de la néomycine à utiliser pour la sélection des clones. En effet, à l’aide d’une faible concentration de la drogue se traduira par des clones positifs fausses, alors qu’une forte concentration peut s’opposer à l’identification des clones positifs. La concentration de néomycine indiquée dans le présent protocole est mortelle aux cellules AGS dans 6-7 jours de l’addition au milieu de culture.

III) cueillette de clone est une étape cruciale. En effet, au cours de cette procédure, il est nécessaire que les clones seul sont cueillis. Pour cette raison, les colonies qui sont trop près de que l’autre devrait être évitée afin d’empêcher le mélange de cellules provenant de différents clones, ce qui entraîne la sélection d’une population mixte de clones qui peuvent contenir des séquences de MS2 intégré à plusieurs sites génomiques. Ces événements doivent être identifiées pendant la projection de Southern blot.

IV) la quantité d’ADN génomique, extraite d’une plaque d’ADN anastomosé 96 puits (protocole 2) est estimée à environ 5 µg et devrait suffire pour chaque clone par PCR et le transfert de Southern avec une seule restriction enzyme digestion de l’écran. Toutefois, afin de confirmer l’intégration de la cassette au télomère attendu, il sera important d’examiner chaque clone par Southern blot par digestion de l’ADN génomique avec deux enzymes de restriction différentes. Dans ce but, comme il est indiqué dans le protocole, les clones positifs lors du dépistage de la PCR doivent être cultivés dans 6 assiettes bien. La quantité d’ADN génomique extrait d’un puits d’une plaque 6 puits sera suffisante pour les digestions de restriction au moins deux requises pour les analyses par transfert Southern.

Dans le protocole décrit ici, les séquences de MS2 sont intégrées au sein de la subtélomère 15 q pour plusieurs raisons : J’ai) région promotrice TERRA et sites de début de transcription de TERRA ont été identifiés sur ce subtélomère26,27; II) expression de TERRA de subtélomère 15 q a été validée en utilisant in vitro techniques4,27,28,29,30; III) la région subtélomériques du chromosome 15 q a été séquencée et il contient une région unique adjacente aux voies répétition télomérique pouvant être ciblées pour l’intégration de la MS2-cassette21. PCR et Southern blot approches ont été développées afin de confirmer l’intégration simple des séquences MS2 dans subtélomère 15 q dans les clones de TERRA-MS2. Il serait intéressant d’effectuer également des expériences de DNA-FISH sur des étalements de chromosomes afin de visualiser la localisation chromosomique des séquences MS2 chromosomes en métaphase fixe. Toutefois, la longueur de la 10xMS2 séquences (450 bp) impose l’utilisation de sondes très courtes par rapport aux sondes généralement utilisés dans des expériences de DNA-FISH le chromosome tartinades (chromosomes artificiels bactériens (Bac), cosmides ou plasmides)31. Ce défi technique nous a empêché de visualiser les séquences MS2 sur des étalements de chromosomes qui représente une limitation du protocole. Une autre limite de la méthode est le temps et l’effort requis pour la sélection des clones de TERRA-MS2. En outre, le laboratoire spécifique mis en place et l’équipement pour l’utilisation des virus, des matières radioactives et des analyses de microscopie sont nécessaires.

La méthode décrite ici peut être implémentée pour la génération de TERRA-MS2 clones dans différentes lignées cellulaires afin de définir la dynamique de TERRA dans divers contextes biologiques, comme durant la sénescence dysfonction ou cellulaire télomère, pour nous aider à comprendre la fonction de TERRA dans ces processus. Un développement intéressant de cette approche sera la génération de TERRA-MS2 clones contenant TetO répète intégrée à un subtélomère spécifique, y compris le télomère MS2-tag. L’expression d’une protéine de tite fondue à une protéine fluorescente (c.-à-d. mCherry) permettra la visualisation de ce télomère particulière dans la vie des cellules32. Cette approche permettra d’enquête si les transcriptions TERRA humaines localiser et agissent en cis à la TERRA transcrivant des télomères et chromosome ou en trans en déplaçant d’autres chromosomes. Cette question dans la biologie de TERRA reste à clarifier.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs déclarent sans intérêts financiers concurrents

Acknowledgments

Nous sommes reconnaissants envers le personnel de l’installation d’imagerie avancée de CIBIO à l’Université de Trento et le BioOptics Light Microscopy facility à laboratoires de Perutz pour le F. Max (MFPL) à Vienne. La recherche ayant abouti à ces résultats a reçu un financement de la Stiftung Mahlke-Obermann et septième Programme-cadre pour la recherche, de développement technologique et de démonstration de l’Union européenne en vertu de la convention de subvention sans 609431 à EC. EC est soutenu par une bourse de Rita Levi Montalcini du ministère italien de l’enseignement universitaire et la recherche (MIUR).

Materials

Name Company Catalog Number Comments
AGS cells - - Gift from Christian Baron (Université de Montréal).
F12K Nut Mix 1X GIBCO 21127022 Culturing medium for AGS cells
L-Glutamine  CORNING MT25005CI Component of cell culturing medium
Penicillin Streptomycin Solution CORNING 30-002-CI Component of cell culturing medium
Fetal Bovine Serum Sigma Aldrich F2442 Component of cell culturing medium
DMEM 1X GIBCO 21068028 culturing medium for phoenix cell
CaCl2 Sigma Aldrich C1016 used in phoenix cell transfection
HEPES Sigma Aldrich H3375 used in phoenix cell transfection (HBS solution)
KCl Sigma Aldrich P9333 used in phoenix cell transfection (HBS solution)
Dextrose Sigma Aldrich D9434 used in phoenix cell transfection (HBS solution)
NaCl Sigma Aldrich S7653 used in phoenix cell transfection (HBS solution) and retrovirus precipitation
Na2HPO4 Sigma Aldrich S3264 used in phoenix cell transfection (HBS solution)
TRYPSIN EDTA SOLUTION 1X CORNING 59430C used in cell split
DPBS 1X GIBCO 14190250 Dulbecco's Phosphate Buffered Saline
DMSO Sigma Aldrich D8418 Component of cell freezing medium (80% FBB and 20% DMSO)
G-418 Disulphate Formedium G4185 selection drug for 
Gelatin solution Bioreagent Sigma Aldrich G1393 cotaing of 96 well DNA plate and freezing plate
Tris-base Fisher BioReagents 10376743 Component of Cell lysis buffer for genomic DNA extraction
EDTA Sigma Aldrich E6758 Component of Cell lysis buffer for genomic DNA extraction
SDS Sigma Aldrich 71729 Component of Cell lysis buffer for genomic DNA extraction
Proteinase K Thermo Fisher AM2546 Component of Cell lysis buffer for genomic DNA extraction
RNAse A Thermo Fisher 12091021 RNA degradation during DNA extraction
Agarose Sigma Aldrich A5304 DNA gel preparation
Atlas ClearSight Bioatlas BH40501 Stain reagent used for detecting DNA and RNA samples in agarose gel
ethanol Fisher BioReagents BP28184 DNA precipitation
Sodium Acetate  Sigma Aldrich 71196 Used for DNA precipitation at a 3M concentration pH5.2
Wizard SV Gel and PCR clean-Up system Promega A9282 Extraction of PCR fragments from agarose gel during PCR screening of neomycin positive clones
Trizol AMBION 15596018 Organic solvent used for RNA extraction
Dnase I THERMO SCIENTIFIC 89836 degradation of genomic DNA from RNA 
dNTPs mix Invitrogen 10297018 used in RT and PCR reactions
DTT Invitrogen 707265ML used in RT reactions
diethyl pyrocarbonate Sigma Aldrich D5758 used to inactivate RNAses in water (1:1000 dilution)
Ribolock Thermo Fisher EO0381 RNase inhibitor
MOPS Sigma Aldrich M9381 preparation of RNA gel
Paraformaldehyde Electron Microscopy Sciences 15710 preparation of denaturating RNA gel (1% PFA in 1x MOPS)
Superscript III Reverse transcriptase Invitrogen 18080-093 Retrotranscription reaction
Pfu DNA polymerase (recombinant) Thermo Scientific EP0501 PCR reaction
2X qPCRBIO SyGreen Mix Separate-ROX PCR BIOSYSTEMS PB 20.14 qPCR reaction
Cre-GFP adenovirus https://medicine.uiowa.edu/vectorcore 1174-HT used to infect TERRA-MS2 clones in order to remove the neomycn gene
Sodium Butyrate Sigma Aldrich B5887 used to promote retrovirus particles production in phoenix cells
PEG8000 Sigma Aldrich 89510 Precipitation of retrovirus partcles
35µ-Dish Glass Bottom Ibidi 81158 used in live cell imaging analyses of TERRA-MS2 clones

DOWNLOAD MATERIALS LIST

References

  1. Azzalin, C. M., Reichenbach, P., Khoriauli, L., Giulotto, E., Lingner, J. Telomeric repeat containing RNA and RNA surveillance factors at mammalian chromosome ends. Science. 318, (5851), 798-801 (2007).
  2. Schoeftner, S., Blasco, M. A. Developmentally regulated transcription of mammalian telomeres by DNA-dependent RNA polymerase II. Nature Cell Biology. 10, (2), 228-236 (2008).
  3. Diman, A., Decottignies, A. Genomic origin and nuclear localization of TERRA telomeric repeat-containing RNA: from Darkness to Dawn. FEBS Journal. (2017).
  4. Arnoult, N., Van Beneden, A., Decottignies, A. Telomere length regulates TERRA levels through increased trimethylation of telomeric H3K9 and HP1alpha. Nature Structural & Molecular Biology. 19, (9), 948-956 (2012).
  5. Montero, J. J., et al. TERRA recruitment of polycomb to telomeres is essential for histone trymethylation marks at telomeric heterochromatin. Nature Communications. 9, (1), 1548 (2018).
  6. Beishline, K., et al. CTCF driven TERRA transcription facilitates completion of telomere DNA replication. Nature Communications. 8, (1), 2114 (2017).
  7. Arora, R., et al. RNaseH1 regulates TERRA-telomeric DNA hybrids and telomere maintenance in ALT tumour cells. Nature Communications. 5, 5220 (2014).
  8. Balk, B., et al. Telomeric RNA-DNA hybrids affect telomere-length dynamics and senescence. Nature Structural & Molecular Biology. 20, (10), 1199-1205 (2013).
  9. Graf, M., et al. Telomere Length Determines TERRA and R-Loop Regulation through the Cell Cycle. Cell. 170, (1), 72-85 (2017).
  10. Lee, Y. W., Arora, R., Wischnewski, H., Azzalin, C. M. TRF1 participates in chromosome end protection by averting TRF2-dependent telomeric R loops. Nature Structural & Molecular Biology. (2018).
  11. Moravec, M., et al. TERRA promotes telomerase-mediated telomere elongation in Schizosaccharomyces pombe. EMBO Reports. 17, (7), 999-1012 (2016).
  12. Cusanelli, E., Romero, C. A., Chartrand, P. Telomeric noncoding RNA TERRA is induced by telomere shortening to nucleate telomerase molecules at short telomeres. Molecular Cell. 51, (6), 780-791 (2013).
  13. Moradi-Fard, S., et al. Smc5/6 Is a Telomere-Associated Complex that Regulates Sir4 Binding and TPE. PLoS Genetics. 12, (8), e1006268 (2016).
  14. Chu, H. P., et al. TERRA RNA Antagonizes ATRX and Protects Telomeres. Cell. 170, (1), 86-101 (2017).
  15. Lai, L. T., Lee, P. J., Zhang, L. F. Immunofluorescence protects RNA signals in simultaneous RNA-DNA FISH. Experimental Cell Research. 319, (3), 46-55 (2013).
  16. Zhang, L. F., et al. Telomeric RNAs mark sex chromosomes in stem cells. Genetics. 182, (3), 685-698 (2009).
  17. Gallardo, F., Chartrand, P. Visualizing mRNAs in fixed and living yeast cells. Methods in Molecular Biology. 714, 203-219 (2011).
  18. Querido, E., Chartrand, P. Using fluorescent proteins to study mRNA trafficking in living cells. Methods in Cell Biology. 85, 273-292 (2008).
  19. Cusanelli, E., Chartrand, P. Telomeric noncoding RNA: telomeric repeat-containing RNA in telomere biology. Wiley Interdisciplinary Reviews: RNA. 5, (3), 407-419 (2014).
  20. Perez-Romero, C. A., Lalonde, M., Chartrand, P., Cusanelli, E. Induction and relocalization of telomeric repeat-containing RNAs during diauxic shift in budding yeast. Current Genetics. (2018).
  21. Avogaro, L., et al. Live-cell imaging reveals the dynamics and function of single-telomere TERRA molecules in cancer cells. RNA Biology. 1-10 (2018).
  22. Ran, F. A., et al. Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell. 154, (6), 1380-1389 (2013).
  23. Yamada, T., et al. Spatiotemporal analysis with a genetically encoded fluorescent RNA probe reveals TERRA function around telomeres. Scientific Reports. 6, 38910 (2016).
  24. Deng, Z., et al. Formation of telomeric repeat-containing RNA (TERRA) foci in highly proliferating mouse cerebellar neuronal progenitors and medulloblastoma. Journal of Cell Science. 125, (Pt 18), 4383-4394 (2012).
  25. Casini, A., et al. A highly specific SpCas9 variant is identified by in vivo screening in yeast. Nature Biotechnology. 36, (3), 265-271 (2018).
  26. Nergadze, S. G., et al. CpG-island promoters drive transcription of human telomeres. RNA. 15, (12), 2186-2194 (2009).
  27. Porro, A., et al. Functional characterization of the TERRA transcriptome at damaged telomeres. Nature Communications. 5, 5379 (2014).
  28. Farnung, B. O., Brun, C. M., Arora, R., Lorenzi, L. E., Azzalin, C. M. Telomerase efficiently elongates highly transcribing telomeres in human cancer cells. PLoS One. 7, (4), e35714 (2012).
  29. Flynn, R. L., et al. Alternative lengthening of telomeres renders cancer cells hypersensitive to ATR inhibitors. Science. 347, (6219), 273-277 (2015).
  30. Scheibe, M., et al. Quantitative interaction screen of telomeric repeat-containing RNA reveals novel TERRA regulators. Genome Research. 23, (12), 2149-2157 (2013).
  31. Bolland, D. J., King, M. R., Reik, W., Corcoran, A. E., Krueger, C. Robust 3D DNA FISH using directly labeled probes. Journal of Visualized Experiments. (78), (2013).
  32. Masui, O., et al. Live-cell chromosome dynamics and outcome of X chromosome pairing events during ES cell differentiation. Cell. 145, (3), 447-458 (2011).
Génération de Clones de cellules de Cancer de visualiser contenant répétition télomérique RNA TERRA exprimée à partir d’un seul télomères dans les cellules vivantes
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Avogaro, L., Oss Pegorar, C., Bettin, N., Cusanelli, E. Generation of Cancer Cell Clones to Visualize Telomeric Repeat-containing RNA TERRA Expressed from a Single Telomere in Living Cells. J. Vis. Exp. (143), e58790, doi:10.3791/58790 (2019).More

Avogaro, L., Oss Pegorar, C., Bettin, N., Cusanelli, E. Generation of Cancer Cell Clones to Visualize Telomeric Repeat-containing RNA TERRA Expressed from a Single Telomere in Living Cells. J. Vis. Exp. (143), e58790, doi:10.3791/58790 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter