Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Generation av Cancer Cell kloner att visualisera Telomeric Repeat-innehållande RNA TERRA uttryckt från en enda telomeren i levande celler

doi: 10.3791/58790 Published: January 17, 2019

Summary

Här presenterar vi ett protokoll för att generera cancer cell kloner som innehåller en MS2 sekvens tagg på en enda subtelomere. Detta tillvägagångssätt, att förlita sig på MS2-GFP systemet, möjliggör visualisering av endogena avskrifter av telomeric repeat-innehållande RNA (TERRA) uttryckt från en enda telomeren i levande celler.

Abstract

Telomerer transkriberas, ger upphov till telomeric repeat-innehållande länge icke-kodande RNAs (TERRA), som har föreslagits att spela viktiga roller i telomeren biologi, inklusive Heterokromatin bildandet och telomerens längd homeostas. Senaste resultaten avslöjade att TERRA molekyler också interagera med interna kromosomala regioner att reglera genuttrycket i mus embryonala stamceller (ES) används. I linje med detta bevis, RNA fluorescens i situ hybridisering (RNA-fisk) analyser har visat att endast en delmängd av TERRA lokalisera avskrifter i kromosom ändar. En bättre förståelse av dynamiken i TERRA molekyler kommer att hjälpa till att definiera deras funktion och verkningsmekanismer. Här, beskriver vi en metod för att märka och visualisera singel-telomer TERRA avskrifter i cancerceller med hjälp av MS2-GFP-systemet. I detta syfte presenterar vi ett protokoll för att generera stabil kloner, använda AGS mänskliga magen cancer cell linjen, som innehåller MS2 sekvenser är integrerade på ett enda subtelomere. Transkription av TERRA från MS2-taggade telomeren resulterar i uttrycket av MS2-taggade TERRA molekyler som visualiseras av live-cell fluorescensmikroskopi vid samtidig uttryck för en MS2 RNA-bindande protein smält till GFP (MS2-GFP). Denna metod gör det möjligt för forskare att studera dynamiken i singel-telomer TERRA molekyler i cancerceller, och det kan tillämpas på andra cellinjer.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Långa icke-kodande RNA TERRA är transkriberas från den subtelomeric regionen kromosomer och dess transkription fortsätter mot kromosom ändarna, avslutas inom den telomeric upprepa tarmkanalen1,2. Av denna anledning, TERRA avskrifter består av subtelomeric-derived sekvenser i sin 5'-änden och avsluta med telomeric repetitioner (UUAGGG hos ryggradsdjur)3. Viktiga roller har föreslagits för TERRA, inklusive Heterokromatin bildande på telomererna4,5, DNA-replikering6, främja homolog rekombination bland kromosom avslutas7,8 , 9, reglera telomeren struktur10och telomerens längd homeostas2,11,12,13. Dessutom interagerar TERRA avskrifter med talrika extratelomeric webbplatser att reglera utbredd genuttryck i mus embryonala stamceller (ES) celler14. I linje med dessa bevis, RNA fluorescens i situ hybridisering (RNA-fisk) analyser har visat att endast en delmängd av TERRA avskrifter lokalisera telomerer1,2,15. TERRA har dessutom rapporterats till formuläret nukleära aggregat lokalisera på X och Y kromosomerna i mus celler2,16. Dessa fynd tyder på att TERRA avskrifter genomgår komplexa dynamiken inom kärnan. Förstå dynamiken i TERRA molekyler kommer att hjälpa till att definiera deras funktion och verkningsmekanismer.

MS2-GFP systemet har använts att visualisera RNA-molekyler i levande celler från olika organismer17,18. Detta system har använts tidigare tagga och visualisera singel-telomer TERRA molekyler i S. cerevisiae12,19. Med detta system, visades det nyligen att jäst TERRA avskrifter lokalisera inom cytoplasman under post-diauxic Skift, vilket tyder på att TERRA kan utöva extranuclear funktioner20. Vi har nyligen använt MS2-GFP systemet för att studera singel-telomer TERRA avskrifter i cancer celler21. I detta syfte vi anställd den CRISPR/Cas9 genom redigerande redskap att integrera MS2 sekvenser på en enda telomeren (telomeren 15q, nedan kallad Tel15q) och erhållna kloner att uttrycka MS2-taggade endogena Tel15q TERRA (TERRA-MS2 kloner). Samtidig uttryck för ett GFP-smält MS2 RNA-bindande protein (MS2-GFP) som känner igen och binder MS2 RNA sekvenser möjliggör visualisering av singel-telomer TERRA avskrifter i levande celler21. Syftet med protokollet illustreras här är att beskriva i detalj de steg som krävs för generering av TERRA-MS2 kloner.

För att generera TERRA-MS2 kloner, en MS2 kassett är integrerad i regionen subtelomeric i telomeren 15q, nedströms webbplatsen TERRA promotor regionen och transkription start. MS2 kassetten innehåller en neomycin motstånd gen flankerad av lox-p platser, och dess integration på subtelomere 15q utförs med hjälp av CRISPR/Cas9 systemet22. Efter transfection av den MS2 kassett, enda kloner är markerade och subtelomeric integration av kassetten är verifierad av PCR, DNA ordningsföljd och Southern blot. Positiva kloner är infekterad med en Cre-uttryckande adenovirus för att ta bort markeringen markören i kassett, lämnar bara MS2 sekvenser och en enda lox-p-plats på subtelomere 15q. Uttryck för MS2-taggade TERRA avskrifter från Tel15q är verifierad av RT-qPCR. Slutligen, MS2-GFP fusion proteinet uttrycks i TERRA-MS2 kloner via retrovirala infektion för att visualisera MS2-TERRA avskrifter av fluorescensmikroskopi. TERRA avskrifter kan lätt upptäckas av RNA-fisk och live-cell bildåtergivning med telomeric repeat-specifika sonder1,2,15,23. Dessa metoder ger viktig information på localizationen av den sammanlagda befolkningen av TERRA molekyler i enskild cell upplösning. Generering av kloner som innehåller MS2 sekvenser på en enda subtelomere gör att forskare att studera dynamiken i singel-telomer TERRA avskrifter i levande celler, som kommer att hjälpa till att definiera funktion och verkningsmekanismer av TERRA.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Urval av Neomycin resistenta kloner

  1. Odla AGS cellerna i Ham's F-12_K (Kaighn) medium kompletteras med 10% fetalt bovint Serum (FBS), 2 mM L-glutamin, penicillin (0,5 enheter per mL medium) och streptomycin (0.2 µg per mL medium) vid 37 ° C och 5% CO2. Transfect cellerna på en 50-60% sammanflödet med den sgRNA/Cas9 uttrycka vektor- och MS2 kassetten i en 1:10 molar förhållandet21.
    Obs: I en parallell experiment, verifiera transfection effektivitet genom transfecting en GFP-uttryckande vektor (dvs Cas9-GFP vektor). Minst 60-70% transfection effektivitet bör uppnås.
  2. Följande dag, Ersätt culturing medium med medium som innehåller neomycin på 0,7 µg/mL slutlig koncentration (selektivt medium).
    Obs: Dela celler och seedning dem i selektivt medium dagen efter transfection kommer att påskynda urvalsförfarandet. Alla icke-transfekterade celler dör omedelbart. Om transfection utförs i 6 plattor, i vilket fall varje brunn på en 60% skulle sammanflödet innehålla cirka 0,7 x 106 celler, den följande dagen cellerna kan delas från en enda brunn till en 10 cm maträtt innehållande selektivt medium.
  3. Hålla cellerna i selektivt medium för 7-10 dagar, ändra medium var och en eller två dagar, tills enda kloner är synliga.
  4. Plockning av cell kloner
    1. Förbereda en 96 väl platta innehållande 10 µL av 0,25% trypsin i varje brunn.
      Obs: Förbereda två 96 väl plattor om mer än 96 kloner förväntas plockas.
    2. Med hjälp av ett mikroskop, markera positionen för varje klon synlig i 10 cm skålen genom att göra en prick längst ned i skålen med en markör. Varje prick motsvarar en koloni som ska plockas.
    3. Ersätta culturing medium med lagom fosfat buffrad saltlösning (PBS) att bilda en tunn film av vätska på klonerna och inte låta cellerna torka under klon plockning.
    4. Plocka enstaka kolonier med 10 µL pipett. Fäst spetsen innehållande 5 µL av trypsin till kolonin och långsamt släppa den trypsin som förblir lokaliserade på kolonin. Tillåta trypsin att lossa cellerna för 1 min, sedan skrapa kolonin med spets och suga upp i spetsen.
      Obs: Under detta förfarande, vända skålen lite på ena sidan så om du vill sänka volymen i PBS runt kolonin att plockas hjälper plockningsprocessen genom att undvika att späda trypsin runt kolonin. Med hjälp av en klon-ring kan också hjälpa till att plocka upp enda kloner.
    5. Placera cellerna från kolonin i en brunn av 96 väl plattan som innehåller 10 µL av 0,25% trypsin.
    6. Inkubera i 5 minuter i rumstemperatur, sedan fylla brunnen med 150 µL av selektivt medium (Ham's F - 12K (Kaighn) medium kompletteras med 10% FBS, 2 mM L-glutamin, penicillin (0,5 enheter per mL medium), streptomycin (0.2 µg per mL medium) och som innehåller neomycin på en koncentration av 0,7 µg/mL.
      Obs: Under inkubationstiden andra kloner kan plockas. Det rekommenderas att plocka så många kloner som möjligt. Mer klonerna plockas desto högre blir chanserna att identifiera positiva.
    7. När alla kloner är plockade och överförs i 96 väl plattan, kan cellerna att växa för ett par dagar i selektivt medium Hams F - 12K (Kaighn) medium kompletteras med 10% FBS, 2 mM L-glutamin, penicillin (0,5 enheter per mL medium), streptomycin (0.2 µg per mL för medium) och som innehåller neomycin vid en koncentration på 0,7 µg/mL vid 37 ° C och 5% CO2, tills de når 90% sammanflödet.
  5. Uppdelning av kloner
    1. Förbered tre 96 plattor belagda med gelatin genom att lägga till 100 µL av gelatin per brunn, inkubera i 30 min i rumstemperatur och sedan tvätta två gånger med PBS. Dessa plattor används för DNA-extraktion (DNA plattan) och klon frysning (frysning pläterar).
      Obs: Gelatin kommer att främja kvarstad av celler och DNA till brunnarna. I synnerhet gör gelatin beläggningen att DNA att hålla sig på botten av brunnarna under den DNA-extraktionen och tvätta förfaranden (diskuteras nedan). Under förfarandet klon-delning är det tillrådligt att använda en flerkanalspipett.
    2. När kloner når 90% sammanflödet, aspirera medium från varje brunn av 96 väl plattan, tvätta med PBS, tillsätt 30 µL per brunn trypsin på 0,25% och inkubera i 5 minuter vid 37 ° C.
      Obs: Kloner kommer att växa i olika takt, vilket beror också på antalet celler plockade per klon. Sålunda, detta steg kommer att utföras under flera dagar när de olika klonerna når 90% sammanflödet.
    3. Till 70 µL av selektivt medium per brunn, störa cell klumpar av pipettering upp och ner inuti brunnarna och sedan överföra 30 µL av de 100 µL till gelatinized DNA plattan förfyllda med 120 µL av selektivt medium per brunn och 30 µL till gelatinized frysning plattor förfyllda wit h 50 µL medium (utan val).
    4. Placera den DNA-plattan i inkubatorn och låt cellerna att växa vid 37 ° C och 5% CO2 till 90% sammanflödet.
    5. Tillsätt 80 µL av iskall nygjorda 2 x frysning medium (80% FBS och 20% dimetyl sulfoxid (DMSO)) till varje brunn av frysning plattan, tillsätt parafilm (besprutas med 70% etanol) ovanpå plattan så att försegla varje brunn, placera locket ovanpå och Linda plattan med aluminiumfolie. Placera frysning plattorna vid-80 ° C.
    6. Lägga till 90 µL av selektivt medium per brunn den ursprungliga 96 väl plattan som innehåller de kloner som har delats upp och hålla det i kultur tills PCR screening resultat. Denna platta kommer att användas som backup plattan.

2. screening av Neomycin resistenta kloner

  1. DNA-extraktion från 96 väl DNA plattan.
    1. När klonerna odlade i DNA plattan når 90% sammanflödet, tvätta 2 gånger med PBS, sedan lyse med 50 μl lyseringsbuffert (10 mM Tris pH 7.5, 10 mM EDTA, 10 mM NaCl, 0,5% SDS och 1 mg/mL proteinas K). Täcka plattan med parafilm, tätning varje brunn, lägga locket på, täck med saran wrap och placera vid 37 ° C under natten.
    2. Tillsätt 100 µL kallt etanol (Et-OH) / NaCl-lösning (0,75 M NaCl i 100% etanol) till varje brunn och fällningen under 6 timmar eller över natten i rumstemperatur.
      Obs: Protokollet kan pausas här.
    3. Ta bort de Et-OH/NaCl-lösningen genom att vända plattan och tvätta 3 gånger med 200 µL av 70% etanol per brunn.
    4. Tillsätt 25 µL RNAse A lösning i destillerat vatten och inkubera vid 37 ° C i 1 h.
  2. Använd 3 µL av genomisk DNA för PCR-amplifiering. Utför PCR-screening av de utvalda kloner använder primers glödgning inom neomycin motstånd genen och subtelomere 15q. PCR-amplifiering utförs med standard polymeras enzymer och PCR-protokoll21.
    Obs: PCR villkoren för MS2 primers (MS2-subtel15q-primer-S och MS2 primer som) och CTR primers (CTR prime S och CTR primer som) är följande: 98 ° C för 20 s som denaturering steg och sedan 34 cykler vid 98 ° C 10 s, 58° C 20 s, 72 ° C 15 s , med polymeras enzym i en 25 µL reaktion blanda (se Tabell för material). Primer sekvenser anges i tabell 1.
  3. Köra PCR-reaktioner på agarosgel och extrahera PCR-band från positiva kloner använder standardgel extraktionsprocessen (se Tabell av material för gel extraktionsreagens).
  4. Utföra DNA sekvensering analyser av gel-extraherade PCR-produkten för bekräftelse av förekomst av MS2 sekvenser21.
    Obs: Sekvensering analyserna kan utföras med primers för PCR-screening.
  5. Southern blot screening av PCR-positiva kloner
    1. Växa klonerna positiv PCR och sekvensering screening från den ursprungliga 96 väl plattan (backup plate) till 6 plattor i Hams F - 12K (Kaighn) medium kompletteras med 10% FBS, 2 mM L-glutamin, penicillin (0,5 enheter per mL medium), streptomycin (0.2 µg per mL medium) och som innehåller neomycin vid en koncentration på 0,7 µg/mL vid 37 ° C 5% CO2.
      Obs: Alternativt, om några av dessa kloner har gått förlorade, Tina dem från en av frysning plattorna (se protokollet 2.6).
    2. När klonerna är på 90% confluence i 6 väl plattan, tvätta cellerna med PBS och tillsätt 250 μl lyseringsbuffert innehållande 0,5 µg proteinas K per brunn.
    3. Skrapa de celler som använder en cell skrapa och överföra den lysate i en 1,5 mL tub.
    4. Inkubera vid 37 ° C i 16 h.
    5. Tillsätt 1 mL 100% etanol, skaka kraftigt och låt DNA fällningen i minst 2 timmar eller över natten vid-20 ° C.
      Obs: Protokollet kan pausas här.
    6. Snurra på 13.400 x g vid 4 ° C i 10 min, avlägsna supernatanten och tvätta pellets med 70% etanol. Låt lufttorka pellets vid rumstemperatur. Alternativt använda en vakuum koncentrator.
    7. Återsuspendera DNA pellets i 50 µL destillerat vatten innehållande RNAse A och inkubera i 1 timme vid 37 ° C.
    8. Smälta 5-10 µg av genomisk DNA med restriktionsenzym för NcoI och BamHI (två oberoende tumörheterogenitet) i 100 µL reaktionsvolym genom ruvning matsmältningen reaktionerna vid 37 ° C under natten.
    9. Kör 4 µL av matsmältningen på agarosgel (0,8% agaros) komplett matsmältning bekräftelse.
    10. Tillsätt 1/10 mängd natrium acetat 3 M lösning pH 5.2 och 2 volymer av 100% etanol till begränsning matsmältningen reaktionerna och inkubera i minst 2 timmar eller över natten vid-20 ° C till fällningen DNA.
      Obs: Protokollet kan pausas här.
    11. Centrifugera 13.400 x g vid 4 ° C i 20 min, kassera supernatanterna och tvätta pellets med 70% etanol. Låt pellets till luft torka i rumstemperatur. Alternativt använda en vakuum koncentrator.
    12. Återsuspendera pellets i 20 µL destillerat vatten och ladda smält DNA på en 0,8% agarosgel.
      Obs: För en bättre upplösning av smält DNA, förbereda en gel på minst 15 cm lång och kör över natten vid låg spänning (̴30 volt). Den elektrofores ställa in bör optimeras.
    13. Följande dag, fläcken gelen med en DNA märkning agent, till exempel etidiumbromid på 1 µL/10 mL slutlig koncentration, i 30 min i rumstemperatur och ta en bild med en linjal nära gelen på en gel som imaging instrument.
    14. Ställa in överföring av DNA till en nylon membran och utföra membran hybridisering med en MS2 sekvens-specifika sonden med hjälp av standardprocedurer21.
    15. Tina de kloner som är positiva vid PCR, DNA ordningsföljd och Southern blot från en av de två frysning plattor (se nästa steg).
  6. Upptining av kloner
    1. Förbereda en 15 mL tub innehållande 5 mL för pre värmde Hams F - 12 K (Kaighn) medium kompletteras med 10% FBS, 2 mM L-glutamin, penicillin (0,5 enheter per mL medium) och streptomycin (0.2 µg per mL medium) för varje klon till tinas upp.
    2. Ta bort en av frysning plattorna från-80 ° och tillsätt 100 µL av pre värmde F12K komplett medium till den brunn innehållande de positiva klonen till Tinas.
      Obs: Denna procedur bör utföras snabbt och 96 väl plattan bör placeras på torris efter varje klon är tinade, för att möjliggöra andra kloner att förbli frysta. Detta är särskilt viktigt om flera kloner behöver tinas upp från samma 96 väl platta.
    3. Överföra cellerna till 15 mL röret innehållande 5 mL medium och centrifugera vid 800 x g under 5 minuter i rumstemperatur.
    4. Aspirera medium, resuspendera cellerna i 500 µL av pre värmde komplett F12K medium och överföra varje klon till en enda väl 12 väl platta.
  7. Eliminering av neomycin motstånd genen från MS2 kassett integrerat på subtelomere 15q.
    1. Tillåta klonerna att växa från en 12 väl platta till en 10 cm skålen i fullständig F12K medium.
      Obs: Neomycin bör inte ingå i medium om inget annat anges.
    2. Lägg till den Cre-uttryckande adenovirus till celler odlade i en 10 cm maträtt på 70% sammanflödet i 10 mL av komplett F12K medium.
      Obs: Genom att använda en Cre-GFP uttrycker adenovirus kan utvärdering av effektiviteten av infektion, som bör närma sig 100%. Den replikering-defekta adenovirus förloras efter några passager i kultur.
    3. 48 timmar efter infektion, dela celler i tre 10 cm rätter. Två rätter kommer att användas för verifiering av neomycin gen avlägsnande av negativa urval, växande celler i som innehåller neomycin medium (första maträtt), och av Southern blot (andra maträtt).
    4. Kultur den tredje maträtt som innehåller klonen för cell frysning och RNA-extraktion.

3. kontroll av TERRA-MS2 avskrift uttryck av RT-qPCR

  1. Vid kontroll av neomycin gen borttagning, utföra total RNA-extraktion från TERRA-MS2 kloner använder organiska lösningsmedel (fenol och guanidin isothiocynate lösning)21.
    1. Återsuspendera RNA extraherade från en 10 cm skålen i 100 µL av dietyleter pyrocarbonate (DEPC) vatten.
    2. Kör 3 µL av RNA på en denaturating (1% formaldehyd-innehållande) 1 x 3-(N-Morpholino) propanesulfonic syra (moppar) gel för att kontrollera koncentrationen och integritet av RNA. Också analysera RNA-koncentrationen med en spektrofotometer.
    3. Behandla 3 µg RNA med DNAS jag använder 1 enhet av DNAS jag enzym i 60 µL slutliga reaktionsvolym.
    4. Inkubera reaktionen för 1 h vid 37 ° C.
  2. Omvänd Transkription reaktion och qPCR analyser
    1. Tillsätt följande komponenter i en nuclease-fri mikrocentrifug rör: 2 µL av 1 µM TERRA specifika primer, 1 µL dNTP mix (10 mM varje), 6 µL av DNAS jag-behandlade RNA (motsvarande ̴300ng RNA). Justera volymen till 13 µL med 4 μl DEPC vatten.
      Obs: För varje RNA analyseras, ett andra rör som innehåller samma reagenser men en referens specifika primer, i stället för TERRA specifika primer, bör förberedas.
    2. Värm blandningen till 65 ° C i 5 min och inkubera i ice för minst 1 min.
    3. Samla in innehållet i rören genom kort centrifugering och tillsätt 4 µL 5 X RT enzymet buffert, 1 µL 0,1 M Ditiotreitol (DTT), 1 µL (4 enheter) av RNAse inhibitor och 1 µL av omvänt transkriptas (se Tabell för material).
    4. Inkubera proverna vid 42 ° C i 60 min och sedan använda 2 µL av den RT-reaktionen för qPCR analyser.
  3. Förbereda qPCR reaktionsblandning i en slutlig volym av 20 µL bestående av 10 µL 2 x qPCR master mix, 2 µL av cDNA mall, 1 µL framåt primer (10 µM), 1 µL reverse primer (10 µM) och 6 µL av vatten.
  4. Utföra qPCR reaktion i en termocykler använder standardprotokoll21.

4. produktion av en MS2-GFP uttrycker Retrovirus

  1. För att generera MS2-GFP uttrycker retrovirus, transfect 80% konfluenta phoenix förpackning celler med en MS2-GFP-fusionsprotein uttrycker retrovirus vektor (pBabe-MS2-GFP PURO) och en env gen uttrycker vector (till exempel pCMV-VSVG) med en molar förhållandet 4:1 i två vektorer.
  2. Följande dag, Ersätt culturing medium (DMEM kompletteras med 10% FBS, 2 mM L-glutamin och penna/Strep) med färskt medium innehållande 10mM natrium butyrate.
  3. Inkubera i 8 h vid 37 ° C, 5% CO2, och sedan ersätta mediet med färska odlingsskålar medium varifrån viruset kommer att samlas in.
  4. Efter 48 h, ta bort retrovirus-med mediet från phoenix cellerna. Detta medium kan användas direkt för infektion av TERRA-MS2 kloner, i vilket fall filtrera medium genom ett 0,45 µm filter, lägga till polybrene (30 µg/mL koncentration) och lägga till cellerna (i detta fall protokollet fortsätter på steg 5). Alternativt kan retrovirus utlösas i en 50 mL falconrör genom att lägga 1/5th volym 50% PEG-8000/900 mm NaCl-lösning och ruvar över natten vid 4 ° C på en rotator hjul.
  5. Följande dag, pellet retrovirus partiklar genom centrifugering vid 2000 x g i 30 min, ta bort supernatanten och återsuspendera pelleten i F12K medium utan serum.
    Obs: Viruspartiklarna kan vara resuspended i 1/100th av den ursprungliga supernatant volymen. En infektion-test bör utföras för att kontrollera minsta volymen av retrovirus som krävs för att effektivt infektera cellerna.

5. visualisering av TERRA-MS2 avskrifter i levande celler

  1. Plattan TERRA-MS2 kloner och WT AGS celler i glasbotten rätter. På dagen för infektion, lägga till polybrene till mediet (30 µg/mL koncentration) och den MS2-GFP uttrycker retrovirus.
  2. Efter 24 timmar, kasta virusinnehållande medium och lägga till färska medium utan fenol-röd.
  3. Analysera cellerna på ett inverterat Mikroskop med inställningen lämpligt Mikroskop. Bild cellerna med en 100 X eller 60 X-objektiv med stora numeriska bländaröppningen (1,4 X) och använda en känslig kamera (elektrisk). Använd en Omgivningskontroll för att underhålla proverna vid 37 ° C och 5% CO2 under imaging.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Figur 1 representerar en översikt över experimentella strategin. De viktigaste stegen i protokollet och en vägledande tidsplan för generering av TERRA-MS2 kloner i AGS celler visas (figur 1A). På dag 1, är flera brunnar 6 väl platta transfekterade med MS2 kassett och sgRNA/Cas9 uttrycker vektorer (visas i figur 1B). Två olika subtelomere 15q-specifika guide RNA sekvenser klonade den Cas9 nickase-uttrycka pX335 vektor, genererar två sgRNA-pX335 vektorer som är samtidig transfekterade med MS2 kassett. En brunn av plattan kan vara transfekterade med en god Jordbrukarsed uttrycker vektor att verifiera transfection effektivitet. På dag 2, är cellerna trypsinized och överförs från en enda brunn till en 10 cm maträtt som innehåller selektivt medium. På dag 3, bör medel ändras som mest untransfected celler kommer att vara döda. Celler odlas i urval tills kloner är synliga och redo att plockas. Under denna tid celler inte bör vara trypsinized och odla medium bör ändras varje 1-2 dagar för den första veckan och sedan varje 2-3 dagar efteråt. När enda kloner är synliga, är de plockade och överförs i en 96 väl platta där de får växa tills de når 80-90% av sammanflödet. Vid denna punkt, är kloner uppdelade i 4 olika 96 plattor, som är markerade i figur 1 med en färgkod. När klonerna odlade i DNA plattan (grön) når 80% sammanflödet, de är lyserat och genomiskt DNA extraheras för PCR screening; klonerna i backup plattan (blå) kommer att hållas i kultur till dess att resultaten av de PCR-screening, medan de röda frysning plattorna är frysta vid-80 ° C. Figur 2 B visar representativa resultat av en PCR-screening av neomycin-resistenta kloner. För denna screening, två uppsättningar av primers används: en primer par (MS2 primers) glödgning inom neomycin genen och subtelomere 15q sekvensen används för att kontrollera förekomsten av MS2 kassetten (en representativ bild av primers localizationen visas i Figur 2A). En andra primer par (CTR primers) glödgning på en inre kromosomal region används för att kontrollera förekomsten av falska negativa kloner (primer sekvenser anges i tabell 1). Negativa kloner för integration av kassetten bör vara negativa till MS2 primers' förstärkning och positiva till CTR primers' förstärkning. Tekniska problem i genomisk DNA extraktion som leder till avsaknad av genomiskt DNA eller dess förorening skulle hindra PCR-amplifiering från MS2 och CTR primer reaktioner. I dessa fall kan klonerna inblandade åter säkerhetskontrolleras med PCR vid utvinning av genomisk DNA från backup plattan. Band som erhållits från MS2 primers amplifiering av positiva kloner kan vara gel-extraheras och sekvenserade med MS2 primers, för att bekräfta förekomsten av tio MS2 sekvenser.

De kloner som är positiva vid PCR-screening är odlade från 96 väl backup plattan (blå plattan i figur 1) till en 6 väl tallrik, då lyserat för genomisk DNA-extraktion och Southern blot analyser. Figur 2 D visar representativa bilder av en gel (vänster) och membran hybridiseras med en radioaktivt märkta MS2 sekvens specifika sond (höger) av en Southern blot screening av PCR-positiva kloner. För bekräftelse av MS2 sekvenser integrationen på subtelomere 15q, ska genomisk DNA extraheras från varje klon smältas med två olika restriktionsenzym (NcoI och BamHI) i två separata matsmältningen reaktioner. NcoI och BamHI begränsning enzymerna är lämplig för verifiering av MS2 kassett integrationen på subtelomere 15q. Andra enzymer kan också användas. Gelen visar en komplett matsmältning av genomisk DNA med hjälp av enzymet BamHI begränsning, som anges av närvaron av ett utstryk. Resultaten från Southern blot indikerar att en klon är positivt för integrationen av MS2 kassett på subtelomere 15q medan flera kloner visar flera integration händelser av kassetten, som anges av närvaron av flera band. En positiv klon bör analyseras av en andra Southern blot vid NcoI rötning av genomisk DNA21. En representativ bild av en subtelomere 15q innehållande MS2 kassett och placera av BamHI och NcoI restriktionsenzym platser visas i figur 2C.

De kloner positiva PCR och Southern blot analyser är infekterade med en Cre-GFP uttrycker adenovirus för att ta bort genen neomycin i MS2 kassett. Figur 3 A skildrar en MS2-taggade subtelomere 15q före och efter Cre uttryck. En bild av en klon som är positiva för MS2 kassett integration på subtelomere 15q infekterade med en Cre-GFP uttrycker adenovirus är visas i figur 3B. För en fullständig borttagning av neomycin genen i alla celler, bör infektion effektivitet nå cirka 100%. Som visas i figur 3C, för att kontrollera eliminering av genen neomycin, delas Cre-GFP infekterade celler i tre plåtar efter 48 timmar från infektionen. En platta kommer vara odlade i närvaro av neomycin. Alla celler i denna platta bör dö inom 6-7-dagar. I en andra platta, kommer celler att tillåtas växa i komplett medium utan val upp till 80-90% sammanflödet. Vid denna punkt, genomisk DNA extraheras och analyseras av Southern blot. Tredje plattan är odlade i komplett medium att tillåta utarbetandet av frysta bestånd av klonen och för RNA-extraktion och RT-qPCR analyser av TERRA-MS2 avskrift uttryck. Figur 3 D visar representativa bilder av Southern blot analyser av en positiv klon före och efter Cre-GFP infektion. DNA agarosgel (bild till vänster) bekräftar fullständig nedbrytning av genomisk DNA med hjälp av enzymet NcoI begränsning. Southern blot analys utfördes med hjälp av en radioaktivt märkt MS2-sekvens specifika sond (bild till höger). Denna analys bekräftar borttagningen av neomycin genen. Förekomsten av ett utstryk i Cre-GFP infekterade provet bekräftar telomeric integrationen av MS2 sekvenser. Positionen av NcoI begränsning platser inom subtelomere 15q visas i figur 3A.

När elimineringen av neomycin motstånd genen har bekräftats kan klonerna testas för uttrycket av TERRA-MS2 avskrifter. I detta syfte är total-RNA extraherade från varje klon och kör på en denaturating moppar gel att bekräfta dess integritet (figur 4A). Ribosomalt RNA band ska vara synliga på 4 700 baser (rRNA 28S) och 1 900 baser (18S rRNA). Retrotranscription reaktionen utförs med hjälp av en telomeric repeat-specifik primer och referens gen-specifik primer (figur 4B, överst) medan qPCR analyser av TERRA uttryck utförs med två uppsättningar av grundfärger: en primer par glödgning inom MS2 sekvensen och subtelomere 15q sekvens; ett par av primers glödgning inom subtelomere 15q. Primer sekvenser anges i tabell 1. Diagrammet presenteras i figur 4B visar RTqPCR analyser av TERRA uttryck från AGS WT celler och två olika TERRA-MS2 kloner. Dessa analyser bekräfta uttrycket av TERRA-MS2 avskrifter i de två klonerna på nivåer som är jämförbara med TERRA avskrifter uttryckt från subtelomere 15q i WT celler. Dessa data indikerar att de två TERRA-MS2-kloner som valts är lämplig för analyser av TERRA-MS2 avskrifter av levande cell imaging.

För att visualisera TERRA-MS2 avskrifter i levande celler, är de utvalda klonerna infekterad med ett retrovirus som uttrycker proteinet MS2-GFP fusion. Figur 5 A visar proceduren för att generera MS2-GFP uttrycker retrovirus, som beskrivs i protokollet steg 4. AGS WT celler och TERRA-MS2 kloner är infekterade i glasbotten rätter. Efter 24 h från infektion analyseras celler av fluorescensmikroskopi. Specificiteten av signalen bekräftas av närvaron av TERRA-MS2-GFP foci i kärnan av TERRA-MS2 kloner och inte hos AGS WT celler (figur 5B). I en population av MS2-GFP uttrycker celler, heterogenitet när det gäller MS2-GFP nivåer bland celler förväntas och celler som uttrycker låga nivåer bör väljas för imaging analyserna. Alternativt kan MS2-GFP uttrycker cellerna sorteras med FACS tidigare mikroskopi analyser för att samla in subpopulationen av celler som uttrycker låga nivåer av GFP. Vi har tidigare upptäckt TERRA-MS2-GFP foci i 40% till 60% av cellerna av AGS TERRA-MS2 kloner21. I dessa celler, var en till fyra TERRA-MS2-GFP foci avbildade per cell. TERRA-MS2-GFP foci visar olika storlekar och dynamics kan vara upptäckta21. TERRA-MS2 kloner kan användas för att studera dynamiken i singel-telomer TERRA avskrifter i levande celler. Som ett exempel av denna ansökan visar figur 5C representativa bilder från mikroskopi analyser av en TERRA-MS2 klon uttrycker proteinet MS2-GFP fusion och telomer-bindande protein TRF2 smält till mCherry för att visualisera MS2-taggade TERRA avskrifter och telomerer i levande celler. Använder denna metod, har vi tidigare observerat att TERRA-MS2-GFP foci Co lokalisera med telomerer i 44% av cellerna, som anger att TERRA avskrifter endast övergående Co lokalisera med kromosomen ändar i AGS celler21.

Figure 1
Figur 1 . Översikt över experimentella strategi och vägledande tidsplan för generering av TERRA-MS2 kloner i AGS celler. (A) stegen som beskrivs i protokollet och en vägledande tidslinje för valet av TERRA-MS2 kloner visas. Celler är transfekterade i en 6 väl platta med linearized MS2 kassett och sgRNA/Cas9 uttrycker vektorer. En färgkod används för att skilja DNA plattan, backup plattan och frysning plattorna anges i avsnittet protokoll. B) The MS2 kassett består av en 800 nt lång subtelomere 15q-sekvens som följt av 10 repetitioner av MS2 sekvenser och en neomycin motstånd gen flankerad av lox-p platser och avslutar med en 300 nt länge telomeric upprepa tarmkanalen i sitt 3'-änden. sgRNA/Cas9 uttrycker vektorer genererades av kloning subtelomere 15q-specifika guide RNA sekvenser i pX335 vector med BbsI begränsning webbplats21,22. Två olika sgRNA-pX335 vektorer genererades och en 1:1 blandning av de två vektorerna användes för transfection. Sekvenserna av sgRNAs anges i tabell 1. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2 . Representativa bilder av PCR och Southern blot screening av neomycin resistenta kloner. A) representativ bild av subtelomere 15q innehållande MS2 kassett. Positionen för MS2 primers (MS2-subtel15q-primer-S och MS2 primer som) används för PCR-screening är indicerat. LoxP webbplatser inom kassetten visas i rött. B) representativ bild av PCR-screening av neomycin resistenta kloner med två uppsättning primers, MS2 primers och CTR primers (CTR prime S och CTR primer som). C) representativ bild av subtelomere 15q innehållande MS2 kassett. BamHI och NcoI begränsning platser och MS2 sonden används för Southern blot screening visas. D) vänster: 10 µg av genomisk DNA per klon var smält med BamHI och kör på en agarosgel. Bilden förvärvades efter en övernattning kör 30 volt. Höger: genomiskt DNA smältas med BamHI restriktionsenzym överfördes till ett positivt laddade nylon membran och hybridiseras med en radioaktivt märkt MS2 sekvens-specifika sond. Den röda rutan anger den förväntade storleken på positiva bandet. Den röda pilen indikerar en positiv klon. Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3 . Eliminering av neomycin motstånd genen och validering experimenten. (A) representativ bild av subtelomere 15q innehållande MS2 kassetten före och efter Cre uttryck. MS2 specifika sonden används för Southern blot analyser och NcoI restriktionsenzym platser visas. LoxP webbplatser inom kassetten visas i rött. B) Fluorescence mikroskopi analys av en TERRA-MS2 klon infekterade med Cre-GFP uttrycker adenovirus. Representativ bild förvärvat på ett enda fokalplan visas. MOI, multiplicity av infektion, är förhållandet mellan antalet virus som används för infektionen och antalet värdceller som. Skalstapeln: 30 µm C) översikt över experimentella strategin används för att verifiera eliminering av neomycin genen. Cre-GFP infekterade celler delas i tre plåtar efter 48 timmar från infektion för i) negativa urval, ii) Southern blot analyser och iii) beredning av frysta cell bestånd och RNA-extraktion. D) Southern blot analyser av en TERRA-MS2 klona före och efter Cre-GFP adenovirus infektion. 10 µg av genomisk DNA var smält med enzymet begränsning NcoI. Agarosgel bekräftar att komplett matsmältning uppnås i både kloner (vänster). Smält genomisk DNA överfördes till ett positivt laddade nylon membran och hybridiseras använder en MS2 sekvens-specifika sond. Fullständig eliminering av neomycin genen bekräftas av avsaknad av specifika bandet. Klicka här för att se en större version av denna siffra.

Figure 4
Figur 4 . RT-qPCR analyser av Tel15q-TERRA och Tel15q-TERRA-MS2 avskrifter uttryck. (A) representativ bild av en moppar gel visar total-RNA extraherade från AGS WT celler och TERRA-MS2 kloner. Band som motsvarande till ribosomalt RNASEN 28S och 18S indikeras. B) toppen: en schematisk bild av den MS2-taggade subtelomere 15q uttrycker TERRA avskrifter. Primers används för TERRA retrotranscription (gul) och qPCR analyser av Tel15q-TERRA (blå) och Tel15q-MS2 TERRA (röd) visas. LoxP webbplatsen visas i rött. Botten: RT-qPCR analyser av Tel15q-TERRA och Tel15q-MS2 TERRA avskrifter uttryck i AGS WT celler och TERRA-MS2 kloner. p < 0,05, oparat t-test. Klicka här för att se en större version av denna siffra.

Figure 5
Figur 5 . Levande cellen imaging analyser av TERRA-MS2 kloner. (A) en översikt över förfarandet för att producera ett MS2-GFP uttrycker retrovirus, som beskrivs i protokollet steg 4. En schematisk av MS2-taggade subtelomere 15q och TERRA betyg igen av proteinet MS2-GFP fusion visas till höger. B) representativa fluorescence mikroskopi bilden av AGS WT och två TERRA-MS2 kloner att uttrycka MS2-GFP. TERRA-MS2-GFP foci indikeras förtroendesökvägarna av pilar. Bilder förvärvades med snurrande skiva confocal Mikroskop utrustade med en elektrisk kamera. Bilderna var tagna med en 100 X / 1,46 apochromat målet i en tänkbar kammare kvarstår vid 37 ° C med 5% CO2. En 488 laser användes som ljuskälla. Skalstapeln: 5 µm. C) levande cell imaging analyser av TERRA-MS2-GFP foci och TRF2-mCherry märkt telomerer. En samtidig lokalisering händelse mellan TERRA-MS2-GFP fokus och en enda telomeren visas. Bilder förvärvades som i B, använder 488 och 520 laser som ljuskälla. En maximal projektion av z stack experiment utförs på en enda gång punkten av time-lapse imaging experiment visas. Skalstapeln: 5 µm. vänligen klicka här för att visa en större version av denna siffra.

Primer namn Primer sekvens Ansökan
MS2-subtel15q-primer-S TGCATTAAAGGGTCCAGTTG MS2 primer framåt används för PCR-screening av neomycin resistenta kloner
MS2 primer som CCTAACTGACACACATTCCACAGA MS2 primer omvänd används för PCR-screening av neomycin resistenta kloner
CTR primer S TGT ACG CCA ACA CAG TGC TG CTR primer fram används i PCR-screening av neomycin resistenta kloner
CTR primer som GCT GGA AGG TGG ACA GCG A CTR primer omvänd används i PCR-screening av neomycin resistenta kloner
Tel15q-S1 GCAGCGAGATTCTCCCAAGC Sense primer används för att upptäcka Tel15q och Tel15q-MS2 TERRA uttryck av qPCR
hTel15q-AS TAACCACATGAGCAATGTGGGTG Antisense primer används för att upptäcka Tel15q och Tel15q-MS2 TERRA uttryck av qPCR
Tel15q-MS2-AS ATGTTTCTGCATCGAAGGCATTAGG Antisense primer används för att upptäcka Tel15q-MS2 TERRA uttryck av qPCR
TERRA-RT-primer CCCTAACCCTAACCCTAACCCTAACCCTAA Primer som används för retrotranscription av TERRA avskrifter
sgRNA1 TTGGGAGAATCTCGCTGGCC Sekvens av kort guide RNA 1 klonade i pX335 vector och används för att rikta Cas9 nickase enzymatiska aktivitet till subtelomere 15q
sgRNA2 TGCATTAAAGGGTCCAGTTG Sekvens av kort guide RNA 2 klonade i pX335 vector och används för att rikta Cas9 nickase enzymatiska aktivitet till subtelomere 15q

Tabell 1 : Lista över primers används i denna studie. En lista över primers och sekvenser av den sgRNAs som används i detta protokoll finns. Sekvenserna är 5' till 3'.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I denna artikel presenterar vi en metod för att generera mänskliga cancer cell kloner som innehåller MS2 sekvenser integrerade inom subtelomere 15q. Använder dessa kloner, upptäcks MS2-taggade TERRA molekylerna transkriberas från subtelomere 15q av fluorescensmikroskopi av samtidig uttryck av en MS2-GFP fusionsprotein. Denna metod gör det möjligt för forskare att studera dynamiken i TERRA uttryckt från en enda telomeren i levande celler21. I detta protokoll, är TERRA-MS2 kloner markerade i AGS cell raden som representerar ett intressant modellsystem att studera TERRA, eftersom TERRA uttryck är uppreglerad i mänskliga magen cancer prover24. Protokollet beskrivs här kan dock anpassas för val av TERRA-MS2 kloner i andra cellinjer. Integrationen av MS2 sekvenser kan i princip främjas på ett subtelomere som är olika från telomeren 15q med hjälp av en specifik MS2 kassett och CRISPR strategi. I metoden presenteras här är en Cas9 nickase enzym och dubbel guide RNAs anställda för att öka specificiteten av integration22. Använda denna strategi, förväntas en övergripande 2% positiva kloner identifieras i AGS celler. Andra versioner av enzymet Cas9 kan testas i försöket att öka andelen framgångsrika de kloner urval25. Dessutom är följande steg i protokollet kritiska att ta hänsyn till att maximera effektiviteten i klon markeringen:

I) för att öka chanserna för att välja TERRA-MS2 klonerna, det är viktigt att uppnå en hög transfection effektivitet av MS2 kassetten och CRISPR vektorer. Dåligt transfekterade cellinjer kommer troligen att kräva flera omgångar av transfection, klon urval och screening för att välja positiva kloner.

(II) det är viktigt att bestämma den exakta koncentrationen av neomycin att använda för val av klonerna. Ja, med hjälp av en låg koncentration av läkemedlet kommer att resultera i falskt positiva kloner medan en hög koncentration kan utgöra hinder för identifiering av positiva kloner. Neomycin koncentrationen anges i detta protokoll är dödliga till AGS celler inom 6-7 dagar från tillägg till culturing medium.

(III) klon plockning är ett viktigt steg. Faktiskt under detta förfarande krävs att endast enstaka kloner plockas. För därför kolonier som är för nära varandra bör undvikas för att förhindra blandning celler från olika kloner, integreras vilket resulterar i valet av en blandad befolkning av kloner som kan innehålla MS2 sekvenser på flera genomisk platser. Dessa händelser bör identifieras under södra blot screening.

IV) mängden genomiskt DNA extraheras från en konfluenta 96 väl DNA tallrik (protokoll 2) uppskattas till cirka 5 µg och borde räcka för att skärmen varje klon av PCR och södra blotting med en enda restriktionsenzym matsmältningen. För att bekräfta integrationen av kassetten på förväntade telomeren, kommer det dock vara viktigt att skärmen varje klon av Southern blot genom smälta genomisk DNA med två olika restriktionsenzym. I detta syfte som anges i protokollet, bör klonerna som är positiva vid PCR-screening vara odlade i 6 plattor. Mängden genomiskt DNA extraheras från en brunn 6 väl platta kommer att räcka för minst två begränsning tumörheterogenitet krävs för Southern blot analyser.

I protokollet som beskrivs här, MS2 sekvenser är integrerade inom subtelomere 15q för ett antal skäl: jag) TERRA promotor regionen och TERRA transkription start platser har identifierats på detta subtelomere26,27. (II) TERRA uttryck från subtelomere 15q har validerats med hjälp av in vitro- tekniker4,27,28,29,30; (III) regionen subtelomeric i kromosomen 15q har varit sekvenserade och innehåller en unik region som gränsar till den telomeric upprepa tarmkanalen som kan riktas för integration av MS2-kassett21. PCR- och Southern blot metoder har utvecklats för att bekräfta en enda integration av MS2 sekvenser inom subtelomere 15q i TERRA-MS2 klonerna. Det skulle vara intressant att också utföra DNA-fisk experiment på kromosom sprider för att visualisera kromosomala lokaliseringen av MS2 sekvenser i fasta metafas kromosomer. Men längden på 10xMS2 sekvenser (450 bp) föreskriver användning av mycket kort sonder jämfört med de sonder som allmänt används i DNA-fisk experiment med kromosomen sprider (bakteriella artificiella kromosomer (Bac), cosmids eller plasmider)31. Denna tekniska utmaning har hindrat oss från att visualisera MS2 sekvenser på kromosom uppslag som utgör en begränsning av protokollet. En ytterligare begränsning för metoden är tiden och den ansträngning som krävs för att välja TERRA-MS2 klonerna. Dessutom krävs särskilda laboratorium upprätta och utrustning för användning av virus, radioaktivt material och mikroskopi analyser.

Den metod som beskrivs här kan genomföras för generering av TERRA-MS2 kloner i olika cellinjer för att definiera dynamiken i TERRA i olika biologiska sammanhang, såsom under telomeren dysfunktion eller cellular åldras, att hjälpa oss att förstå funktionen av TERRA i dessa processer. En intressant utveckling av denna strategi kommer att vara generationen av TERRA-MS2 kloner som innehåller TetO upprepar integrerade på en specifik subtelomere, inklusive MS2-taggade telomeren. Uttrycket av ett te protein smält till en fluorescerande protein (dvs mCherry) gör att visualisering av detta särskilt telomeren i levande celler32. Detta tillvägagångssätt gör att utreda huruvida mänskliga TERRA avskrifter lokalisera och agera i cis på TERRA transkribera telomer och kromosom eller i trans genom omplacering till andra kromosomer. Denna fråga inom biologin för TERRA återstår för att klargöras.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna förklarar inget konkurrerande finansiella intressen

Acknowledgments

Vi är tacksamma för den avancerade imaging anläggningen i CIBIO vid universitetet i Trento och BioOptics ljus Microscopy anläggningen på Max F. Perutz Laboratories (MFPL) i Wien personal. Den forskning som leder till dessa resultat har fått finansiering från den Mahlke-Obermann Stiftung och EU: s sjunde ramprogram för forskning, teknisk utveckling och demonstration under bidragsavtalet ingen 609431 till EG. EG stöds av en Rita Levi Montalcini stipendium från det italienska ministeriet för utbildning och forskning (MIUR).

Materials

Name Company Catalog Number Comments
AGS cells - - Gift from Christian Baron (Université de Montréal).
F12K Nut Mix 1X GIBCO 21127022 Culturing medium for AGS cells
L-Glutamine  CORNING MT25005CI Component of cell culturing medium
Penicillin Streptomycin Solution CORNING 30-002-CI Component of cell culturing medium
Fetal Bovine Serum Sigma Aldrich F2442 Component of cell culturing medium
DMEM 1X GIBCO 21068028 culturing medium for phoenix cell
CaCl2 Sigma Aldrich C1016 used in phoenix cell transfection
HEPES Sigma Aldrich H3375 used in phoenix cell transfection (HBS solution)
KCl Sigma Aldrich P9333 used in phoenix cell transfection (HBS solution)
Dextrose Sigma Aldrich D9434 used in phoenix cell transfection (HBS solution)
NaCl Sigma Aldrich S7653 used in phoenix cell transfection (HBS solution) and retrovirus precipitation
Na2HPO4 Sigma Aldrich S3264 used in phoenix cell transfection (HBS solution)
TRYPSIN EDTA SOLUTION 1X CORNING 59430C used in cell split
DPBS 1X GIBCO 14190250 Dulbecco's Phosphate Buffered Saline
DMSO Sigma Aldrich D8418 Component of cell freezing medium (80% FBB and 20% DMSO)
G-418 Disulphate Formedium G4185 selection drug for 
Gelatin solution Bioreagent Sigma Aldrich G1393 cotaing of 96 well DNA plate and freezing plate
Tris-base Fisher BioReagents 10376743 Component of Cell lysis buffer for genomic DNA extraction
EDTA Sigma Aldrich E6758 Component of Cell lysis buffer for genomic DNA extraction
SDS Sigma Aldrich 71729 Component of Cell lysis buffer for genomic DNA extraction
Proteinase K Thermo Fisher AM2546 Component of Cell lysis buffer for genomic DNA extraction
RNAse A Thermo Fisher 12091021 RNA degradation during DNA extraction
Agarose Sigma Aldrich A5304 DNA gel preparation
Atlas ClearSight Bioatlas BH40501 Stain reagent used for detecting DNA and RNA samples in agarose gel
ethanol Fisher BioReagents BP28184 DNA precipitation
Sodium Acetate  Sigma Aldrich 71196 Used for DNA precipitation at a 3M concentration pH5.2
Wizard SV Gel and PCR clean-Up system Promega A9282 Extraction of PCR fragments from agarose gel during PCR screening of neomycin positive clones
Trizol AMBION 15596018 Organic solvent used for RNA extraction
Dnase I THERMO SCIENTIFIC 89836 degradation of genomic DNA from RNA 
dNTPs mix Invitrogen 10297018 used in RT and PCR reactions
DTT Invitrogen 707265ML used in RT reactions
diethyl pyrocarbonate Sigma Aldrich D5758 used to inactivate RNAses in water (1:1000 dilution)
Ribolock Thermo Fisher EO0381 RNase inhibitor
MOPS Sigma Aldrich M9381 preparation of RNA gel
Paraformaldehyde Electron Microscopy Sciences 15710 preparation of denaturating RNA gel (1% PFA in 1x MOPS)
Superscript III Reverse transcriptase Invitrogen 18080-093 Retrotranscription reaction
Pfu DNA polymerase (recombinant) Thermo Scientific EP0501 PCR reaction
2X qPCRBIO SyGreen Mix Separate-ROX PCR BIOSYSTEMS PB 20.14 qPCR reaction
Cre-GFP adenovirus https://medicine.uiowa.edu/vectorcore 1174-HT used to infect TERRA-MS2 clones in order to remove the neomycn gene
Sodium Butyrate Sigma Aldrich B5887 used to promote retrovirus particles production in phoenix cells
PEG8000 Sigma Aldrich 89510 Precipitation of retrovirus partcles
35µ-Dish Glass Bottom Ibidi 81158 used in live cell imaging analyses of TERRA-MS2 clones

DOWNLOAD MATERIALS LIST

References

  1. Azzalin, C. M., Reichenbach, P., Khoriauli, L., Giulotto, E., Lingner, J. Telomeric repeat containing RNA and RNA surveillance factors at mammalian chromosome ends. Science. 318, (5851), 798-801 (2007).
  2. Schoeftner, S., Blasco, M. A. Developmentally regulated transcription of mammalian telomeres by DNA-dependent RNA polymerase II. Nature Cell Biology. 10, (2), 228-236 (2008).
  3. Diman, A., Decottignies, A. Genomic origin and nuclear localization of TERRA telomeric repeat-containing RNA: from Darkness to Dawn. FEBS Journal. (2017).
  4. Arnoult, N., Van Beneden, A., Decottignies, A. Telomere length regulates TERRA levels through increased trimethylation of telomeric H3K9 and HP1alpha. Nature Structural & Molecular Biology. 19, (9), 948-956 (2012).
  5. Montero, J. J., et al. TERRA recruitment of polycomb to telomeres is essential for histone trymethylation marks at telomeric heterochromatin. Nature Communications. 9, (1), 1548 (2018).
  6. Beishline, K., et al. CTCF driven TERRA transcription facilitates completion of telomere DNA replication. Nature Communications. 8, (1), 2114 (2017).
  7. Arora, R., et al. RNaseH1 regulates TERRA-telomeric DNA hybrids and telomere maintenance in ALT tumour cells. Nature Communications. 5, 5220 (2014).
  8. Balk, B., et al. Telomeric RNA-DNA hybrids affect telomere-length dynamics and senescence. Nature Structural & Molecular Biology. 20, (10), 1199-1205 (2013).
  9. Graf, M., et al. Telomere Length Determines TERRA and R-Loop Regulation through the Cell Cycle. Cell. 170, (1), 72-85 (2017).
  10. Lee, Y. W., Arora, R., Wischnewski, H., Azzalin, C. M. TRF1 participates in chromosome end protection by averting TRF2-dependent telomeric R loops. Nature Structural & Molecular Biology. (2018).
  11. Moravec, M., et al. TERRA promotes telomerase-mediated telomere elongation in Schizosaccharomyces pombe. EMBO Reports. 17, (7), 999-1012 (2016).
  12. Cusanelli, E., Romero, C. A., Chartrand, P. Telomeric noncoding RNA TERRA is induced by telomere shortening to nucleate telomerase molecules at short telomeres. Molecular Cell. 51, (6), 780-791 (2013).
  13. Moradi-Fard, S., et al. Smc5/6 Is a Telomere-Associated Complex that Regulates Sir4 Binding and TPE. PLoS Genetics. 12, (8), e1006268 (2016).
  14. Chu, H. P., et al. TERRA RNA Antagonizes ATRX and Protects Telomeres. Cell. 170, (1), 86-101 (2017).
  15. Lai, L. T., Lee, P. J., Zhang, L. F. Immunofluorescence protects RNA signals in simultaneous RNA-DNA FISH. Experimental Cell Research. 319, (3), 46-55 (2013).
  16. Zhang, L. F., et al. Telomeric RNAs mark sex chromosomes in stem cells. Genetics. 182, (3), 685-698 (2009).
  17. Gallardo, F., Chartrand, P. Visualizing mRNAs in fixed and living yeast cells. Methods in Molecular Biology. 714, 203-219 (2011).
  18. Querido, E., Chartrand, P. Using fluorescent proteins to study mRNA trafficking in living cells. Methods in Cell Biology. 85, 273-292 (2008).
  19. Cusanelli, E., Chartrand, P. Telomeric noncoding RNA: telomeric repeat-containing RNA in telomere biology. Wiley Interdisciplinary Reviews: RNA. 5, (3), 407-419 (2014).
  20. Perez-Romero, C. A., Lalonde, M., Chartrand, P., Cusanelli, E. Induction and relocalization of telomeric repeat-containing RNAs during diauxic shift in budding yeast. Current Genetics. (2018).
  21. Avogaro, L., et al. Live-cell imaging reveals the dynamics and function of single-telomere TERRA molecules in cancer cells. RNA Biology. 1-10 (2018).
  22. Ran, F. A., et al. Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell. 154, (6), 1380-1389 (2013).
  23. Yamada, T., et al. Spatiotemporal analysis with a genetically encoded fluorescent RNA probe reveals TERRA function around telomeres. Scientific Reports. 6, 38910 (2016).
  24. Deng, Z., et al. Formation of telomeric repeat-containing RNA (TERRA) foci in highly proliferating mouse cerebellar neuronal progenitors and medulloblastoma. Journal of Cell Science. 125, (Pt 18), 4383-4394 (2012).
  25. Casini, A., et al. A highly specific SpCas9 variant is identified by in vivo screening in yeast. Nature Biotechnology. 36, (3), 265-271 (2018).
  26. Nergadze, S. G., et al. CpG-island promoters drive transcription of human telomeres. RNA. 15, (12), 2186-2194 (2009).
  27. Porro, A., et al. Functional characterization of the TERRA transcriptome at damaged telomeres. Nature Communications. 5, 5379 (2014).
  28. Farnung, B. O., Brun, C. M., Arora, R., Lorenzi, L. E., Azzalin, C. M. Telomerase efficiently elongates highly transcribing telomeres in human cancer cells. PLoS One. 7, (4), e35714 (2012).
  29. Flynn, R. L., et al. Alternative lengthening of telomeres renders cancer cells hypersensitive to ATR inhibitors. Science. 347, (6219), 273-277 (2015).
  30. Scheibe, M., et al. Quantitative interaction screen of telomeric repeat-containing RNA reveals novel TERRA regulators. Genome Research. 23, (12), 2149-2157 (2013).
  31. Bolland, D. J., King, M. R., Reik, W., Corcoran, A. E., Krueger, C. Robust 3D DNA FISH using directly labeled probes. Journal of Visualized Experiments. (78), (2013).
  32. Masui, O., et al. Live-cell chromosome dynamics and outcome of X chromosome pairing events during ES cell differentiation. Cell. 145, (3), 447-458 (2011).
Generation av Cancer Cell kloner att visualisera Telomeric Repeat-innehållande RNA TERRA uttryckt från en enda telomeren i levande celler
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Avogaro, L., Oss Pegorar, C., Bettin, N., Cusanelli, E. Generation of Cancer Cell Clones to Visualize Telomeric Repeat-containing RNA TERRA Expressed from a Single Telomere in Living Cells. J. Vis. Exp. (143), e58790, doi:10.3791/58790 (2019).More

Avogaro, L., Oss Pegorar, C., Bettin, N., Cusanelli, E. Generation of Cancer Cell Clones to Visualize Telomeric Repeat-containing RNA TERRA Expressed from a Single Telomere in Living Cells. J. Vis. Exp. (143), e58790, doi:10.3791/58790 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter