Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Generazione di cloni delle cellule di cancro per visualizzare Telomeric Repeat-contenente RNA TERRA espresso da un singolo dei telomeri nelle cellule viventi

doi: 10.3791/58790 Published: January 17, 2019

Summary

Qui, presentiamo un protocollo per generare cloni delle cellule di cancro che contiene un tag di sequenza MS2 presso un singolo subtelomeriche. Questo approccio, basandosi sul sistema MS2-GFP, permette la visualizzazione delle trascrizioni endogene di telomerica ripetizione-contenente RNA (TERRA) espresso da un singolo telomero in cellule viventi.

Abstract

I telomeri sono trascritti, dando luogo a telomeric repeat-contenente RNA lunghi non codificanti (TERRA), che sono state proposte per svolgere un ruolo importante nella biologia del telomero, tra cui la formazione dell'eterocromatina e nell'omeostasi di lunghezza del telomero. Recenti scoperte hanno rivelato che TERRA molecole interagiscono anche con interne regioni cromosomiche per regolare l'espressione genica in cellule staminali embrionali (ES) del topo. In linea con questa prova, RNA fluorescenza in situ di ibridazione (RNA-pesce) analisi hanno mostrato che solo un sottoinsieme di TERRA trascrizioni localizzare alle estremità del cromosoma. Una migliore comprensione delle dinamiche di molecole TERRA vi aiuterà a definire la loro funzione e meccanismi di azione. Qui, descriviamo un metodo per etichettare e visualizzare trascrizioni TERRA di singolo-telomero in cellule di cancro usando il sistema di MS2-GFP. A questo scopo, vi presentiamo un protocollo per generare cloni stabili, utilizzando la linea cellulare del cancro AGS stomaco umano, che contiene le sequenze di MS2 integrate a un singolo subtelomeriche. Trascrizione di TERRA dal telomero MS2-etichetta provoca l'espressione di molecole TERRA MS2-Tag che vengono visualizzate da microscopia di fluorescenza di cellule vive al momento di co-espressione di una proteina di legame al RNA MS2-fusa a GFP (MS2-GFP). Questo approccio consente ai ricercatori di studiare la dinamica delle single-telomero TERRA molecole nelle cellule tumorali, e può essere applicato ad altre linee cellulari.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

La TERRA di RNA lunghi non codificanti è trascritto dalla regione subtelomerica dei cromosomi e la trascrizione procede verso le estremità del cromosoma, che chiude all'interno del tratto di ripetizione telomerica1,2. Per questo motivo, trascrizioni TERRA sono costituiti da sequenze subtelomeric derivata alla loro estremità 5' e terminare con ripetizioni telomeriche (UUAGGG nei vertebrati)3. Importanti ruoli sono stati proposti per TERRA, tra cui la formazione dell'eterocromatina presso i telomeri4,5, DNA replication6, promuovendo una ricombinazione omologa tra cromosoma termina7,8 , 9, regolazione del telomero struttura10e lunghezza del telomero omeostasi2,11,12,13. Inoltre, trascrizioni TERRA interagiscono con numerosi siti di extratelomeric alla regolazione dell'espressione genica diffusa di cellule staminali embrionali (ES) del mouse14. In linea con queste prove, ibridazione in situ di fluorescenza RNA (RNA-pesce) analisi hanno mostrato che solo un sottoinsieme delle trascrizioni TERRA di localizzare a telomeri1,2,15. Inoltre, la TERRA è stata segnalata a formare aggregati nucleari localizzazione presso i cromosomi X e Y del mouse le celle2,16. Questi risultati indicano che le trascrizioni TERRA subiscono complesse dinamiche all'interno del nucleo. Comprensione delle dinamiche delle molecole TERRA vi aiuterà a definire la loro funzione e meccanismi di azione.

Il sistema di MS2-GFP è stato ampiamente utilizzato per visualizzare le molecole di RNA in cellule viventi da vari organismi17,18. Questo sistema è stato utilizzato in precedenza per tag e visualizzare le molecole TERRA di singolo-telomero in S. cerevisiae12,19. Utilizzando questo sistema, è stato recentemente dimostrato che le trascrizioni TERRA di lievito localizzare all'interno del citoplasma durante la fase di spostamento post-Coelho, suggerendo che la TERRA possa esercitare funzioni extranucleari20. Noi abbiamo recentemente utilizzato il sistema di MS2-GFP per studiare le trascrizioni TERRA di singolo-telomero in cancro cellule21. A questo scopo, abbiamo impiegato lo strumento di modifica di genoma CRISPR/Cas9 di integrare MS2 sequenze a un singolo telomero (telomero 15q, qui di seguito Tel15q) ed abbiamo ottenuto cloni che esprimono MS2-etichettate endogene Tel15q TERRA (TERRA-MS2 cloni). Co-espressione di una proteina legante il RNA MS2 fusi con GFP (MS2-GFP) che riconosce e lega RNA MS2 sequenze consente visualizzazione delle trascrizioni di singolo-telomero TERRA in vita cellule21. Lo scopo del protocollo illustrato qui è quello di descrivere in dettaglio i passaggi necessari per la generazione di cloni di TERRA-MS2.

Per generare cloni di TERRA-MS2, una cassetta di MS2 è integrata all'interno della regione subtelomerica del telomero 15q, a valle del sito di inizio TERRA promotore regione e trascrizione. La cassetta di MS2 contiene un gene di resistenza di neomicina affiancato da siti lox-p, e la sua integrazione a subtelomeriche 15q viene eseguita utilizzando il sistema CRISPR/Cas922. Dopo trasfezione di MS2 cassetta, singolo cloni sono selezionati e subtelomeric integrazione della cassetta è verificato mediante PCR, DNA sequencing e Southern blot. Cloni positivi sono infettati con un adenovirus che esprimono Cre al fine di rimuovere il marcatore di selezione nel cassetto, lasciando solo sequenze di MS2 e un sito singolo lox-p a subtelomeriche 15q. Espressione delle trascrizioni TERRA MS2-contrassegnati da Tel15q è verificata da RT-qPCR. Infine, si esprime la proteina di fusione GFP-MS2 in TERRA-MS2 cloni tramite infezione retrovirale per visualizzare trascrizioni MS2-TERRA mediante microscopia a fluorescenza. Trascrizioni TERRA possono essere facilmente individuate da RNA-pesce e cellule vive imaging utilizzando telomeric repeat specifiche sonde1,2,15,23. Questi approcci forniscono importanti informazioni sulla localizzazione della popolazione totale di molecole TERRA a risoluzione di singola cellula. La generazione di cloni contenenti sequenze di MS2 presso un singolo subtelomeriche permetterà ai ricercatori di studiare le dinamiche delle trascrizioni TERRA di singolo-telomero in cellule viventi, che contribuiranno a definire la funzione e meccanismi di azione di TERRA.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Selezione di cloni resistenti neomicina

  1. Crescere le cellule AGS in medium F-12_K di Ham (Kaighn) completate con 10% siero bovino fetale (FBS), 2 mM L-Glutammina, penicillina (0,5 unità per mL di terreno) e streptomicina (0,2 µ g / mL di medium) a 37 ° C e 5% CO2. Transfect le cellule in una confluenza di 50-60% con il sgRNA/Cas9 esprimendo vettoriale e la cassetta di MS2 presso un 01:10 rapporto molare21.
    Nota: In un esperimento parallelo, verificare l'efficienza di trasfezione di trasfezione un vettore che esprimono GFP (cioè, Cas9-GFP vector). Almeno 60-70% di efficienza di trasfezione dovrebbe essere realizzato.
  2. Il giorno seguente, sostituire il mezzo di coltura con mezzo contenente neomicina alla concentrazione finale a 0,7 µ g/mL (mezzo selettivo).
    Nota: Spaccare le cellule e li semina in terreno selettivo il giorno dopo trasfezione permetterà di accelerare il processo di selezione. Tutte le cellule trasfettate con non morirà immediatamente. Se transfezione avviene in 6 piastre a pozzetti, nel qual caso ciascun pozzetto a un 60% confluenza dovrebbe contenere circa 0,7 x 106 celle, il giorno seguente che le celle possono essere suddivise da un singolo pozzo di terreno selettivo contenente 10 cm piatto.
  3. Mantenere le cellule in terreno selettivo per 7-10 giorni, cambiando mezzo ogni uno o due giorni, fino al singolo cloni sono visibili.
  4. Raccolta di cloni cellulari
    1. Preparare un piatto ben 96 contenente 10 µ l di 0,25% tripsina in ciascun pozzetto.
      Nota: Preparare due 96 pozzetti nel caso in cui più di 96 cloni devono essere selezionati.
    2. Con l'uso di un microscopio, segnare la posizione di ogni clone visibile nel piatto 10 cm facendo un punto nella parte inferiore del piatto con un pennarello. Ogni punto corrisponderà ad una colonia di essere raccolti.
    3. Sostituire il mezzo di coltura con appena sufficiente fosfato tamponata (PBS) forma una pellicola sottile di liquido sui cloni e non lasciare che le celle a secco durante la raccolta di clone.
    4. Scegliere singole colonie utilizzando una pipetta 10 µ l. Collegare il puntale contenente 5 µ l di tripsina alla Colonia e rilasciare lentamente la tripsina che rimarrà localizzata sulla Colonia. Consentire la tripsina staccare le cellule per 1 min, poi raschiare la Colonia con la punta e succhiano la punta.
      Nota: Durante questa procedura, lanciando il piatto un po' su un lato quindi per diminuire il volume di PBS attorno alla Colonia essendo scelto aiuterà il processo di prelievo evitando di diluire la tripsina attorno alla Colonia. Utilizzando un anello di clone può anche aiutare a raccogliere singoli cloni.
    5. Inserire le celle dalla Colonia in un pozzetto della piastra ben 96 contenente 10 µ l di 0,25% tripsina.
    6. Incubare per 5 minuti a temperatura ambiente, quindi riempire il pozzetto con 150 µ l di terreno selettivo (medio F - 12K di Ham (Kaighn) completati con 10% FBS, 2 mM L-Glutammina, penicillina (0,5 unità per mL di terreno), streptomicina (0,2 µ g / mL di medium) e contenenti neomicina presso una concentrazione di 0,7 µ g/mL.
      Nota: Durante il periodo di incubazione possono essere selezionati altri cloni. Si raccomanda di prendere come molti cloni come possibile. Vengono raccolti i cloni più maggiore sarà la probabilità di identificare quelli positivi.
    7. Una volta che tutti i cloni sono raccolti e trasferiti nella piastra ben 96, permettono alle cellule di crescere per un paio di giorni in mezzo selettivo F - 12K di Ham (Kaighn), supplementato con 10% FBS, 2 mM L-Glutammina, penicillina (0,5 unità per mL di terreno), streptomicina (0,2 µ g / mL del mezzo) e contenenti neomicina ad una concentrazione di 0,7 µ g/mL a 37 ° C e 5% CO2, fino a raggiungere la confluenza del 90%.
  5. Suddivisione dei cloni
    1. Preparare tre 96 pozzetti rivestiti con gelatina aggiungendo 100 µ l di gelatina per pozzetto, incubare a temperatura ambiente per 30 minuti, quindi lavare due volte con PBS. Queste piastre verranno utilizzate per l'estrazione del DNA (piastra di DNA) e per clone congelamento (piastre di congelamento).
      Nota: Gelatina promuoverà l'allegato delle cellule e del DNA ai pozzetti. In particolare, il rivestimento di gelatina consentirà il DNA di attaccare nella parte inferiore dei pozzetti durante l'estrazione di DNA e lavare le procedure (discusse sotto). Durante la procedura di divisione di clone, si consiglia di utilizzare una pipetta multicanale.
    2. Una volta che cloni raggiungono 90% confluenza, aspirare medio da ciascun pozzetto della piastra ben 96, lavare con PBS, aggiungere 30 µ l di 0,25% tripsina per pozzetto e incubare per 5 min a 37 ° C.
      Nota: Cloni crescerà a ritmi diversi, che dipenderanno anche il numero di cellule raccolte al clone. Così, questo passaggio verrà eseguito durante i diversi giorni quando i diversi cloni raggiungono la confluenza del 90%.
    3. Aggiungere 70 µ l di terreno selettivo per pozzetto, perturbare grumi di cellule pipettando su e giù all'interno dei pozzetti, quindi trasferire 30 µ l della 100 µ l alla piastra di DNA gelatinizzata preriempita con 120 µ l di terreno selettivo per bene e 30 µ l al wit preriempita piastre congelamento gelatinizzato medio di µ l di h 50 (senza selezione).
    4. Posizionare la piastra di DNA nell'incubatrice e permettono alle cellule di crescere a 37 ° C e 5% CO2 fino al 90% confluenza.
    5. Aggiungere 80 µ l di ghiacciata preparata 2x congelamento medio (80% FBS e 20% solfossido dimetilico (DMSO)) in ciascun pozzetto della piastra congelamento, parafilm (spruzzato con etanolo al 70%) sopra la piastra così per sigillare ogni bene, mettere il coperchio sulla parte superiore e avvolgere la piastra con un foglio di alluminio. Posizionare le piastre di congelamento a-80 ° C.
    6. Aggiungere 90 µ l di terreno selettivo per pozzetto alla piastra ben 96 originale contenente i cloni che sono stati suddivisi e tenerlo in coltura fino al PCR risultati dello screening. Piastrina d'appoggio fungerà da questo piatto.

2. lo screening di cloni resistenti neomicina

  1. Estrazione del DNA dalla piastra di DNA ben 96.
    1. Una volta che i cloni coltivati nella piastra di DNA raggiungono 90% confluenza, lavare 2 volte con PBS, quindi lisare con 50 µ l di tampone lisi (10 mM Tris-HCl pH 7.5, 10 mM EDTA, 10 millimetri di NaCl, 0,5% SDS e proteinasi K di 1 mg/mL). Coprire la piastra con parafilm, sigillando ogni bene, mettere il coperchio, coprire con pellicola trasparente e posto a 37 ° C durante la notte.
    2. Aggiungere 100 µ l di etanolo freddo (Et-OH) / soluzione di NaCl (0,75 M di NaCl in 100% etanolo) a ciascun bene e precipitare per 6 h o una notte a temperatura ambiente.
      Nota: Il protocollo può essere messo in pausa qui.
    3. Rimuovere la soluzione di NaCl/Et-OH invertendo la piastra e lavare 3 volte con 200 µ l di etanolo al 70% per pozzetto.
    4. Aggiungere 25 µ l di soluzione di RNasi A in acqua distillata e incubare a 37 ° C per 1 h.
  2. Utilizzare 3 µ l di DNA genomico per l'amplificazione di PCR. Eseguire lo screening di PCR dei cloni selezionati utilizzando primers ricottura all'interno del gene di resistenza di neomicina e subtelomeriche 15q. L'amplificazione di PCR viene eseguita utilizzando gli enzimi della polimerasi standard e protocolli PCR21.
    Nota: Condizioni di PCR per MS2 primer (primer MS2-subtel15q-primer-S e MS2 come) e gli iniettori CTR (CTR prime S e primer CTR come) sono i seguenti: 98 ° C per 20 s come punto di denaturazione e quindi 34 cicli a 98 ° C 10 s, 58° C 20 s, 72 ° C 15 s , utilizzando enzima polimerasi in un 25 µ l reazione mescolare (Vedi Tabella materiali). Sequenze dell'iniettore sono indicati nella tabella 1.
  3. Eseguire reazioni di PCR su gel di agarosio ed estrarre fasce PCR ottenuti da cloni positivi utilizzando le procedure di estrazione standard del gel (Vedi Tabella materiali per reagenti di estrazione del gel).
  4. Eseguire analisi di sequenziamento del DNA del prodotto della PCR gel-estratta per la conferma della presenza di sequenze MS221.
    Nota: L'analisi di sequenziamento possono essere eseguite utilizzando i primers utilizzati per lo screening di PCR.
  5. Proiezione del sud della macchia di cloni positivi di PCR
    1. Crescere i cloni positivi alla PCR e di sequenziamento screening dalla piastra ben 96 originale (la piastrina d'appoggio) per ben 6 piastre in F - 12K di Ham (Kaighn), supplementato con 10% FBS, 2 mM L-Glutammina, penicillina (0,5 unità per mL di terreno), streptomicina (0,2 µ g / mL di terreno) e contenenti neomicina ad una concentrazione di 0,7 µ g/mL a 37 ° C 5% CO2.
      Nota: In alternativa, se alcuni di questi cloni sono stati persi, scongelare li da una delle piastre congelamento (Vedi protocollo 2.6).
    2. Una volta che i cloni sono al 90% confluenza nella piastra ben 6, lavare le cellule con PBS e aggiungere 250 µ l di tampone di lisi contenente 0,5 µ g proteinasi K per pozzetto.
    3. Raschiare le celle utilizzando un raschietto di cella e trasferire il lisato in una provetta da 1,5 mL.
    4. Incubare a 37 ° C per 16 h.
    5. Aggiungere 1 mL di etanolo al 100%, agitare vigorosamente e consentire il DNA per precipitare almeno 2 ore o durante la notte a-20 ° C.
      Nota: Il protocollo può essere messo in pausa qui.
    6. Spin a 13.400 x g a 4 ° C per 10 minuti, eliminare il surnatante e lavare il pellet con etanolo al 70%. Lasciare asciugare a temperatura ambiente l'aria di pellet. In alternativa, utilizzare un concentratore a vuoto.
    7. Risospendere il pellet di DNA in 50 µ l di acqua distillata contenente RNasi A e incubare per 1h a 37 ° C.
    8. Digerire il 5-10 µ g di DNA genomico mediante enzimi di restrizione NcoI e BamHI (due digestioni indipendente) in 100 µ l di reazione incubando le reazioni di digestione a 37 ° C durante la notte.
    9. Eseguire 4 µ l della digestione su gel di agarosio (0,8% agarosio) per la conferma di digestione completa.
    10. Aggiungere 1/10 di volume di sodio acetato 3M soluzione pH 5.2 e 2 volumi di etanolo al 100% per le reazioni di digestione di limitazione e incubare almeno 2 ore o durante la notte a-20 ° C per precipitare il DNA.
      Nota: Il protocollo può essere messo in pausa qui.
    11. Centrifugare a 13.400 x g a 4 ° C per 20 min, eliminare i sovranatante e lavare il pellet con etanolo al 70%. Lasciare asciugare il pellet all'aria a temperatura ambiente. In alternativa, utilizzare un concentratore a vuoto.
    12. Risospendere il pellet in 20 µ l di acqua distillata e caricare il DNA digerito su gel di agarosio 0.8%.
      Nota: Per una migliore risoluzione del DNA digerito, preparare un gel almeno 15 cm lungo ed eseguire durante la notte a bassa tensione (Volt ̴30). L'elettroforesi impostata deve essere ottimizzato.
    13. Il giorno seguente, macchia il gel con un agente di etichettatura del DNA, come il bromuro di etidio alla concentrazione finale di 1 µ l/10 mL, per 30 min a temperatura ambiente e scattare una foto con un righello vicino il gel su un gel di strumento di imaging.
    14. Impostare il trasferimento di DNA su una membrana di nylon ed eseguire l'ibridazione della membrana con una sonda di sequenza-specific MS2 utilizzando le procedure standard21.
    15. Scongelare i cloni che sono positivi alla PCR, DNA sequencing e Southern blot da una delle due piastre congelamento (Vedi punto successivo).
  6. Lo scongelamento dei cloni
    1. Preparare una provetta da 15 mL contenente 5 mL di pre-riscaldato di Ham F - 12K medium (di Kaighn) supplementato con 10% FBS, 2 mM L-Glutammina, penicillina (0,5 unità per mL di terreno) e streptomicina (0,2 µ g / mL di medium) per ogni clone essere scongelati.
    2. Rimuovere una delle piastre congelamento da-80 ° e aggiungere 100 µ l di terreno completo di pre-riscaldato F12K al bene contenente il clone positivo per essere scongelati.
      Nota: Questa procedura deve essere eseguita rapidamente e appoggiare la piastra ben 96 su ghiaccio secco dopo ogni clone è scongelato, al fine di consentire gli altri cloni di rimanere congelati. Ciò è particolarmente importante se più cloni devono essere scongelati dallo stesso piatto ben 96.
    3. Trasferire le cellule per il tubo da 15 mL contenente 5 mL di medium e centrifuga a 800 x g per 5 min a temperatura ambiente.
    4. Aspirare il mezzo, risospendere le cellule in 500 µ l di terreno F12K completo pre-riscaldato e trasferire ogni clone in un unico pozzetto di una piastra ben 12.
  7. Eliminazione del gene di resistenza neomicina dal cassetto MS2 integrata a subtelomeriche 15q.
    1. Consentire i cloni a crescere di un piatto ben 12 in un piatto di 10 cm nel terreno F12K completo.
      Nota: Neomicina non deve essere inclusi nel mezzo se non diversamente indicato.
    2. Aggiungere l'adenovirus Cre-esprimendo le cellule coltivate in un piatto di 10 cm alla confluenza del 70% in 10 mL di terreno completo di F12K.
      Nota: Utilizzando un adenovirus che esprimono Cre-GFP permetterà la valutazione dell'efficienza di infezione, che dovrebbe raggiungere il 100%. L'adenovirus replica-difettoso andranno perso dopo pochi passaggi in coltura.
    3. 48 ore dopo l'infezione, dividere le celle in tre piatti di 10 cm. Due piatti saranno utilizzati per la verifica della rimozione gene neomicina da selezione negativa, le celle contenenti neomicina in crescita medio (primo piatto) e da Southern blot (secondo piatto).
    4. Il terzo piatto contenente il clone per congelamento delle cellule e l'estrazione di RNA della coltura.

3. Verifica della TERRA-MS2 espressione della trascrizione di RT-qPCR

  1. Al momento della verifica della rimozione del gene di neomicina, eseguire l'estrazione di RNA totale da TERRA-MS2 cloni utilizzando solventi organici (fenolo e guanidina soluzione isothiocynate)21.
    1. Risospendere il RNA Estratto da un piatto di 10 cm in 100 µ l di acqua di dietil pirocarbonato (DEPC).
    2. Eseguire 3 µ l di RNA su un gel di acido (MOPS) propansulfonico di denaturanti (1% formaldeide-contenenti) 1 x 3-(N-Morpholino) per verificare la concentrazione e l'integrità del RNA. Anche analizzare la concentrazione di RNA usando uno spettrofotometro.
    3. Trattare 3 µ g di RNA con dnasi I utilizzando 1 unità della dnasi I enzima in 60 µ l di reazione finale.
    4. Incubare la reazione per 1h a 37 ° C.
  2. Invertire le analisi di reazione e qPCR di trascrizione
    1. Aggiungere i seguenti componenti di un tubo del microcentrifuge nucleasi-free: 2 µ l di un primer specifico di 1 µM TERRA, 1 µ l di dNTP mix (10 mM), 6 µ l di dnasi I trattati RNA (corrispondente a ̴300ng RNA). Regolare il volume a 13 µ l con 4 µ l di acqua DEPC.
      Nota: Per ogni RNA devono essere analizzate, una seconda provetta contenente i reagenti stessi ma un primer specifico di riferimento, invece di primer specifici di TERRA, deve essere preparata.
    2. Riscaldare la miscela a 65 ° C per 5 min e incubare in ghiaccio per almeno 1 min.
    3. Raccogliere il contenuto dei tubi mediante centrifugazione breve e 4 µ l di enzima 5 X RT Buffer, 1 µ l 0,1 M ditiotreitolo (DTT), 1 µ l (4 unità) dell'inibitore di RNAsi e 1 µ l della trascrittasi inversa (Vedi Tabella materiali).
    4. Incubare i campioni a 42 ° C per 60 min, quindi utilizzare 2 µ l della reazione di RT per analisi qPCR.
  3. Preparare la miscela di reazione di qPCR in un volume finale di 20 µ l composto da 10 µ l di mix master di 2 x qPCR, 2 µ l di modello di cDNA, 1 µ l di primer forward (10 µM), 1 µ l di primer reverse (10 µM) e 6 µ l di acqua.
  4. Eseguire qPCR reazione in un termociclatore utilizzando protocolli standard21.

4. produzione di un Retrovirus esprimendo MS2-GFP

  1. Per generare il retrovirus esprimenti MS2-GFP, transfect 80% confluenti phoenix imballaggio di cellule con una proteina di fusione GFP-MS2 esprimendo retrovirus vettoriali (pBabe-MS2-GFP PURO) e un gene env esprimendo vettore (ad esempio pCMV-VSVG) utilizzando un rapporto molare 4:1 di i due vettori.
  2. Il giorno seguente, è necessario sostituire il mezzo di coltura (DMEM supplementato con 10% FBS, 2 mM L-Glutammina e Pen/Strep) con fresca Media contenente 10mM del butirrato del sodio.
  3. Incubare per 8 h a 37 ° C, 5% CO2, quindi sostituire il mezzo con mezzo di coltura fresco da cui il virus saranno raccolto.
  4. Dopo 48 h, è necessario rimuovere il mezzo contenente retrovirus dalle cellule di phoenix. Questo mezzo può essere utilizzato direttamente per l'infezione di TERRA-MS2 cloni, nel qual caso il mezzo di filtrare attraverso un filtro da 0,45 µm, aggiungere polybrene (concentrazione finale di 30 µ g/mL) e aggiungerlo alle cellule (in questo caso il protocollo continua al passo 5). In alternativa, i retrovirus possono essere precipitati in un tubo falcon 50 mL aggiungendo volumeth 1/5 del 50% PEG-8000/900 mM NaCl soluzione e incubazione overnight a 4 ° C su una ruota di rotatore.
  5. Il giorno seguente, le particelle di retrovirus pellet mediante centrifugazione a 2.000 x g per 30 min, rimuovere il surnatante e risospendere il pellet in F12K medium senza siero.
    Nota: Le particelle di virus possono essere risospesi in 1/100th del surnatante volume originale. Un'infezione test dovrebbe essere eseguito al fine di verificare il volume minimo del retrovirus per infettare efficientemente le cellule necessaria.

5. visualizzazione delle trascrizioni di TERRA-MS2 in cellule viventi

  1. Piastra di TERRA-MS2 cloni e cellule WT AGS in piatti con fondo di vetro. Il giorno di infezione, è necessario aggiungere polybrene il medium (concentrazione finale di 30 µ g/mL) ed il retrovirus esprime MS2-GFP.
  2. Dopo 24 ore, eliminare il terreno contenenti virus e aggiungere mezzo fresco senza rosso fenolo.
  3. Analizzare le cellule al microscopio invertito utilizzando l'impostazione di microscopio appropriato. Immagine delle cellule con un 100 X o obiettivo 60x con grande apertura numerica (1.4 X) e utilizzando una telecamera sensibile (EMCCD). Utilizzare un sistema di controllo ambientale per mantenere i campioni a 37 ° C e 5% CO2 durante la formazione immagine.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Figura 1 rappresenta una panoramica della strategia sperimentale. I passaggi principali del protocollo e un calendario indicativo per la generazione di cloni di TERRA-MS2 in cellule AGS sono illustrati (Figura 1A). Giorno 1, più pozzetti di una piastra ben 6 transfected con la cassetta di MS2 e sgRNA/Cas9 esprimendo vettori (illustrati nella Figura 1B). Due sequenze di guida 15q specifici RNA subtelomeriche diversi vengono clonati in Cas9 nickase-esprimendo pX335 vettoriale, generando due vettori sgRNA-pX335 che sono co-trasfettate con la cassetta di MS2. Un pozzetto della piastra può essere transfected con un GFP esprimendo vettoriale per verificare l'efficienza di trasfezione. Al giorno 2, le cellule vengono tripsinizzate e trasferite da un singolo pozzo a un piatto di 10 cm contenente terreno selettivo. Al giorno 3, medio deve essere modificato come maggior parte delle cellule untransfected sarà morte. Le cellule sono coltivate in selezione fino a quando i cloni sono visibili e pronti per essere raccolti. Durante questo tempo, le cellule non dovrebbero essere tripsinizzate e medium di coltura deve essere cambiato ogni 1-2 giorni per la prima settimana e poi ogni 2-3 giorni in seguito. Una volta singoli cloni sono visibili, sono raccolte e trasferite in un piatto ben 96 dove possono crescere fino a 80-90% di confluenza. A questo punto, cloni sono divisi in 4 differenti 96 pozzetti, che sono segnati in Figura 1 con codice colore. Una volta che i cloni coltivati nella piastra di DNA (verde) raggiungono 80% confluenza, vengono lisate e DNA genomico estratto per la PCR di screening; i cloni nella piastrina d'appoggio (blu) saranno conservati nella cultura fino a quando i risultati di PCR screening, mentre le piastre di congelamento rosse vengono congelate a-80 ° C. Figura 2 B Mostra risultati rappresentativi di uno screening di PCR di cloni neomicina-resistenti. Per questo screening, vengono utilizzati due insiemi degli iniettori: coppia di un primer (primer MS2) ricottura all'interno della sequenza di 15q neomicina gene e subtelomeriche viene utilizzato per verificare la presenza della cassetta MS2 (un'immagine rappresentativa della localizzazione degli iniettori è mostrata in Figura 2A). Un secondo primer coppia (primer CTR) ricottura a una regione cromosomica interna viene utilizzata per verificare la presenza di falsi negativi cloni (sequenze dell'iniettore sono indicati nella tabella 1). Cloni negativi per l'integrazione della cassetta devono essere negativo all'amplificazione degli iniettori MS2 e positivo all'amplificazione degli iniettori CTR. Problemi tecnici nell'estrazione del DNA genomico con conseguente assenza di DNA genomico o sue contaminazioni precluderebbe l'amplificazione di PCR da reazioni di primer MS2 e CTR. In questi casi, i cloni coinvolti possono essere ri-proiettati da PCR dopo l'estrazione del DNA genomico dalla piastrina d'appoggio. Bande ottenute da amplificazione primer MS2 dei cloni positivi possono essere estratte dal gel e sequenziati utilizzando i primers MS2, al fine di confermare la presenza di sequenze di dieci MS2.

I cloni che sono positivi allo screening di PCR sono coltivati dalla piastrina d'appoggio ben 96 (il piatto blu nella Figura 1) in un piatto ben 6, poi lisate per estrazione del DNA genomico e analisi del sud della macchia. Figura 2 D Mostra immagini rappresentative di un gel (a sinistra) e la membrana ibridato con una radioattivamente MS2 sequenza sonda specifica (a destra) di uno screening del sud della macchia di cloni positivi di PCR. Per la conferma dell'integrazione di sequenze MS2 presso subtelomeriche 15q, DNA genomico Estratto da ogni clone dovrebbe essere digerito con due diversi enzimi di restrizione (NcoI e BamHI) nelle due reazioni di digestione separato. Gli enzimi di restrizione NcoI e BamHI sono adatti per la verifica dell'integrazione cassetta MS2 presso subtelomeriche 15q. Possono essere utilizzati anche altri enzimi. Il gel viene illustrato una completa digestione del DNA genomico usando l'enzima di restrizione BamHI, come indicato dalla presenza di una sbavatura. I risultati dalla macchia del sud indicano che un clone è positivo per l'integrazione della cassetta MS2 presso subtelomeriche 15q mentre diversi cloni mostrano più eventi di integrazione della cassetta, come indicato dalla presenza di bande multiple. Un clone positivo dovrebbe essere analizzato da una seconda macchia del sud sulla digestione NcoI di genomic DNA21. Un'immagine rappresentativa di una cassetta subtelomeriche 15q contenente il MS2 e la posizione dei siti di enzima di restrizione BamHI e NcoI è illustrati nella Figura 2C.

I cloni positivi alla PCR e Southern blot analisi sono infettati con un adenovirus che esprimono Cre-GFP al fine di rimuovere il gene di neomicina presente nella cassetta MS2. Figura 3 A raffigura un subtelomeriche MS2-etichetta 15q prima e dopo l'espressione di Cre. Un'immagine di un clone positivo per l'integrazione di cassetta MS2 presso subtelomeriche 15q è infettato da un Cre-GFP, che esprime l'adenovirus è illustrato nella Figura 3B. Per una rimozione completa del gene di neomicina in tutte le cellule, l'efficienza di infezione dovrebbe raggiungere circa il 100%. Come mostrato nella Figura 3C, al fine di verificare l'eliminazione del gene di neomicina, cellule Cre-GFP infettati sono divisi in tre piastre dopo 48 ore dall'infezione. Una piastra sarà coltivata in presenza di neomicina. Tutte le celle in questa piastra dovrebbero morire entro 6-7-giorni. In una seconda piastra, cellule saranno consentite di crescere in terreno completo senza selezione di confluenza di 80-90%. A questo punto, il DNA di genomic è estratto e analizzato dalla macchia del sud. Il terzo piatto è coltivato in terreno completo per consentire la preparazione degli stock congelati del clone e per l'estrazione di RNA e le analisi di RT-qPCR di espressione della trascrizione del TERRA-MS2. Figura 3 D Mostra immagini rappresentative delle analisi del sud della macchia di un clone positivo prima e dopo l'infezione Cre-GFP. Gel di agarosio di DNA (immagine a sinistra) conferma la completa digestione del DNA genomic usando l'enzima di restrizione NcoI. Analisi del sud della macchia è stata effettuata usando una radioattivo etichettato MS2-sequenza specifica sonda (immagine a destra). Questa analisi conferma la rimozione del gene di neomicina. La presenza di uno striscio del campione di Cre-GFP infettato conferma l'integrazione telomerica delle sequenze MS2. La posizione dei siti di restrizione NcoI entro il subtelomeriche 15q è mostrata in Figura 3A.

Una volta confermata l'eliminazione del gene di resistenza di neomicina, i cloni possono essere testati per l'espressione delle trascrizioni di TERRA-MS2. A questo scopo, RNA totale viene estratta da ogni clone e correre su un gel di MOPS denaturanti per confermare la sua integrità (Figura 4A). Bande di RNA ribosomiale (rRNA) dovrebbero essere visibile alle 4.700 basi (rRNA 28S) e 1.900 basi (rRNA 18S). Reazione di retrotrascrizione viene eseguita utilizzando un primer specifici di ripetizione telomerica e iniettore di gene-specific di riferimento (Figura 4B, in alto) mentre qPCR analisi di espressione di TERRA vengono eseguite utilizzando due insiemi degli iniettori: un iniettore ricottura di coppia all'interno della sequenza di MS2 e la sequenza di subtelomeriche 15q; una seconda coppia di primers ricottura entro il subtelomeriche 15q. Sequenze dell'iniettore sono indicati nella tabella 1. Il grafico presentato in Figura 4B Mostra RT-qPCR analisi di espressione di TERRA da cellule WT AGS e due cloni diversi di TERRA-MS2. Queste analisi confermano l'espressione delle trascrizioni di TERRA-MS2 nei due cloni a livelli che sono paragonabili alle trascrizioni TERRA espresse da subtelomeriche 15q nelle cellule WT. Questi dati indicano che i due cloni di TERRA-MS2 selezionati sono adatti per l'analisi delle trascrizioni di TERRA-MS2 da formazione immagine di cellule vive.

Al fine di visualizzare trascrizioni di TERRA-MS2 in cellule viventi, i cloni selezionati sono infettati con un retrovirus che esprimono la proteina di fusione GFP-MS2. Figura 5 A Mostra la procedura per generare retrovirus esprimenti MS2-GFP, come descritto nel protocollo passaggio 4. Cellule WT AGS e TERRA-MS2 cloni sono infettati in piatti con fondo di vetro. Dopo 24 h dall'infezione, le cellule sono analizzate mediante microscopia a fluorescenza. La specificità del segnale è confermata dalla presenza di foci di TERRA-MS2-GFP rilevato nel nucleo della TERRA-MS2 cloni e non nelle cellule WT AGS (Figura 5B). In una popolazione di MS2-GFP è previsto che esprimono le cellule, eterogeneità in termini di livelli di MS2-GFP fra le cellule e le cellule che esprimono bassi livelli dovrebbero essere scelti per le analisi di imaging. In alternativa, le cellule esprimenti MS2-GFP possono essere ordinate dalle analisi di FACS microscopia preventiva al fine di raccogliere la sottopopolazione delle cellule che esprimono bassi livelli di GFP. In precedenza abbiamo rilevato i fuochi TERRA-MS2-GFP in 40-60% delle cellule di AGS TERRA-MS2 cloni21. In queste cellule, uno a quattro fuochi di TERRA-MS2-GFP erano imaged per cella. I fuochi di TERRA-MS2-GFP mostrando dinamiche e formati distinti possono essere rilevati21. TERRA-MS2 cloni possono essere utilizzati per studiare la dinamica delle trascrizioni TERRA di singolo-telomero in cellule viventi. Come esempio di questa applicazione, Figura 5C Mostra immagini rappresentative da analisi di microscopia di un clone di TERRA-MS2 che esprimono la proteina di fusione GFP-MS2 e il telomero-proteina di che TRF2 fusa a mCherry al fine visualizzare trascrizioni MS2-etichetta TERRA e telomeri nelle cellule viventi. Utilizzando questo approccio, abbiamo precedentemente osservato che i fuochi di TERRA-MS2-GFP colocalizzano con telomeri nel 44% delle cellule, che indica che le trascrizioni TERRA solo transitoriamente co-localizzano con estremità cromosomiche in cellule AGS21.

Figure 1
Figura 1 . Panoramica della strategia sperimentale e un calendario indicativo per la generazione di TERRA-MS2 cloni in cellule di AGS. A) sono illustrati i passaggi descritti nel protocollo e una linea del tempo indicativo per la selezione di TERRA-MS2 cloni. Le cellule transfected in un piatto ben 6 con la linearizzato MS2 cassetta e sgRNA/Cas9 esprimendo vettori. Un codice di colore è utilizzato per distinguere la piastra di DNA, la piastrina d'appoggio e le piastre di congelamento indicato nella sezione protocollo. B) MS2 la cassetta è costituito da una sequenza di lunga subtelomeriche 15q nt 800 seguita da 10 ripetizioni delle sequenze MS2 e un gene di resistenza di neomicina affiancato da lox-p siti e termina con un tratto in ripetizione telomerica lungo 300 nt alla sua estremità 3'. vettori di espressione sgRNA/Cas9 sono stati generati da clonazione sequenze di guida 15q specifici RNA subtelomeriche nel vettore pX335 utilizzando il BbsI restrizione sito21,22. Due vettori diversi sgRNA-pX335 sono stati generati e un mix 1:1 dei due vettori è stato usato per la transfezione. Le sequenze della sgRNAs sono indicate nella tabella 1. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2 . Immagini rappresentative di PCR e Southern blot screening di cloni resistenti neomicina. A) immagine rappresentativa di subtelomeriche 15q contenente la cassetta MS2. La posizione degli iniettori MS2 (MS2-subtel15q-primer-S e MS2 primer come) utilizzato per lo screening di PCR è indicata. I siti loxP presenti all'interno della cassetta sono mostrati in rosso. B) immagine rappresentativa della proiezione di PCR di cloni resistenti neomicina utilizzando due set di primer, MS2 primer e primer CTR (CTR prime S e primer CTR come). C) immagine rappresentativa di subtelomeriche 15q contenente la cassetta MS2. Siti di restrizione BamHI e NcoI e la sonda di MS2 usato per lo screening del sud della macchia sono mostrati. D) sinistra: 10 µ g di DNA genomico per clone sono stati digeriti con BamHI e correre su un gel di agarosio. L'immagine è stata acquisita dopo un pernottamento a 30 volt. A destra: DNA genomic digerito con l'enzima di restrizione BamHI è stato trasferito ad una membrana di nylon caricato positivamente e ibridato con una sonda di sequenza-specific MS2 radioattivo etichettato. Il riquadro rosso indica la dimensione prevista della band positiva. La freccia rossa indica un clone positivo. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3 . Eliminazione degli esperimenti neomicina resistenza gene e convalida. A) immagine rappresentativa di subtelomeriche 15q contenente la cassetta MS2 prima e dopo l'espressione di Cre. La sonda specifica MS2 utilizzata per le analisi del sud della macchia e i siti di enzima di restrizione NcoI sono mostrati. I siti loxP presenti all'interno della cassetta sono mostrati in rosso. B) analisi di microscopia di fluorescenza di un clone di TERRA-MS2 infettato con adenovirus che esprimono Cre-GFP. Immagine rappresentativa ha acquisito presso un unico piano focale è mostrato. MOI, molteplicità di infezione, è il rapporto tra il numero di virus usati per l'infezione e il numero di cellule dell'ospite. Barra della scala: 30 µm C) Panoramica della strategia sperimentale utilizzata per verificare l'eliminazione del gene di neomicina. Le cellule Cre-GFP infettata sono divisi in tre piastre dopo 48 ore dall'infezione per selezione i) negativa, analisi ii) del sud della macchia e iii) preparazione delle scorte delle cellule congelate ed estrazione del RNA. D) le analisi del sud della macchia di un TERRA-MS2 clonare prima e dopo l'infezione dell'adenovirus Cre-GFP. 10 µ g di DNA genomic erano digerito con l'enzima di restrizione NcoI. Gel di agarosio conferma che la digestione completa avviene in entrambi i cloni (a sinistra). Il DNA di genomic digerito è stato trasferito ad una membrana di nylon caricato positivamente e ibridato usando una sonda di sequenza-specifico di MS2. L'eliminazione completa del gene di neomicina è confermato dall'assenza di banda specifica. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 4
Figura 4 . Analisi di RT-qPCR di Tel15q-TERRA e Tel15q-TERRA-MS2 espressione di trascrizioni. A) immagine rappresentativa di un gel di MOPS risultati RNA totale Estratto da cellule WT AGS e TERRA-MS2 cloni. Bande corrispondenti al RNA ribosomiale 28S e 18S sono indicati. B) Top: uno schema di subtelomeriche MS2-etichetta 15q esprimendo trascrizioni TERRA. Primer usati per retrotrascrizione TERRA (giallo) e analisi qPCR del Tel15q-TERRA (blu) e Tel15q-MS2 TERRA (rosso) sono mostrati. Il sito loxP è mostrato in rosso. In basso: Analisi di RT-qPCR dell'espressione di trascritti Tel15q-TERRA e TERRA Tel15q-MS2 nelle cellule WT AGS e TERRA-MS2 cloni. p < 0.05, spaiati t-test. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 5
Figura 5 . Live cell imaging analisi della TERRA-MS2 cloni. A) una panoramica della procedura per produrre un retrovirus esprime MS2-GFP, come descritto nel protocollo passaggio 4. Un disegno schematico della MS2-etichetta subtelomeriche 15q e trascrizioni TERRA riconosciute dalla proteina di fusione GFP-MS2 è mostrato a destra. B) immagine di microscopia fluorescenza rappresentativo di AGS WT e due TERRA-MS2 cloni che esprimono MS2-GFP. TERRA-MS2-GFP fuochi sono indicati dalle frecce. Immagini sono state acquisite utilizzando un microscopio confocale del disco rotante dotato di una fotocamera EMCCD. Le immagini sono state catturate utilizzando un 100 X / 1,46 apochromat obiettivo in una camera di imaging mantenuta a 37 ° C con 5% CO2. Un laser 488 è stato utilizzato come fonte di luce. Barra della scala: 5 µm. C) Live cell imaging analisi dei fuochi di TERRA-MS2-GFP e TRF2-mCherry etichettato i telomeri. Viene mostrato un evento co-localizzazione tra un focus di TERRA-MS2-GFP e un singolo telomero. Le immagini sono state acquisite come in B, usando laser 488 e 520 come sorgente luminosa. Una proiezione massima di un esperimento di stack z eseguita in una sola volta punto di time-lapse imaging esperimento è mostrato. Barra della scala: 5 µm. Clicca qui per visualizzare una versione più grande di questa figura.

Nome di primer Sequenza più superelegante Applicazione
MS2-subtel15q-primer-S TGCATTAAAGGGTCCAGTTG MS2 primer avanti utilizzati per lo screening di PCR di cloni resistenti neomicina
MS2 primer come CCTAACTGACACACATTCCACAGA MS2 primer reverse utilizzati per lo screening di PCR di cloni resistenti neomicina
Primer CTR S TGT ACG CCA ACA CAG TGC TG Primer CTR in avanti utilizzati nello screening di PCR di cloni resistenti neomicina
Primer CTR come GCT GGA AGG TGG ACA GCG A Primer CTR inversa utilizzati nello screening di PCR di cloni resistenti neomicina
Tel15q-S1 GCAGCGAGATTCTCCCAAGC Primer senso usato per rilevare l'espressione Tel15q e Tel15q-MS2 TERRA tramite qPCR
hTel15q-AS TAACCACATGAGCAATGTGGGTG Primer antisenso utilizzati per rilevare l'espressione Tel15q e Tel15q-MS2 TERRA di qPCR
Tel15q-MS2-AS ATGTTTCTGCATCGAAGGCATTAGG Primer antisenso utilizzati per rilevare Tel15q-MS2 TERRA espressione di qPCR
TERRA-RT-primer CCCTAACCCTAACCCTAACCCTAACCCTAA Primer utilizzati per retrotrascrizione di trascrizioni TERRA
sgRNA1 TTGGGAGAATCTCGCTGGCC Sequenza della Guida breve RNA 1 clonati nel vettore pX335 e utilizzato per indirizzare l'attività enzimatica di nickase di Cas9 a subtelomeriche 15q
sgRNA2 TGCATTAAAGGGTCCAGTTG Sequenza della Guida breve RNA 2 clonati nel vettore pX335 e utilizzato per indirizzare l'attività enzimatica di nickase di Cas9 a subtelomeriche 15q

Tabella 1 : Elenco dei primer utilizzati in questo studio. Un elenco dei primers e le sequenze di sgRNAs utilizzata nel presente protocollo sono forniti. Le sequenze sono 5' a 3'.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

In questo articolo presentiamo un metodo per generare cloni di cellule tumorali umane contenenti sequenze di MS2 integrati all'interno di subtelomeriche 15q. Utilizzando questi cloni, le molecole di MS2-etichetta TERRA trascritte da subtelomeriche 15q vengono rilevate da microscopia di fluorescenza di co-espressione di una proteina di fusione GFP-MS2. Questo approccio consente ai ricercatori di studiare la dinamica della TERRA espressa da un singolo dei telomeri in vita cellule21. In questo protocollo, TERRA-MS2 cloni sono selezionati nella linea cellulare AGS, che rappresenta un interessante sistema di modello per studiare la TERRA, poiché l'espressione TERRA è aumentata in stomaco umano cancro campioni24. Tuttavia, il protocollo qui descritto può essere adattato per la selezione di cloni di TERRA-MS2 in altre linee cellulari. L'integrazione delle sequenze MS2 può in linea di principio essere promosso a un diverso dal telomero 15q subtelomeriche utilizzando una specifica cassetta a MS2 e strategia CRISPR. Nel metodo presentato qui, un enzima di nickase Cas9 e doppia guida RNAs sono impiegati al fine di aumentare la specificità di integrazione22. Utilizzando questa strategia, complessivamente al 2% dei cloni positivi devono essere identificati in cellule di AGS. Altre versioni dell'enzima Cas9 possono essere testati nel tentativo di aumentare il tasso di successo dei cloni selezione25. Inoltre, i seguenti passaggi del protocollo sono quelli critici di prendere in considerazione per massimizzare l'efficienza della selezione clone:

I) al fine di aumentare le possibilità di selezionare i cloni di TERRA-MS2, è importante raggiungere un'efficienza di trasfezione alta della cassetta MS2 e i vettori CRISPR. Linee cellulari trasfettate scarsamente richiederà probabilmente diversi giri di transfezione, selezione clonale e screening al fine di selezionare cloni positivi.

II) è importante determinare la concentrazione precisa della neomicina da utilizzare per la selezione dei cloni. Infatti, utilizzando una bassa concentrazione del farmaco si tradurrà in cloni positivi falsi mentre un'alta concentrazione può precludere l'identificazione dei cloni positivi. La concentrazione di neomicina indicata in questo protocollo è letale per le cellule AGS entro 6-7 giorni dall'aggiunta al mezzo di coltura.

III) clone picking è un passo fondamentale. Infatti, durante questa procedura è necessario che solo singoli cloni sono raccolti. Per questo motivo, le colonie che sono troppo vicino a che vicenda dovrebbe essere evitato al fine di evitare la miscelazione cellule da diversi cloni, conseguente la selezione di una popolazione mista di cloni che possono contenere sequenze di MS2 integrata a più siti genomici. Questi eventi dovrebbero essere identificati durante la proiezione del sud della macchia.

IV) la quantità di DNA genomico Estratto da una piastra di DNA ben confluenti 96 (protocollo n. 2) è stimata per essere di circa 5 µ g e dovrebbe essere sufficiente per ogni clone mediante PCR e Southern blotting con digestione degli enzimi di limitazione singolo a schermo. Tuttavia, al fine di confermare l'integrazione della cassetta presso il telomero previsto, sarà importante allo schermo ogni clone dalla macchia del sud digerendo il DNA genomico con due diversi enzimi di restrizione. A questo scopo, come indicato nel protocollo, i cloni positivi allo screening di PCR dovrebbero essere colti in 6 piastre a pozzetti. La quantità di DNA genomico Estratto da un pozzetto di una piastra ben 6 sarà sufficiente per almeno due digestioni di restrizione necessarie per le analisi del sud della macchia.

Nel protocollo descritto qui, le sequenze di MS2 sono integrate all'interno di subtelomeriche 15q per una serie di motivi: i) regione del promotore TERRA e siti di inizio di trascrizione di TERRA sono stati identificati su questo subtelomeriche26,27; II) espressione di TERRA da subtelomeriche 15q è stato convalidato utilizzando in vitro tecniche4,27,28,29,30; III) la regione subtelomerica del cromosoma 15q è stata sequenziata e contiene una regione unica adiacente al tratto ripetizione telomerica che possa essere destinato per l'integrazione del MS2-cassetta21. PCR e del sud della macchia approcci sono stati sviluppati al fine di confermare la sola integrazione delle sequenze MS2 entro subtelomeriche 15q in the cloni di TERRA-MS2. Sarebbe interessante anche eseguire esperimenti di DNA-FISH su cromosomici per visualizzare la localizzazione cromosomica delle sequenze MS2 in cromosomi in metafase fissa. Tuttavia, la lunghezza della 10xMS2 sequenze (450 bp) impone l'utilizzo di sonde molto breve rispetto alle sonde generalmente utilizzate in esperimenti di DNA-FISH su cromosoma spread (cromosomi artificiali batterici (Bac), cosmidi o plasmidi)31. Questa sfida tecnica ci ha impedito di visualizzare le sequenze di MS2 su cromosomici che rappresenta una limitazione del protocollo. Una limitazione ulteriore del metodo è il tempo e lo sforzo richiesto per la selezione di cloni TERRA-MS2. Inoltre, impostare specifiche di laboratorio e attrezzature per l'uso di virus, materiale radioattivo e analisi di microscopia sono necessari.

Il metodo qui descritto può essere implementato per la generazione di cloni di TERRA-MS2 in differenti linee cellulari al fine di definire le dinamiche della TERRA in vari contesti biologici, come ad esempio durante la senescenza cellulare o disfunzione dei telomeri, aiutandoci a capire la funzione di TERRA in questi processi. Un interessante sviluppo di questo approccio sarà la generazione di cloni di TERRA-MS2 contenente TetO ripete integrato a un subtelomeriche specifiche, tra cui il telomero MS2-etichetta. L'espressione di una proteina di TetR fusa ad una proteina fluorescente (cioè, mCherry) consentirà la visualizzazione di questo particolare dei telomeri in vita celle32. Questo approccio consentirà di indagine se umano TERRA trascrizioni localizzare e agiscono in cis del terra trascrivere dei telomeri e cromosoma o in trans da trasferirsi in altri cromosomi. Questa domanda nella biologia della TERRA rimane essere chiarito.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non dichiarano concorrenti interessi finanziari

Acknowledgments

Siamo grati per il personale della struttura imaging avanzata del CIBIO presso l'Università di Trento e l'impianto di microscopia luce BioOptics a Max F. Perutz laboratori (MFPL) a Vienna. La ricerca che porta a questi risultati ha ricevuto non finanziamenti dalla Stiftung Mahlke-Obermann e il settimo programma dell'Unione europea quadro di ricerca, sviluppo tecnologico e dimostrazione sotto convenzione di sovvenzione 609431 CE. CE è supportato da un fellowship di Montalcini dal Ministero dell'istruzione Università e ricerca (MIUR).

Materials

Name Company Catalog Number Comments
AGS cells - - Gift from Christian Baron (Université de Montréal).
F12K Nut Mix 1X GIBCO 21127022 Culturing medium for AGS cells
L-Glutamine  CORNING MT25005CI Component of cell culturing medium
Penicillin Streptomycin Solution CORNING 30-002-CI Component of cell culturing medium
Fetal Bovine Serum Sigma Aldrich F2442 Component of cell culturing medium
DMEM 1X GIBCO 21068028 culturing medium for phoenix cell
CaCl2 Sigma Aldrich C1016 used in phoenix cell transfection
HEPES Sigma Aldrich H3375 used in phoenix cell transfection (HBS solution)
KCl Sigma Aldrich P9333 used in phoenix cell transfection (HBS solution)
Dextrose Sigma Aldrich D9434 used in phoenix cell transfection (HBS solution)
NaCl Sigma Aldrich S7653 used in phoenix cell transfection (HBS solution) and retrovirus precipitation
Na2HPO4 Sigma Aldrich S3264 used in phoenix cell transfection (HBS solution)
TRYPSIN EDTA SOLUTION 1X CORNING 59430C used in cell split
DPBS 1X GIBCO 14190250 Dulbecco's Phosphate Buffered Saline
DMSO Sigma Aldrich D8418 Component of cell freezing medium (80% FBB and 20% DMSO)
G-418 Disulphate Formedium G4185 selection drug for 
Gelatin solution Bioreagent Sigma Aldrich G1393 cotaing of 96 well DNA plate and freezing plate
Tris-base Fisher BioReagents 10376743 Component of Cell lysis buffer for genomic DNA extraction
EDTA Sigma Aldrich E6758 Component of Cell lysis buffer for genomic DNA extraction
SDS Sigma Aldrich 71729 Component of Cell lysis buffer for genomic DNA extraction
Proteinase K Thermo Fisher AM2546 Component of Cell lysis buffer for genomic DNA extraction
RNAse A Thermo Fisher 12091021 RNA degradation during DNA extraction
Agarose Sigma Aldrich A5304 DNA gel preparation
Atlas ClearSight Bioatlas BH40501 Stain reagent used for detecting DNA and RNA samples in agarose gel
ethanol Fisher BioReagents BP28184 DNA precipitation
Sodium Acetate  Sigma Aldrich 71196 Used for DNA precipitation at a 3M concentration pH5.2
Wizard SV Gel and PCR clean-Up system Promega A9282 Extraction of PCR fragments from agarose gel during PCR screening of neomycin positive clones
Trizol AMBION 15596018 Organic solvent used for RNA extraction
Dnase I THERMO SCIENTIFIC 89836 degradation of genomic DNA from RNA 
dNTPs mix Invitrogen 10297018 used in RT and PCR reactions
DTT Invitrogen 707265ML used in RT reactions
diethyl pyrocarbonate Sigma Aldrich D5758 used to inactivate RNAses in water (1:1000 dilution)
Ribolock Thermo Fisher EO0381 RNase inhibitor
MOPS Sigma Aldrich M9381 preparation of RNA gel
Paraformaldehyde Electron Microscopy Sciences 15710 preparation of denaturating RNA gel (1% PFA in 1x MOPS)
Superscript III Reverse transcriptase Invitrogen 18080-093 Retrotranscription reaction
Pfu DNA polymerase (recombinant) Thermo Scientific EP0501 PCR reaction
2X qPCRBIO SyGreen Mix Separate-ROX PCR BIOSYSTEMS PB 20.14 qPCR reaction
Cre-GFP adenovirus https://medicine.uiowa.edu/vectorcore 1174-HT used to infect TERRA-MS2 clones in order to remove the neomycn gene
Sodium Butyrate Sigma Aldrich B5887 used to promote retrovirus particles production in phoenix cells
PEG8000 Sigma Aldrich 89510 Precipitation of retrovirus partcles
35µ-Dish Glass Bottom Ibidi 81158 used in live cell imaging analyses of TERRA-MS2 clones

DOWNLOAD MATERIALS LIST

References

  1. Azzalin, C. M., Reichenbach, P., Khoriauli, L., Giulotto, E., Lingner, J. Telomeric repeat containing RNA and RNA surveillance factors at mammalian chromosome ends. Science. 318, (5851), 798-801 (2007).
  2. Schoeftner, S., Blasco, M. A. Developmentally regulated transcription of mammalian telomeres by DNA-dependent RNA polymerase II. Nature Cell Biology. 10, (2), 228-236 (2008).
  3. Diman, A., Decottignies, A. Genomic origin and nuclear localization of TERRA telomeric repeat-containing RNA: from Darkness to Dawn. FEBS Journal. (2017).
  4. Arnoult, N., Van Beneden, A., Decottignies, A. Telomere length regulates TERRA levels through increased trimethylation of telomeric H3K9 and HP1alpha. Nature Structural & Molecular Biology. 19, (9), 948-956 (2012).
  5. Montero, J. J., et al. TERRA recruitment of polycomb to telomeres is essential for histone trymethylation marks at telomeric heterochromatin. Nature Communications. 9, (1), 1548 (2018).
  6. Beishline, K., et al. CTCF driven TERRA transcription facilitates completion of telomere DNA replication. Nature Communications. 8, (1), 2114 (2017).
  7. Arora, R., et al. RNaseH1 regulates TERRA-telomeric DNA hybrids and telomere maintenance in ALT tumour cells. Nature Communications. 5, 5220 (2014).
  8. Balk, B., et al. Telomeric RNA-DNA hybrids affect telomere-length dynamics and senescence. Nature Structural & Molecular Biology. 20, (10), 1199-1205 (2013).
  9. Graf, M., et al. Telomere Length Determines TERRA and R-Loop Regulation through the Cell Cycle. Cell. 170, (1), 72-85 (2017).
  10. Lee, Y. W., Arora, R., Wischnewski, H., Azzalin, C. M. TRF1 participates in chromosome end protection by averting TRF2-dependent telomeric R loops. Nature Structural & Molecular Biology. (2018).
  11. Moravec, M., et al. TERRA promotes telomerase-mediated telomere elongation in Schizosaccharomyces pombe. EMBO Reports. 17, (7), 999-1012 (2016).
  12. Cusanelli, E., Romero, C. A., Chartrand, P. Telomeric noncoding RNA TERRA is induced by telomere shortening to nucleate telomerase molecules at short telomeres. Molecular Cell. 51, (6), 780-791 (2013).
  13. Moradi-Fard, S., et al. Smc5/6 Is a Telomere-Associated Complex that Regulates Sir4 Binding and TPE. PLoS Genetics. 12, (8), e1006268 (2016).
  14. Chu, H. P., et al. TERRA RNA Antagonizes ATRX and Protects Telomeres. Cell. 170, (1), 86-101 (2017).
  15. Lai, L. T., Lee, P. J., Zhang, L. F. Immunofluorescence protects RNA signals in simultaneous RNA-DNA FISH. Experimental Cell Research. 319, (3), 46-55 (2013).
  16. Zhang, L. F., et al. Telomeric RNAs mark sex chromosomes in stem cells. Genetics. 182, (3), 685-698 (2009).
  17. Gallardo, F., Chartrand, P. Visualizing mRNAs in fixed and living yeast cells. Methods in Molecular Biology. 714, 203-219 (2011).
  18. Querido, E., Chartrand, P. Using fluorescent proteins to study mRNA trafficking in living cells. Methods in Cell Biology. 85, 273-292 (2008).
  19. Cusanelli, E., Chartrand, P. Telomeric noncoding RNA: telomeric repeat-containing RNA in telomere biology. Wiley Interdisciplinary Reviews: RNA. 5, (3), 407-419 (2014).
  20. Perez-Romero, C. A., Lalonde, M., Chartrand, P., Cusanelli, E. Induction and relocalization of telomeric repeat-containing RNAs during diauxic shift in budding yeast. Current Genetics. (2018).
  21. Avogaro, L., et al. Live-cell imaging reveals the dynamics and function of single-telomere TERRA molecules in cancer cells. RNA Biology. 1-10 (2018).
  22. Ran, F. A., et al. Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell. 154, (6), 1380-1389 (2013).
  23. Yamada, T., et al. Spatiotemporal analysis with a genetically encoded fluorescent RNA probe reveals TERRA function around telomeres. Scientific Reports. 6, 38910 (2016).
  24. Deng, Z., et al. Formation of telomeric repeat-containing RNA (TERRA) foci in highly proliferating mouse cerebellar neuronal progenitors and medulloblastoma. Journal of Cell Science. 125, (Pt 18), 4383-4394 (2012).
  25. Casini, A., et al. A highly specific SpCas9 variant is identified by in vivo screening in yeast. Nature Biotechnology. 36, (3), 265-271 (2018).
  26. Nergadze, S. G., et al. CpG-island promoters drive transcription of human telomeres. RNA. 15, (12), 2186-2194 (2009).
  27. Porro, A., et al. Functional characterization of the TERRA transcriptome at damaged telomeres. Nature Communications. 5, 5379 (2014).
  28. Farnung, B. O., Brun, C. M., Arora, R., Lorenzi, L. E., Azzalin, C. M. Telomerase efficiently elongates highly transcribing telomeres in human cancer cells. PLoS One. 7, (4), e35714 (2012).
  29. Flynn, R. L., et al. Alternative lengthening of telomeres renders cancer cells hypersensitive to ATR inhibitors. Science. 347, (6219), 273-277 (2015).
  30. Scheibe, M., et al. Quantitative interaction screen of telomeric repeat-containing RNA reveals novel TERRA regulators. Genome Research. 23, (12), 2149-2157 (2013).
  31. Bolland, D. J., King, M. R., Reik, W., Corcoran, A. E., Krueger, C. Robust 3D DNA FISH using directly labeled probes. Journal of Visualized Experiments. (78), (2013).
  32. Masui, O., et al. Live-cell chromosome dynamics and outcome of X chromosome pairing events during ES cell differentiation. Cell. 145, (3), 447-458 (2011).
Generazione di cloni delle cellule di cancro per visualizzare Telomeric Repeat-contenente RNA TERRA espresso da un singolo dei telomeri nelle cellule viventi
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Avogaro, L., Oss Pegorar, C., Bettin, N., Cusanelli, E. Generation of Cancer Cell Clones to Visualize Telomeric Repeat-containing RNA TERRA Expressed from a Single Telomere in Living Cells. J. Vis. Exp. (143), e58790, doi:10.3791/58790 (2019).More

Avogaro, L., Oss Pegorar, C., Bettin, N., Cusanelli, E. Generation of Cancer Cell Clones to Visualize Telomeric Repeat-containing RNA TERRA Expressed from a Single Telomere in Living Cells. J. Vis. Exp. (143), e58790, doi:10.3791/58790 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter