Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Geração de Clones de células câncer Visualizar oligospermia Repeat-contendo RNA TERRA expressado de um único dos telômeros em células vivas

doi: 10.3791/58790 Published: January 17, 2019

Summary

Aqui, apresentamos um protocolo para gerar clones de células de câncer que contém uma marca de sequência MS2 em um único subtelomere. Esta abordagem, baseando-se no sistema MS2-GFP, permite a visualização de transcrições endógenas de oligospermia repetição contendo RNA (TERRA) expressado de um único dos telômeros em células vivas.

Abstract

Telômeros são transcritas, dando origem a oligospermia repetição-contendo o tempo não-codificante RNAs (TERRA), que têm sido propostos para desempenhar um papel importante na biologia do telômero, incluindo formação de heterocromatina e homeostase do comprimento dos telômeros. Descobertas recentes revelaram que as moléculas TERRA também interagirem com regiões cromossômicas internas para regular a expressão gênica em células-tronco embrionárias (ES) do mouse. Em consonância com esta evidência, RNA fluorescência em situ hibridização RNA-análises mostraram que somente um subconjunto de TERRA transcrições localizar nas extremidades do cromossomo. Uma melhor compreensão da dinâmica das moléculas da TERRA ajudará a definir sua função e mecanismos de ação. Aqui, descrevemos um método para rotular e visualizar as transcrições TERRA single-telômero nas células cancerosas, usando o sistema MS2-GFP. Para este objetivo, apresentamos um protocolo para gerar clones estáveis, usando a linhagem de células de câncer de estômago humano AGS, contendo sequências MS2 integradas em um único subtelomere. Transcrição de TERRA do telômero MS2-tag resulta na expressão de moléculas TERRA MS2-marcados que são visualizados por microscopia de fluorescência de viver-pilha sobre co expressão de uma proteína RNA MS2-fundida a GFP (MS2-GFP). Esta abordagem permite aos pesquisadores estudar a dinâmica de moléculas TERRA single-telômero nas células cancerosas, e pode ser aplicado a outras linhas de célula.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

O tempo não-codificante TERRA de RNA é transcrito da região subtélomérique dos cromossomos e sua transcrição prossegue em direção as extremidades do cromossoma, encerra-se no âmbito do trato repetição oligospermia1,2. Por esta razão, transcrições TERRA consistem em sequências de derivados de subtelomeric na sua extremidade 5' e encerrar com repetições teloméricas (UUAGGG em vertebrados)3. Importantes funções têm sido propostos para a TERRA, incluindo a formação de heterocromatina telômeros4,5, DNA replicação6, promovendo uma recombinação homóloga entre cromossomo termina7,8 , 9, regulamenta o telômero estrutura10e telômero comprimento homeostase2,11,12,13. Além disso, transcrições TERRA interagirem com inúmeros locais de extratelomeric para regular a expressão gênica generalizada em rato de células estaminais embrionárias (ES)14. Em consonância com estas provas, RNA fluorescência em situ da hibridação análises (RNA-FISH) têm demonstrado que somente um subconjunto de transcrições TERRA localizar ao telômeros1,2,15. Além disso, a TERRA tem sido relatado para agregados nucleares de forma localizando nos cromossomos X e Y em células de rato2,16. Estes resultados indicam que as transcrições TERRA sofrer uma dinâmica complexa dentro do núcleo. Compreensão da dinâmica das moléculas da TERRA ajudará a definir sua função e mecanismos de ação.

O sistema MS2-GFP tem sido amplamente utilizado para visualizar moléculas de RNA em células vivas de vários organismos17,18. Este sistema tem sido anteriormente usado para tag e Visualizar moléculas TERRA single-telômero em S. cerevisiae12,19. Usando este sistema, recentemente foi demonstrado que as transcrições TERRA de levedura localizar dentro do citoplasma durante a fase de mudança de post-diauxic, sugerindo que a TERRA pode exercer funções extranuclear20. Recentemente nós usamos o sistema MS2-GFP estudar transcrições TERRA single-telômero em células de câncer21. Para este objectivo, que empregou a ferramenta de edição de genoma CRISPR/Cas9 integrar MS2 sequências em um único telômero (telômero 15q, doravante Tel15q) e obtidos clones expressando MS2-tag endógena Tel15q TERRA (TERRA-MS2 clones). Co a expressão de uma proteína GFP-fundido MS2 RNA-obrigatórias (MS2-GFP) que reconhece e liga MS2 RNA sequências permite visualização de transcrições TERRA single-telômero na vida células21. O objetivo do protocolo ilustrado aqui é descrever em detalhe os passos necessários para a geração de clones de TERRA-MS2.

Para gerar TERRA-MS2 clones, uma gaveta MS2 é integrada dentro da região de subtélomérique do telômero 15q, a jusante do TERRA promotor região e transcrição iniciar site. A MS2 gaveta contém um gene de resistência de neomicina ladeado por sites de salmão fumado-p, e sua integração no subtelomere 15q é executada usando o sistema CRISPR/Cas922. Depois de Transfeccao de gaveta, única clona o MS2 são selecionados e subtélomérique integração da fita é verificada pelo PCR, DNA, sequenciamento e Southern blot. Clones positivos estão infectados com um vírus adenoide Cre-expressando a fim de remover o marcador de seleção na gaveta, deixando apenas as sequências MS2 e um site único lox-p no subtelomere 15q. Expressão de transcritos TERRA MS2-tag de Tel15q é verificada por RT-qPCR. Finalmente, a proteína de fusão MS2-GFP é expressa em TERRA-MS2 clones através de infecção retroviral para visualizar as transcrições MS2-TERRA por microscopia de fluorescência. Transcrições TERRA podem ser facilmente detectadas por RNA-peixe e imagem latente da viver-pilha usando específicas repetição oligospermia sondas1,2,15,23. Estas abordagens fornecem informações importantes sobre a localização da população total de moléculas TERRA em resolução de célula única. A geração de clones contendo MS2 sequências em um único subtelomere permitirá aos pesquisadores estudar a dinâmica de transcrições TERRA single-telômero em células vivas, o que ajudarão a definir a função e os mecanismos de ação da TERRA.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Seleção de Clones resistentes de neomicina

  1. Desenvolvem-se células AGS no meio de F-12_K do Ham (do Kaighn) suplementado com 10% de soro bovino Fetal (FBS), 2 mM L-glutamina, penicilina (0,5 unidades por mL de meio) e estreptomicina (0,2 µ g / mL de meio) a 37 ° C e 5% de CO2. Transfect as células em uma confluência de 50-60% com a sgRNA/Cas9 expressando o vetor e o cassette MS2 em um 01:10 razão molar21.
    Nota: Em um experimento paralelo, verificar eficiência do transfection transfecting um vetor GFP-expressando (i.e., Cas9-GFP vetor). Pelo menos 60-70% de eficiência de transfeccao deve ser alcançado.
  2. No dia seguinte, substitua o meio de cultivo com meio contendo neomicina na concentração final de 0,7 µ g/mL (meio selectivo).
    Nota: Divisão das células e semeadura-los em meio seletivo no dia seguinte a transfeccao irá acelerar o processo de seleção. Todas as células transfectadas não morrerão imediatamente. Se transfeccao é executado em 6 pratos bem, caso em que cada poço em um 60% confluência conteria aproximadamente 0,7 x 106 células, no dia seguinte que as células podem ser divididas de um único poço para um meio selectivo contendo prato de 10 cm.
  3. Manter as células em meio seletivo para 7-10 dias, alterando o meio de cada um ou dois dias, até o clona single são visíveis.
  4. Colheita de clones de células
    1. Prepare um prato bem 96 contendo 10 µ l de tripsina 0,25% em cada poço.
      Nota: Preparar dois 96 placas bem no caso de mais de 96 clones são esperados para ser escolhido.
    2. Com o uso de um microscópio, marca a posição de cada clone visível no prato 10cm, tornando um ponto na parte inferior do prato usando um marcador. Cada ponto corresponderá a uma colônia a ser escolhido.
    3. Substitua o meio de cultivo com suficiente fosfato tamponado salino (PBS) para formar uma fina película de líquido sobre os clones e não deixar que as células a seco durante a colheita de clone.
    4. Escolha colônias simples usando uma pipeta de 10 µ l. Coloque a ponta contendo 5 µ l de tripsina à colônia e libere lentamente a tripsina que continuará a ser localizada na colônia. Permitir que a tripsina separar as células por 1 min, em seguida, raspar a colônia com a ponta e chupa-lo na ponta.
      Nota: Durante este procedimento, invertendo o prato um pouco de um lado assim diminuir o volume de PBS em torno da colônia ser escolhido vai ajudar o processo de colheita, evitando a diluição da tripsina em torno da colônia. Usar um anel de clone também pode ajudar a pegar clones único.
    5. Coloque as células da colônia em um poço da placa de 96 bem, contendo 10 µ l de tripsina 0,25%.
    6. Incubar a 5 min à temperatura ambiente e, em seguida, encher o poço com 150 µ l de meio seletivo (média F - 12K do Ham (do Kaighn) suplementado com 10% FBS, 2 mM L-glutamina, penicilina (0,5 unidades por mL de meio), estreptomicina (0,2 µ g / mL de meio) e contendo neomicina no uma concentração de 0,7 µ g/mL.
      Nota: Durante o tempo de incubação outros clones podem ser selecionados. É recomendável escolher clones tantos quanto possível. Os clones mais são colhidos maior será as chances de identificar os positivos.
    7. Uma vez que todos os clones são escolhidos e transferidos em placa de 96 bem, permitem que as células a crescer durante alguns dias em meio seletivo F - 12K do Ham (do Kaighn) suplementado com 10% FBS, 2 mM L-glutamina, penicilina (0,5 unidades por mL de meio), estreptomicina (0,2 µ g / mL do meio) e contendo neomicina em concentrações de 0,7 µ g/mL em 37 ° C e 5% CO2, até alcançar a confluência de 90%.
  5. Separação dos clones
    1. Preparar três 96 placas bem revestidas com gelatina por adicionar 100 µ l de gelatina por alvéolo, incube durante 30 min à temperatura ambiente e, em seguida, lave duas vezes com PBS. Estas placas serão usadas para a extração de DNA (placa de DNA) e para clone congelamento (placas de congelamento).
      Nota: Gelatina promoverá a fixação das células e do DNA aos poços. Em particular, o revestimento de gelatina permitirá o DNA para pôr no fundo dos poços durante a extração de DNA e lavar os procedimentos (discutidos abaixo). Durante o procedimento de divisão de clone, é aconselhável usar uma pipeta multicanal.
    2. Assim clones atingem 90% confluência, Aspire o meio de cada poço da placa de 96 bem, lave com PBS, adicionar 30 µ l de tripsina 0,25% por bem e incubar durante 5 min a 37 ° C.
      Nota: Clones crescerá em taxas diferentes, o que também dependerá do número de células escolhido por clone. Assim, esta etapa será realizada durante os dias quando os clones diferentes alcançar confluência de 90%.
    3. Adicionar 70 µ l de meio seletivo por alvéolo, perturbar aglomerados de células pipetando para cima e para baixo dentro dos poços e, em seguida, transferir 30 µ l da 100 µ l para a placa de DNA gelatinizada pré-carregadas com 120 µ l de meio seletivo por bem e 30 µ l para a sagacidade pré-carregadas gelatinizado de congelação placas meio de h 50 µ l (sem seleção).
    4. Coloque a placa de DNA na incubadora e permitir que as células a crescer a 37 ° C e 5% de CO2 até confluência de 90%.
    5. Adicione 80 µ l de gelado acabadas 2x congelamento médio (80% FBS e 20% dimetilsulfóxido (DMSO)) para cada poço da placa de congelamento, adicionar parafilm (pulverizado com 70% de etanol) em cima da placa para selar cada poço, coloque a tampa por cima e enrole a placa com folha de alumínio. Colocar as placas de congelamento a-80 ° C.
    6. Adicione 90 µ l de meio seletivo por alvéolo para a placa bem 96 original contendo os clones que foram separados e mantém-lo em cultura até PCR resultados de rastreio. Esta placa será usada como placa de backup.

2. seleção de Clones resistentes de neomicina

  1. Extração de DNA da placa de DNA bem de 96.
    1. Uma vez que os clones cultivados na placa ADN alcançar 90% confluência, lave 2 vezes com PBS e, em seguida, lyse com 50 µ l do lysis (10 mM Tris pH 7.5, 10 mM de EDTA, 10 mM de NaCl, SDS 0,5% e 1 mg/mL da protease K). Cubra o prato com parafilm, lacrar cada poço, colocar a tampa, cubra com película aderente e coloque a 37 ° C durante a noite.
    2. Adicione 100 µ l de etanol frio (Et-OH) / solução de NaCl (0,75 M de NaCl em 100% de etanol) para cada um bem e precipitar para 6 h ou durante a noite em temperatura ambiente.
      Nota: O protocolo pode ser pausado aqui.
    3. Remover a solução de NaCl/Et-OH invertendo-se o prato e lavar 3 vezes com 200 µ l de etanol 70% por poço.
    4. Adicione 25 µ l de solução de RNAse A em água destilada e incubar a 37 ° C, durante 1 h.
  2. Use 3 µ l de DNA genômico para amplificação por PCR. Realize triagem de PCR dos clones selecionados usando as primeiras demão recozimento dentro do gene de resistência de neomicina e subtelomere 15q. Amplificação por PCR é realizada usando enzimas polimerase padrão e de protocolos PCR21.
    Nota: As condições PCR para MS2 primers (cartilha MS2-subtel15q-cartilha-S e MS2 como) e as primeiras demão CTR (prime CTR S e CTR primer como) são as seguintes: 98 ° C por 20 s como etapa da desnaturação e então 34 ciclos de 98 ° C 10 s, 58° C 20 s, 72 ° C 15 s , utilizando a enzima polimerase em um 25 µ l reação misturar (ver Tabela de materiais). Sequências da primeira demão são indicadas na tabela 1.
  3. Executar as reações de PCR em gel de agarose e extrair faixas PCR obtidas de clones positivos usando procedimentos de extração padrão do gel (consulte Tabela de materiais para reagentes de extracção de gel).
  4. Realizar análises de sequenciamento de DNA do produto gel-extraído do PCR para confirmação da presença do MS2 sequências21.
    Nota: As análises de sequenciamento podem ser realizadas utilizando os primers utilizados para o rastreio de PCR.
  5. Borrão do Sul seleção de clones positivos de PCR
    1. Crescem os clones positivos na PCR e rastreio de sequenciamento da placa bem 96 original (a placa de backup) para 6 placas bem no meio F - 12K do Ham (do Kaighn) suplementado com 10% FBS, 2 mM L-glutamina, penicilina (0,5 unidades por mL de meio), estreptomicina (0,2 µ g por mL de meio) e contendo neomicina em uma concentração de 0,7 µ g/mL em 37 ° C 5% CO2.
      Nota: Como alternativa, se alguns destes clones foram perdidos, descongelá-los de uma das placas de congelamento (ver protocolo 2.6).
    2. Uma vez que os clones estão na confluência de 90% em 6 placa bem, lavar as células com PBS e adicionar 250 µ l de tampão de Lise contendo 0,5 µ g proteinase K por bem.
    3. Raspar as células com uma espátula de célula e transfira o lisado em um tubo de 1,5 mL.
    4. Incube a 37 ° C, durante 16 h.
    5. Adicione 1 mL de etanol a 100%, agitar vigorosamente e permitir que o DNA precipitar a pelo menos 2 h ou durante a noite a-20 ° C.
      Nota: O protocolo pode ser pausado aqui.
    6. Girar a 13.400 x g a 4 ° C por 10 min, desprezar o sobrenadante e lavar as pelotas com etanol a 70%. Deixe o ar de pelotas secar à temperatura ambiente. Como alternativa, use um concentrador a vácuo.
    7. Resuspenda as pelotas de DNA em 50 µ l de água destilada contendo RNAse A e incubar durante 1 h a 37 ° C.
    8. Digeri a 5-10 µ g de DNA genômico, usando enzimas de restrição NcoI e BamHI (duas digestões independentes) em volume de reação de 100 µ l, incubando-se as reações de digestão a 37 ° C durante a noite.
    9. Execute 4 µ l da digestão em gel de agarose (agarose 0,8%) para confirmação de digestão completa.
    10. Adicionar o volume de 1/10 de sódio acetato 3M solução pH 5.2 e 2 volumes de etanol 100% para as reações de digestão de restrição e incubar a pelo menos 2 h ou durante a noite a-20 ° C para precipitar o DNA.
      Nota: O protocolo pode ser pausado aqui.
    11. Centrifugar a 13.400 x g a 4 ° C por 20 min, descartar os sobrenadantes e lavar as pelotas com etanol a 70%. Permitir que as bolinhas de ar seco à temperatura ambiente. Como alternativa, use um concentrador a vácuo.
    12. Resuspenda pelotas em 20 µ l de água destilada e carregar o DNA digerido em um gel de agarose 0,8%.
      Nota: Para uma melhor resolução do DNA digerido, preparar um gel de pelo menos 15 cm longo e correr durante a noite em baixa tensão (volts ̴30). A eletroforese configurado deve ser otimizada.
    13. No dia seguinte, manchar o gel com um agente de rotulagem de DNA, como o brometo de etídio em concentração final de 1 µ l/10 mL, durante 30 min à temperatura ambiente e tirar uma foto com uma régua perto o gel em um gel de instrumento de imagem.
    14. Definir a transferência do DNA para uma membrana de nylon e executar hibridização de membrana com uma sonda de sequência específica MS2 utilizando procedimentos padrão21.
    15. Descongele os clones que dão resultados positivos na PCR, DNA, sequenciamento e sul da mancha de um dos dois pratos congelamento (ver próximo passo).
  6. Descongelamento de clones
    1. Prepare um tubo de 15 mL contendo 5 mL de pré-aquecido Ham F - 12 K médio (do Kaighn) suplementado com 10% FBS, 2 mM L-glutamina, penicilina (0,5 unidades por mL de meio) e estreptomicina (0,2 µ g / mL de meio) para cada clone ao ser descongelado.
    2. Remover uma das placas de congelamento de-80 ° e adicionar 100 µ l de meio completo de F12K previamente aquecido para o bem que contenham o clone positivo ao ser descongelado.
      Nota: Este procedimento deve ser realizado rapidamente e a placa bem 96 deve ser colocado em gelo seco depois de cada clone é descongelado, a fim de permitir que os outros clones permanecem congelados. Isto é particularmente importante se vários clones precisam ser descongelados do mesmo prato bem 96.
    3. Transferi as células para o tubo de 15 mL contendo 5 mL de meio e centrifugar 800 x g por 5 min à temperatura ambiente.
    4. Aspire o meio, Ressuspender as células em 500 µ l de pré-aquecido meio F12K completo e transferir cada clone de um único poço de uma placa bem 12.
  7. Eliminação do gene de resistência a neomicina a cassete MS2 integrado no subtelomere 15q.
    1. Permitir que os clones crescer a partir de uma placa bem 12 para um prato de 10cm no meio F12K completo.
      Nota: Neomicina não deve ser incluída no meio salvo indicação em contrário.
    2. Adicione o adenovírus Cre-expressando as células cultivadas em um prato de 10 cm na confluência de 70% em 10 mL de meio F12K completo.
      Nota: Usar um adenovírus expressando GFP-Cre permitirá a avaliação da eficiência de infecção, que deve abordar a 100%. O adenovírus de replicação com defeito serão perdidos após poucas passagens em cultura.
    3. 48 horas após a infecção, dividi as células em três pratos de 10 cm. Dois pratos serão usados para verificação da remoção gene neomicina pela seleção negativa, crescendo as células contendo neomicina médio (primeiro prato) e por Southern blot (segundo prato).
    4. Cultura o terceiro prato contendo o clone para congelamento de células e extração do RNA.

3. verificação da TERRA-MS2 transcrição expressão por RT-qPCR

  1. Após verificação da remoção de gene de neomicina, realize a extração de RNA total de clones de TERRA-MS2 utilizando solventes orgânicos (solução de fenol e guanidina isothiocynate)21.
    1. Ressuspender o RNA extraído de um prato de 10 cm em 100 µ l de água de pyrocarbonate (DEPC) dietílico.
    2. Execute 3 µ l de RNA em um gel de ácido (MOPS) de propanossulfónico de 3-(N-Morpholino) 1 x denaturating (1% formaldeído contendo) a fim de verificar a integridade do RNA e concentração. Também analise a concentração do RNA usando um espectrofotômetro.
    3. Tratar de 3 µ g de RNA com DNAse I usando 1 unidade de DNAse eu enzima em volume de reação final 60 µ l.
    4. Incubar a reação de 1 h a 37 ° C.
  2. Inverter a reação e qPCR análises de transcrição
    1. Adicione os seguintes componentes para um tubo de microcentrifugadora nuclease-livre: 2 µ l de uma 1 µM TERRA específica da primeira demão, 1 µ l de dNTPs mix (10 mM cada), 6 µ l de RNA tratei de DNAse (correspondente a ̴300ng do RNA). Ajuste o volume para 13 µ l com 4 µ l de água DEPC.
      Nota: Para cada RNA a analisar, um segundo tubo contendo os mesmos reagentes mas uma cartilha de referência específico, em vez de primer específico de TERRA, deve estar preparado.
    2. Aqueça a mistura a 65 ° C por 5 min e incubar no gelo pelo menos 1 min.
    3. Recolher o conteúdo dos tubos por centrifugação breve e adicionar 4 µ l da enzima 5 X RT Buffer, 1 µ l 0,1 M ditiotreitol (DTT), 1 µ l (4 unidades) de inibidor de RNAse e 1 µ l de transcriptase reversa (ver Tabela de materiais).
    4. Incubar as amostras a 42 ° C por 60 min, em seguida, usar 2 µ l da reação de RT para análises de qPCR.
  3. Prepare a mistura de reação qPCR em um volume final de 20 µ l, consistindo de 10 µ l de mistura de mestre 2 x qPCR, 2 µ l de cDNA modelo, 1 µ l de primer para a frente (10 µM), 1 µ l de primer reverso (10 µM) e 6 µ l de água.
  4. Execute qPCR reação em um thermocycler usando protocolos padrão21.

4. produção de um retrovírus expressando de MS2-GFP

  1. Para gerar o retrovírus expressando MS2-GFP, transfect células de empacotamento de Fênix confluente 80% com uma proteína de fusão MS2-GFP expressando vector retrovírus (PURO pBabe-MS2-GFP) e um gene env expressando vetor (como pCMV-VSVG), utilizando uma relação molar de 4:1 de os dois vetores.
  2. No dia seguinte, substitua o cultivo suplementado (DMEM com 10% FBS, 2 mM L-glutamina e caneta/Strep) fresco médio butirato de sódio de 10mM que contém.
  3. Incubar durante 8 h a 37 ° C, 5% de CO2, em seguida, substituir o medium com meio de cultivo fresco do qual o vírus será recolhido.
  4. Após 48 h, retire o meio de retrovírus contendo as células de Fênix. Este meio pode ser usado diretamente para a infecção de clones de TERRA-MS2, caso em que filtrar o meio através de um filtro de 0,45 µm, adicionar polybrene (concentração final de 30 µ g/mL) e adicioná-lo para as células (no caso o protocolo continua no passo 5). Alternativamente, retrovírus podem ser precipitado em um tubo falcon de 50ml adicionando o volume de 1/5th de 50% PEG-8000/900 mM solução de NaCl e incubar durante a noite a 4 ° C em uma roda de rotator.
  5. No dia seguinte, partículas de retrovírus pelota por centrifugação a 2.000 x g, durante 30 minutos, remover o sobrenadante e ressuspender o precipitado em meio F12K sem soro.
    Nota: As partículas de vírus podem ser resuspended em 1/100 deth do volume sobrenadante original. Testes de infecção devem ser realizada a fim de verificar o volume mínimo de retrovírus necessários para infectar eficientemente as células.

5. visualização de TERRA-MS2 transcritos em células vivas

  1. Placa TERRA-MS2 clones e células WT AGS em pratos com fundo de vidro. No dia de infecção, adicione polybrene para o meio (concentração final de 30 µ g/mL) e o retrovírus expressando MS2-GFP.
  2. Depois de 24 horas, descarte o meio contendo vírus e adicionar meio fresco sem vermelho de fenol.
  3. Analise as células em um microscópio invertido usando a configuração de microscópio apropriado. Imagem 60 X objetivo, com grande abertura numérica (1.4 X) e usando uma câmera sensível (EMCCD) ou as células com 100 X. Use um sistema de controle ambiental para manter as amostras em 37 ° C e 5% de CO2 durante a imagem latente.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Figura 1 representa uma visão geral da estratégia experimental. As principais etapas do protocolo e um calendário indicativo para a geração de clones de TERRA-MS2 em células AGS são mostradas (Figura 1A). No dia 1, vários poços de uma placa bem 6 são transfectados com o MS2 gaveta e sgRNA/Cas9 expressando vetores (mostrados na Figura 1B). Duas sequências de guia específico 15q RNA subtelomere diferentes são clonadas em Cas9 nickase-expressando pX335 vetor, gerando dois vetores de sgRNA-pX335 que são co transfectados com a MS2 gaveta. Um poço da placa pode ser transfected com um GFP expressando vetor para verificar a eficiência do transfection. No dia 2, as células são trypsinized e transferidas de um único poço para um prato de 10 cm contendo meio seletivo. No dia 3, o médio deve ser alterado como mais untransfected células será mortas. As células são cultivadas na seleção até clones são visíveis e pronto para ser escolhido. Durante este tempo, não devem ser trypsinized as células e o meio de cultivo deve ser mudado a cada 1-2 dias para a primeira semana e depois a cada 2-3 dias depois. Uma vez que o único clones são visíveis, eles são escolheu e transferidos em um prato bem 96 onde eles podem crescer até alcançar 80-90% da confluência. Neste ponto, clones são divididas em 4 diferentes 96 bem placas, que são marcadas na Figura 1 , com um código de cores. Uma vez que os clones cultivados em placa de DNA (verde) alcança a confluência de 80%, eles lysed e DNA genômico extraído para PCR de triagem; os clones na placa de backup (azul) serão mantidos em cultura até os resultados da triagem do PCR, enquanto as vermelhas placas de congelamento são congeladas a-80 ° C. Figura 2 B mostra resultados representativos de uma seleção de PCR de clones resistentes a neomicina. Para esta seleção, são utilizados dois conjuntos de primers: par de um primer (primeiras demão MS2) recozimento na sequência 15q neomicina gene e subtelomere é usado para verificar a presença da fita MS2 (uma imagem representativa da localização primeiras demão é mostrada em Figura 2). Um segundo recozimento da primeira demão par (primeiras demão CTR) em uma região cromossômica interno é usado para verificar a presença de falsos negativos clones (sequências da primeira demão são indicadas na tabela 1). Clones de negativos para a integração da fita devem ser negativo para amplificação dos primers MS2 e positivo para amplificação dos primers CTR. Problemas técnicos na extração de DNA genômico, resultando na ausência de DNA genômico ou sua contaminação impediria a amplificação por PCR de reações de primeira demão MS2 e CTR. Nestes casos, os clones envolvidos podem re-projectados pelo PCR sobre extração de DNA genômico de placa de backup. Bandas obtidas amplificação de primeiras demão MS2 de clones positivos podem ser extraídas por meio de gel e sequenciado usando as primeiras demão MS2, a fim de confirmar a presença de sequências de dez MS2.

Os clones que dão resultados positivos na triagem de PCR são cultivados da placa de 96 bem backup (a placa azul na Figura 1) para um prato bem 6, então lysed para extração de DNA genômica e análises de Southern blot. Figura 2 D mostra imagens representativas de um gel (à esquerda) e a membrana hibridizada com uma marcada radioactivamente MS2 sequência específica sonda (à direita) de um borrão do Sul de triagem dos clones positivos de PCR. Para a confirmação da integração no subtelomere 15q sequências MS2, DNA genômico extraído de cada clone deve ser digerido com duas enzimas de restrição diferentes (NcoI e BamHI) em duas reações separadas de digestão. As enzimas de restrição NcoI e BamHI são adequadas para verificação da integração no subtelomere 15q gaveta MS2. Outras enzimas também podem ser usadas. O gel mostra uma digestão completa do DNA genômico usando a enzima de restrição de BamHI, conforme indicado pela presença de uma mancha. Os resultados de Southern blot indicam que um clone é positivo para a integração da fita no subtelomere 15q MS2, enquanto vários clones mostram vários eventos de integração da fita, conforme indicado pela presença de várias bandas. Um clone positivo deve ser analisado por um borrão do Sul segundo após digestão NcoI de DNA genômico21. Uma imagem representativa de uma fita subtelomere 15q contendo o MS2 e a posição dos sites de restrição da enzima BamHI e NcoI são mostradas na Figura 2C.

Clones positivos para PCR e Southern blot análises estão infectadas com um adenovírus expressando GFP-Cre, a fim de remover o gene de neomicina presente na gaveta MS2. Figura 3 A retrata uma subtelomere MS2-tag 15q antes e depois da expressão Cre. Uma imagem de um clone positivo para a integração de gaveta MS2 no subtelomere 15q infectado com um adenovírus expressando é mostrada na Figura 3BCre-GFP. Para uma remoção completa do gene neomicina em todas as células, a eficiência de infecção deve chegar a cerca de 100%. Conforme mostrado na Figura 3C, para verificar a eliminação do gene neomicina, Cre-GFP infectado células são divididas em três placas após 48 horas da infecção. Um prato vai ser cultivado na presença de neomicina. Todas as células nesta placa devem morrer dentro de 6-7-dias. Em um segundo prato, células poderão crescer em meio completo sem seleção e confluência de 80-90%. Neste ponto, DNA genômico é extraído e analisado por Southern blot. O terceiro prato é cultivado em meio completo para permitir a preparação de estoques congelados do clone, bem como para a extração do RNA e RT-qPCR análises de expressão de transcrição de TERRA-MS2. Figura 3 D mostra imagens representativas das análises de borrão do Sul de um clone positivo antes e após a infecção de Cre-GFP. Gel de agarose de DNA (imagem à esquerda) confirma a digestão completa do DNA genômico usando a enzima de restrição NcoI. Borrão do Sul análise foi realizado utilizando uma marcado radioactivamente MS2-sequência específica sonda (imagem à direita). Esta análise confirma a remoção do gene da neomicina. A presença de uma mancha na amostra Cre-GFP infectado confirma a oligospermia integração das sequências MS2. A posição dos sites NcoI restrição dentro o subtelomere 15q é mostrada na Figura 3.

Uma vez confirmada a eliminação do gene de resistência a neomicina, os clones podem ser testados para a expressão da TERRA-MS2 transcrições. Para este objectivo, o RNA total é extraído de cada clone e executar em um gel de MOPS denaturating para confirmar sua integridade(Figura 4). RNA ribossómico bandas devem ser visíveis em 4.700 bases (rRNA 28S) e 1.900 bases (rRNA 18S). Reação de Retrotranscription é executada usando um primer específico repetição oligospermia e referência primeira demão gene-específica (Figura 4B, top) enquanto qPCR análises de expressão de TERRA são executadas usando dois conjuntos de primers: uma primeira demão par de recozimento dentro da sequência de MS2 e a sequência de subtelomere 15q; um segundo par de primers recozimento dentro o subtelomere 15q. Sequências da primeira demão são indicadas na tabela 1. O gráfico apresentado na Figura 4B mostra RT-qPCR análises de expressão de TERRA da AGS WT células e duas diferentes clones de TERRA-MS2. Estas análises confirmam a expressão de TERRA-MS2 transcritos em dois clones em níveis comparáveis de transcrições TERRA expressadas de subtelomere 15q nas células WT. Estes dados indicam que os dois clones de TERRA-MS2 selecionados são apropriados para a análise da TERRA-MS2 transcrições por imagens de células vivas.

Para visualizar a TERRA-MS2 transcritos em células vivas, os clones selecionados estão infectados com o retrovírus expressando a proteína de fusão MS2-GFP. Figura 5 A mostra o procedimento para gerar o retrovírus expressando MS2-GFP, conforme descrito na etapa de protocolo 4. Células de AGS WT e TERRA-MS2 clones são infectados em pratos com fundo de vidro. Após 24 h da infecção, as células são analisadas por microscopia de fluorescência. A especificidade do sinal é confirmada pela presença de focos de TERRA-MS2-GFP detectado no núcleo da TERRA-MS2 clones e não nas células AGS WT (Figura 5B). Em uma população de MS2-GFP expressar células, heterogeneidade em termos de níveis de MS2-GFP entre células é esperado e células expressando baixos níveis devem ser escolhidas para a análise de imagens. Alternativamente, as células expressando MS2-GFP podem ser classificadas por análises de microscopia prévia FACS para recolher a subpopulação de células expressando baixos níveis de GFP. Nós anteriormente detectaram focos de TERRA-MS2-GFP em 40% a 60% das células de AGS TERRA-MS2 clones21. Nestas células, um a quatro focos de TERRA-MS2-GFP foram fotografados por célula. TERRA-MS2-GFP focos mostrando dinâmica e tamanhos distintos podem ser detectado21. TERRA-MS2 clones podem ser usados para estudar a dinâmica de transcrições TERRA single-telômero em pilhas vivas. Como um exemplo desta aplicação, Figura 5C mostra imagens representativas das análises de microscopia de um clone de TERRA-MS2 expressando a proteína de fusão MS2-GFP e o telômero-proteína de que Trf2 fundidos para mCherry a fim visualize os telômeros em células vivas e transcrições TERRA MS2-tag. Usando essa abordagem, anteriormente observamos que os focos de TERRA-MS2-GFP co localizar com telômeros em 44% das células, indicando que as transcrições TERRA apenas transitoriamente co localizar com extremidades cromossomos em células AGS21.

Figure 1
Figura 1 . Visão geral da estratégia experimental e calendário indicativo para a geração de TERRA-MS2 clones em células AGS. A) as etapas descritas no protocolo e uma linha do tempo indicativo para a seleção de TERRA-MS2 clones são mostradas. As células são transfectadas em um prato bem 6 com a gaveta de MS2 linear e sgRNA/Cas9 expressando vetores. Um código de cores é usado para distinguir a placa de DNA, a placa de backup e as placas de congelamento indicaram na seção de protocolo. B) o MS2 gaveta consiste de uma sequência de longa subtelomere 15q nt 800 seguido de 10 repetições de sequências MS2 e um gene de resistência de neomicina ladeado por lox-p sites e termina com um 300 nt tempo oligospermia repetição do trato em sua extremidade 3'. sgRNA/Cas9 expressando vetores foram gerados pela clonagem sequências de guia específico 15q RNA subtelomere pX335 vetor usando a BbsI restrição local21,22. Foram gerados dois vetores diferentes sgRNA-pX335 e uma mistura de 1:1 dos dois vetores foi usada para o transfection. As sequências do sgRNAs são indicadas na tabela 1. Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2 . Imagens representativas de PCR e Southern blot triagem dos clones resistentes neomicina. A) imagem representativa da subtelomere 15q contendo a gaveta MS2. A posição dos primers MS2 (cartilha MS2-subtel15q-cartilha-S e MS2 como) usado para a seleção de PCR é indicada. Os sites loxP presentes dentro da gaveta são mostrados em vermelho. B) imagem representativa do rastreio de PCR de neomicina resistentes clones usando dois conjunto de primers, MS2 primers e fixadores CTR (prime CTR S e CTR primer como). C) imagem representativa da subtelomere 15q contendo a gaveta MS2. BamHI e NcoI locais de restrição e a sonda MS2 usado para o rastreio de Southern blot são mostrados. D) esquerda: 10 µ g de DNA genômico por clone foram digeridas com BamHI e executar em um gel de agarose. A imagem foi adquirida após um pernoite executar a 30 volts. Direita: DNA genômico digerido com a enzima de restrição BamHI foi transferido para uma membrana de nylon positivamente carregado e hibridizado com uma sonda de sequência específica MS2 marcado radioactivamente. A caixa vermelha indica o tamanho esperado da banda positiva. A seta vermelha indica um clone positivo. Clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3 . Eliminação dos experimentos de validação e gene de resistência neomicina. A) imagem representativa da subtelomere 15q contendo a gaveta MS2 antes e depois da expressão Cre. A sonda específica MS2 usada para análises de Southern blot e NcoI enzima de restrição de sites são mostrados. Os sites loxP presentes dentro da gaveta são mostrados em vermelho. B) análise de microscopia de fluorescência de um clone de TERRA-MS2 infectado com o vírus adenoide expressando GFP-Cre. Imagem representativa, adquirida em um único plano focal é mostrada. MOI, multiplicidade de infecção, é a proporção entre o número de vírus utilizados para a infecção e o número de células hospedeiras. Barra de escala: 30 µm C) visão geral da estratégia experimental usada para verificar a eliminação do gene da neomicina. Células Cre-GFP infectado são divididas em três placas após 48 horas de infecção para seleção i) negativa, análises ii) Southern blot e iii) preparação de estoques de células congeladas e extração do RNA. Análises de Southern blot D) de uma TERRA-MS2 clonagem antes e após a infecção do vírus adenoide Cre-GFP. 10 µ g de DNA genômico foram digeridos com a enzima de restrição NcoI. Gel de agarose confirma que a digestão completa é alcançada em ambos os clones (à esquerda). O DNA genômico digerido foi transferido para uma membrana de nylon positivamente carregado e hibridizado usando uma sonda de sequência específica MS2. Eliminação completa do gene da neomicina é confirmada pela ausência da banda específica. Clique aqui para ver uma versão maior desta figura.

Figure 4
Figura 4 . RT-qPCR análises de Tel15q-TERRA e Tel15q-TERRA-MS2 expressão de transcrições. A) imagem representativa de um gel de MOPS mostrando o RNA total extraído de células AGS WT e TERRA-MS2 clones. Bandas correspondentes para a RNA ribossomal 28S e 18S são indicados. B) Top: um esquema do subtelomere MS2-tag 15q expressando transcrições TERRA. Primers utilizados para retrotranscription TERRA (amarelo) e qPCR análises de Tel15q-TERRA (azul) e TERRA Tel15q-MS2 (vermelho) são mostrados. O site loxP é mostrado em vermelho. Fundo: RT-qPCR análises de Tel15q-TERRA e TERRA Tel15q-MS2 expressão de transcritos em células de AGS WT e TERRA-MS2 de clones. p < 0.05, unpaired t-teste. Clique aqui para ver uma versão maior desta figura.

Figure 5
Figura 5 . Célula viva imagem análises de TERRA-MS2 clones. A) uma visão geral do processo para produzir um retrovírus expressando MS2-GFP, conforme descrito na etapa de protocolo 4. Um esquema do subtelomere MS2-tag 15q e transcrições TERRA reconhecidas pela proteína de fusão MS2-GFP é mostrado à direita. B) imagem de microscopia fluorescência representativa de AGS WT e TERRA-MS2 dois clones expressando MS2-GFP. TERRA-MS2-GFP focos são indicados pelas setas. Imagens foram adquiridas utilizando um microscópio confocal de fiação disco equipado com uma câmera EMCCD. As imagens foram captadas usando um 100 X / 1.46 apochromat objetivo em uma câmara de imagem mantida a 37 ° C com 5% de CO2. Um laser 488 foi usado como fonte de luz. Barra de escala: 5 µm. C) célula viva análises de TERRA-MS2-GFP focos e TRF2-mCherry de imagem rotulado telômeros. Um evento de localização co entre um foco de TERRA-MS2-GFP e um único telômero é mostrado. Imagens foram adquiridas como em B, usando 488 e 520 laser como fonte de luz. Uma projeção máxima de um experimento de pilha z realizado em uma única vez em que ponto do experimento de imagens lapso de tempo é mostrado. Barra de escala: 5 µm. clique aqui para ver uma versão maior desta figura.

Nome da primeira demão Sequência da primeira demão Aplicação
MS2-subtel15q-cartilha-S TGCATTAAAGGGTCCAGTTG Primeira demão MS2 usada-se para a frente de PCR de clones resistentes de neomicina
MS2 cartilha como CCTAACTGACACACATTCCACAGA Primeira demão MS2 reverso usado para a seleção de PCR de clones resistentes de neomicina
Cartilha CTR S TGT ACG CCA ACA CAG TGC TG Cartilha CTR em frente usada na triagem de PCR de clones resistentes de neomicina
Cartilha CTR como GCT GGA AGG TGG ACA GCG A Cartilha CTR reversa utilizada na triagem de PCR de clones resistentes de neomicina
Tel15q-S1 GCAGCGAGATTCTCCCAAGC Cartilha de sentido usada para detectar a expressão Tel15q e Tel15q-MS2 TERRA por qPCR
hTel15q-AS TAACCACATGAGCAATGTGGGTG Primeira demão antisentido usado para detectar a expressão Tel15q e Tel15q-MS2 TERRA por qPCR
Tel15q-MS2-AS ATGTTTCTGCATCGAAGGCATTAGG Primeira demão antisentido usado para detectar a expressão Tel15q-MS2 TERRA por qPCR
TERRA-RT-primer CCCTAACCCTAACCCTAACCCTAACCCTAA Primeira demão usado para retrotranscription de transcrições TERRA
sgRNA1 TTGGGAGAATCTCGCTGGCC Sequência do guia curta 1 RNA clonado no vetor pX335 e usado para direcionar a atividade enzimática de Cas9 nickase para subtelomere 15q
sgRNA2 TGCATTAAAGGGTCCAGTTG Sequência do RNA 2 guia curta clonado no vetor pX335 e usado para direcionar a atividade enzimática de Cas9 nickase para subtelomere 15q

Tabela 1 : Lista dos primers utilizados neste estudo. Uma lista de primers e as sequências do sgRNAs usado no presente protocolo são fornecidos. As sequências são 5' para 3'.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Neste artigo, apresentamos um método para gerar clones de célula de câncer humano contendo sequências MS2 integradas dentro subtelomere 15q. Usando estes clones, as moléculas TERRA MS2-tag transcritas do subtelomere 15q são detectadas por microscopia de fluorescência pela expressão co de uma proteína de fusão MS2-GFP. Esta abordagem permite aos pesquisadores estudar a dinâmica da TERRA, expressado de um único dos telômeros em vida células21. Neste protocolo, TERRA-MS2 clones são selecionados na linha de célula AGS, que representa um sistema interessante de modelo para estudar a TERRA, como expressão de TERRA é upregulated em câncer de estômago humano amostras24. No entanto, o protocolo descrito aqui pode ser adaptado para a seleção de clones de TERRA-MS2 em outras linhas de célula. A integração das sequências MS2 pode em princípio ser promovida em um subtelomere diferente do telômero 15q usando uma estratégia CRISPR e específicos MS2 gaveta. O método apresentado aqui, uma enzima de nickase Cas9 e RNAs dupla guia são empregados para aumentar a especificidade da integração22. Usando essa estratégia, um total de 2% dos clones positivos deverão ser identificados em células AGS. Outras versões da enzima Cas9 podem ser testadas na tentativa de aumentar a taxa de sucesso dos clones seleção25. Além disso, as seguintes etapas do protocolo são essenciais a ter em conta para maximizar a eficiência da seleção clone:

I) a fim de aumentar as chances de selecionar os clones de TERRA-MS2, é importante atingir uma eficiência de transfeccao alta de fita MS2 e os vetores CRISPR. Linhas de células transfectadas mal provavelmente exigirá várias rodadas de transfeccao, clone de seleção e triagem para selecionar clones positivos.

II) é importante determinar a concentração exacta da neomicina para usar para a seleção dos clones. Com efeito, usar uma baixa concentração da droga resultará em clones positivos falsos enquanto uma alta concentração pode impedir a identificação dos clones positivos. A concentração de neomicina indicada neste protocolo é letal para as células AGS dentro de 6-7 dias da adição ao meio de cultivo.

III) clone colheita é um passo crítico. De fato, durante este procedimento é necessário que o único single clones são colhidos. Por esta razão, colônias que estão muito perto de que outro deve ser evitado para evitar a mistura de células de diferentes clones, resultando na seleção de uma população mista de clones que podem conter sequências MS2 integrado em vários locais de genômicas. Esses eventos devem ser identificados durante a projecção de Southern blot.

IV) a quantidade de DNA genômico extraído de uma placa de DNA bem confluente 96 (protocolo 2) estima-se que em torno de 5 µ g e deve ser suficiente para cada clone por PCR e mancha do Sul com uma enzima de restrição simples digestão de tela. No entanto, a fim de confirmar a integração da fita no esperado telômero, será importante para cada clone de tela por Southern blot, digerindo o DNA genômico com duas enzimas de restrição diferentes. Para esse fim, conforme indicado no protocolo, os clones positivos na triagem de PCR devem ser cultivados em 6 pratos bem. A quantidade de DNA genômico extraído de um poço de um prato bem 6 será suficiente pelo menos duas digestões de restrição necessárias para as análises de Southern blot.

O protocolo descrito aqui, as sequências MS2 são integradas dentro subtelomere 15q para um número de razões: eu) região promotora TERRA e locais de início de transcrição de TERRA foram identificados neste subtelomere26,,27; II) expressão TERRA de subtelomere 15q foi validado usando em vitro técnicas4,,27,28,29,30; III) região subtélomérique do cromossomo 15q foi sequenciado e contém uma única região adjacente ao tracto teloméricas de repetição que pode ser direcionado para a integração da MS2-gaveta21. PCR e Southern blot abordagens foram desenvolvidas a fim de confirmar a integração única das sequências MS2 dentro subtelomere 15q em TERRA-MS2 clones. Seria interessante também realizar experimentos de DNA-peixe no cromossomo se espalha para visualizar a localização cromossômica das sequências MS2 cromossomas da metafase fixo. No entanto, o comprimento da 10xMS2 sequências (450 bp) impõe a utilização de sondas muito curtas em comparação com as sondas geralmente usadas em experimentos de DNA-peixe no cromossomo se espalha (cromossomos artificiais bacterianos (Bac), cosmídeos ou plasmídeo)31. Este desafio técnico impediu-nos de visualizar as sequências MS2 em propagações de cromossomo que representa uma limitação do protocolo. Uma outra limitação do método é o tempo e o esforço necessário para selecionar os clones de TERRA-MS2. Além disso, laboratoriais específicos configurar e equipamentos para o uso de vírus, o material radioativo e análises de microscopia são necessários.

O método descrito aqui pode ser implementado para a geração de clones de TERRA-MS2 em linhas de células diferentes para definir a dinâmica da TERRA em diversos contextos biológicos, tais como durante a senescência celular ou disfunção telômero, ajudando-na entender a função da TERRA nestes processos. Um desenvolvimento interessante desta abordagem será a geração de clones de TERRA-MS2 contendo TetO repete integrada em um subtelomere específico, incluindo o telômero MS2-tag. A expressão de uma proteína juntos fundida a uma proteína fluorescente (i.e., mCherry) permitirá a visualização do telômero particular em vida células32. Esta abordagem permitirá a investigação de se localizar e agir em cis na TERRA transcrevendo telômero e cromossomo ou em trans por mudar-se para outros cromossomos humanas transcrições TERRA. Esta questão na biologia da TERRA continua a ser esclarecido.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores declaram não concorrentes interesses financeiros

Acknowledgments

Somos gratos ao pessoal da instalação de imagem avançada do CIBIO para a Universidade de Trento e a facilidade de microscopia de luz de BioOptics na F. Max Perutz laboratórios (MFPL) em Viena. A pesquisa que conduz a estes resultados tem recebeu financiamento da Stiftung Mahlke-Anderson e o sétimo programa-quadro da União Europeia para a investigação, desenvolvimento tecnológico e demonstração no âmbito do acordo de concessão não 609431 CE. CE é apoiado por uma bolsa de Rita Levi Montalcini do Ministério da Educação Universidade e pesquisa (MIUR) italiano.

Materials

Name Company Catalog Number Comments
AGS cells - - Gift from Christian Baron (Université de Montréal).
F12K Nut Mix 1X GIBCO 21127022 Culturing medium for AGS cells
L-Glutamine  CORNING MT25005CI Component of cell culturing medium
Penicillin Streptomycin Solution CORNING 30-002-CI Component of cell culturing medium
Fetal Bovine Serum Sigma Aldrich F2442 Component of cell culturing medium
DMEM 1X GIBCO 21068028 culturing medium for phoenix cell
CaCl2 Sigma Aldrich C1016 used in phoenix cell transfection
HEPES Sigma Aldrich H3375 used in phoenix cell transfection (HBS solution)
KCl Sigma Aldrich P9333 used in phoenix cell transfection (HBS solution)
Dextrose Sigma Aldrich D9434 used in phoenix cell transfection (HBS solution)
NaCl Sigma Aldrich S7653 used in phoenix cell transfection (HBS solution) and retrovirus precipitation
Na2HPO4 Sigma Aldrich S3264 used in phoenix cell transfection (HBS solution)
TRYPSIN EDTA SOLUTION 1X CORNING 59430C used in cell split
DPBS 1X GIBCO 14190250 Dulbecco's Phosphate Buffered Saline
DMSO Sigma Aldrich D8418 Component of cell freezing medium (80% FBB and 20% DMSO)
G-418 Disulphate Formedium G4185 selection drug for 
Gelatin solution Bioreagent Sigma Aldrich G1393 cotaing of 96 well DNA plate and freezing plate
Tris-base Fisher BioReagents 10376743 Component of Cell lysis buffer for genomic DNA extraction
EDTA Sigma Aldrich E6758 Component of Cell lysis buffer for genomic DNA extraction
SDS Sigma Aldrich 71729 Component of Cell lysis buffer for genomic DNA extraction
Proteinase K Thermo Fisher AM2546 Component of Cell lysis buffer for genomic DNA extraction
RNAse A Thermo Fisher 12091021 RNA degradation during DNA extraction
Agarose Sigma Aldrich A5304 DNA gel preparation
Atlas ClearSight Bioatlas BH40501 Stain reagent used for detecting DNA and RNA samples in agarose gel
ethanol Fisher BioReagents BP28184 DNA precipitation
Sodium Acetate  Sigma Aldrich 71196 Used for DNA precipitation at a 3M concentration pH5.2
Wizard SV Gel and PCR clean-Up system Promega A9282 Extraction of PCR fragments from agarose gel during PCR screening of neomycin positive clones
Trizol AMBION 15596018 Organic solvent used for RNA extraction
Dnase I THERMO SCIENTIFIC 89836 degradation of genomic DNA from RNA 
dNTPs mix Invitrogen 10297018 used in RT and PCR reactions
DTT Invitrogen 707265ML used in RT reactions
diethyl pyrocarbonate Sigma Aldrich D5758 used to inactivate RNAses in water (1:1000 dilution)
Ribolock Thermo Fisher EO0381 RNase inhibitor
MOPS Sigma Aldrich M9381 preparation of RNA gel
Paraformaldehyde Electron Microscopy Sciences 15710 preparation of denaturating RNA gel (1% PFA in 1x MOPS)
Superscript III Reverse transcriptase Invitrogen 18080-093 Retrotranscription reaction
Pfu DNA polymerase (recombinant) Thermo Scientific EP0501 PCR reaction
2X qPCRBIO SyGreen Mix Separate-ROX PCR BIOSYSTEMS PB 20.14 qPCR reaction
Cre-GFP adenovirus https://medicine.uiowa.edu/vectorcore 1174-HT used to infect TERRA-MS2 clones in order to remove the neomycn gene
Sodium Butyrate Sigma Aldrich B5887 used to promote retrovirus particles production in phoenix cells
PEG8000 Sigma Aldrich 89510 Precipitation of retrovirus partcles
35µ-Dish Glass Bottom Ibidi 81158 used in live cell imaging analyses of TERRA-MS2 clones

DOWNLOAD MATERIALS LIST

References

  1. Azzalin, C. M., Reichenbach, P., Khoriauli, L., Giulotto, E., Lingner, J. Telomeric repeat containing RNA and RNA surveillance factors at mammalian chromosome ends. Science. 318, (5851), 798-801 (2007).
  2. Schoeftner, S., Blasco, M. A. Developmentally regulated transcription of mammalian telomeres by DNA-dependent RNA polymerase II. Nature Cell Biology. 10, (2), 228-236 (2008).
  3. Diman, A., Decottignies, A. Genomic origin and nuclear localization of TERRA telomeric repeat-containing RNA: from Darkness to Dawn. FEBS Journal. (2017).
  4. Arnoult, N., Van Beneden, A., Decottignies, A. Telomere length regulates TERRA levels through increased trimethylation of telomeric H3K9 and HP1alpha. Nature Structural & Molecular Biology. 19, (9), 948-956 (2012).
  5. Montero, J. J., et al. TERRA recruitment of polycomb to telomeres is essential for histone trymethylation marks at telomeric heterochromatin. Nature Communications. 9, (1), 1548 (2018).
  6. Beishline, K., et al. CTCF driven TERRA transcription facilitates completion of telomere DNA replication. Nature Communications. 8, (1), 2114 (2017).
  7. Arora, R., et al. RNaseH1 regulates TERRA-telomeric DNA hybrids and telomere maintenance in ALT tumour cells. Nature Communications. 5, 5220 (2014).
  8. Balk, B., et al. Telomeric RNA-DNA hybrids affect telomere-length dynamics and senescence. Nature Structural & Molecular Biology. 20, (10), 1199-1205 (2013).
  9. Graf, M., et al. Telomere Length Determines TERRA and R-Loop Regulation through the Cell Cycle. Cell. 170, (1), 72-85 (2017).
  10. Lee, Y. W., Arora, R., Wischnewski, H., Azzalin, C. M. TRF1 participates in chromosome end protection by averting TRF2-dependent telomeric R loops. Nature Structural & Molecular Biology. (2018).
  11. Moravec, M., et al. TERRA promotes telomerase-mediated telomere elongation in Schizosaccharomyces pombe. EMBO Reports. 17, (7), 999-1012 (2016).
  12. Cusanelli, E., Romero, C. A., Chartrand, P. Telomeric noncoding RNA TERRA is induced by telomere shortening to nucleate telomerase molecules at short telomeres. Molecular Cell. 51, (6), 780-791 (2013).
  13. Moradi-Fard, S., et al. Smc5/6 Is a Telomere-Associated Complex that Regulates Sir4 Binding and TPE. PLoS Genetics. 12, (8), e1006268 (2016).
  14. Chu, H. P., et al. TERRA RNA Antagonizes ATRX and Protects Telomeres. Cell. 170, (1), 86-101 (2017).
  15. Lai, L. T., Lee, P. J., Zhang, L. F. Immunofluorescence protects RNA signals in simultaneous RNA-DNA FISH. Experimental Cell Research. 319, (3), 46-55 (2013).
  16. Zhang, L. F., et al. Telomeric RNAs mark sex chromosomes in stem cells. Genetics. 182, (3), 685-698 (2009).
  17. Gallardo, F., Chartrand, P. Visualizing mRNAs in fixed and living yeast cells. Methods in Molecular Biology. 714, 203-219 (2011).
  18. Querido, E., Chartrand, P. Using fluorescent proteins to study mRNA trafficking in living cells. Methods in Cell Biology. 85, 273-292 (2008).
  19. Cusanelli, E., Chartrand, P. Telomeric noncoding RNA: telomeric repeat-containing RNA in telomere biology. Wiley Interdisciplinary Reviews: RNA. 5, (3), 407-419 (2014).
  20. Perez-Romero, C. A., Lalonde, M., Chartrand, P., Cusanelli, E. Induction and relocalization of telomeric repeat-containing RNAs during diauxic shift in budding yeast. Current Genetics. (2018).
  21. Avogaro, L., et al. Live-cell imaging reveals the dynamics and function of single-telomere TERRA molecules in cancer cells. RNA Biology. 1-10 (2018).
  22. Ran, F. A., et al. Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell. 154, (6), 1380-1389 (2013).
  23. Yamada, T., et al. Spatiotemporal analysis with a genetically encoded fluorescent RNA probe reveals TERRA function around telomeres. Scientific Reports. 6, 38910 (2016).
  24. Deng, Z., et al. Formation of telomeric repeat-containing RNA (TERRA) foci in highly proliferating mouse cerebellar neuronal progenitors and medulloblastoma. Journal of Cell Science. 125, (Pt 18), 4383-4394 (2012).
  25. Casini, A., et al. A highly specific SpCas9 variant is identified by in vivo screening in yeast. Nature Biotechnology. 36, (3), 265-271 (2018).
  26. Nergadze, S. G., et al. CpG-island promoters drive transcription of human telomeres. RNA. 15, (12), 2186-2194 (2009).
  27. Porro, A., et al. Functional characterization of the TERRA transcriptome at damaged telomeres. Nature Communications. 5, 5379 (2014).
  28. Farnung, B. O., Brun, C. M., Arora, R., Lorenzi, L. E., Azzalin, C. M. Telomerase efficiently elongates highly transcribing telomeres in human cancer cells. PLoS One. 7, (4), e35714 (2012).
  29. Flynn, R. L., et al. Alternative lengthening of telomeres renders cancer cells hypersensitive to ATR inhibitors. Science. 347, (6219), 273-277 (2015).
  30. Scheibe, M., et al. Quantitative interaction screen of telomeric repeat-containing RNA reveals novel TERRA regulators. Genome Research. 23, (12), 2149-2157 (2013).
  31. Bolland, D. J., King, M. R., Reik, W., Corcoran, A. E., Krueger, C. Robust 3D DNA FISH using directly labeled probes. Journal of Visualized Experiments. (78), (2013).
  32. Masui, O., et al. Live-cell chromosome dynamics and outcome of X chromosome pairing events during ES cell differentiation. Cell. 145, (3), 447-458 (2011).
Geração de Clones de células câncer Visualizar oligospermia Repeat-contendo RNA TERRA expressado de um único dos telômeros em células vivas
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Avogaro, L., Oss Pegorar, C., Bettin, N., Cusanelli, E. Generation of Cancer Cell Clones to Visualize Telomeric Repeat-containing RNA TERRA Expressed from a Single Telomere in Living Cells. J. Vis. Exp. (143), e58790, doi:10.3791/58790 (2019).More

Avogaro, L., Oss Pegorar, C., Bettin, N., Cusanelli, E. Generation of Cancer Cell Clones to Visualize Telomeric Repeat-containing RNA TERRA Expressed from a Single Telomere in Living Cells. J. Vis. Exp. (143), e58790, doi:10.3791/58790 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter