Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Canlı hücreler içinde tek bir telomer üzerinden ifade Telomeric tekrar içeren RNA TERRA görselleştirmek için kanser hücre klonlar nesil

doi: 10.3791/58790 Published: January 17, 2019

Summary

Burada, tek bir subtelomere bir MS2 sıra etiketi içeren kanser hücre klonlar oluşturmak için bir protokol mevcut. Bu yaklaşım MS2 GFP sistemde güvenerek, endojen tutanaklar, telomeric tekrar içeren RNA (canlı hücreler içinde tek bir telomer üzerinden ifade TERRA) görselleştirme sağlar.

Abstract

Telomer, sebebiyet veren telomeric için tekrar içeren-uzun kodlamayan RNA'ların (TERRA), hangi heterochromatin oluşumu ve telomer uzunluğu homeostasis gibi telomer biyolojide önemli rol oynarlar önerilen transkripsiyonu. Son bulgular TERRA molekülleri Ayrıca gen ekspresyonu fare embriyonik kök (ES) hücre içinde düzenlemek için iç kromozom bölgeleri ile etkileşim ortaya koydu. Bu kanıtlar doğrultusunda sadece bir alt RNA floresans in situ hibridizasyon (RNA-balık) analizleri göstermiştir TERRA tutanaklar kromozom uçlarında yerelleştirilmesine. TERRA molekülleri dinamiklerini daha iyi anlaşılmasını işlev ve mekanizmaları eylem tanımlamak yardımcı olur. Burada, etiket ve tek-telomer TERRA transkript kanser hücrelerinde MS2 GFP sistemini kullanarak görselleştirmek için bir yöntem açıklanmaktadır. Bu amaçla, biz AGS insan mide kanseri hücre kültürünü tek bir subtelomere entegre MS2 dizileri içeren kullanarak istikrarlı klonlar, oluşturmak için bir protokol mevcut. TERRA transkripsiyon MS2 öğesini telomer üzerinden canlı hücre floresans mikroskobu GFP (MS2-GFP) erimiş MS2 RNA-bağlayıcı proteinin ortak ifade üzerine tarafından görüntülenmiştir MS2 öğesini TERRA molekülleri ifade sonuçlanır. Tek-telomer TERRA molekülleri kanser hücrelerinin dinamiklerini incelemek araştırmacılar bu yaklaşım sağlar ve diğer hücre hatları için uygulanabilir.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Uzun kodlamayan RNA TERRA kromozomlar subtelomeric bölgesinden sentezlenir ve onun transkripsiyon içinde telomeric tekrar yolu1,2sonlandırma kromozom uçları doğru devam eder. Bu nedenle, TERRA transkript vasıl onların son 5' subtelomeric kaynaklı sıralarının oluşur ve telomeric tekrarlar (omurgalılarda UUAGGG)3ile bitirmek. Önemli rolleri önerdi TERRA için telomerlerin4,5, DNA çoğaltma6kromozom arasında Homolog rekombinasyon teşvik, heterochromatin formasyonu da dahil olmak üzere7,8 biter , telomer yapısını10ve telomer uzunluğu homeostazı2,11,12,13düzenleyen 9. Ayrıca, TERRA transkript yaygın gen ekspresyonu fare embriyonik kök (ES) hücreleri14düzenleyen sayısız extratelomeric siteleri ile etkileşim. Bunlar doğrultusunda (RNA-balık) analizleri yalnızca alt küme küme küme kümesini TERRA transkript göstermiştir kanıt, RNA floresans in situ hibridizasyon yerelleştirmek telomerlerin1,2,15' de. Buna ek olarak, TERRA formu nükleer toplamları fare hücreleri2,16X ve Y kromozomu, yerelleştirme bildirilmiştir. Bu bulgular TERRA transkript çekirdek içinde karmaşık dynamics geçmesi göstermektedir. TERRA molekülleri dinamiklerini anlamak, işlev ve mekanizmaları eylem tanımlamak yardımcı olacaktır.

MS2 GFP sistem, canlı hücreler çeşitli organizmalar17,18RNA molekülleri görselleştirmek için yaygın olarak kullanılmıştır. Bu sistem daha önce etiket ve tek-telomer TERRA molekülleri S. cerevisiae12,19görselleştirmek için kullanılmıştır. Bu sistemi kullanarak, bu son zamanlarda Maya TERRA tutanaklar içinde sitoplazma post-diauxic shift aşamasında TERRA extranuclear işlevleri20uygulamayın düşündüren yerelleştirmek gösterilmiştir. Son zamanlarda tek-telomer TERRA transkript kanser hücreleri21çalışmaya MS2 GFP sistemi kullandık. Bu amaç için MS2 dizileri tek telomer (telomer 15q, bundan sonra Tel15q), entegre etmek için CRISPR/Cas9 genom düzenleme aracı istihdam ve klonlar MS2 öğesini endojen Tel15q TERRA (TERRA-MS2 klonları) ifade elde. Tanıyan ve yaşam MS2 RNA sıralarını etkinleştirir görselleştirme tek-telomer TERRA transkript bağlar GFP erimiş MS2 RNA-bağlayıcı protein (MS2-GFP) ortak ifade21hücreleri. TERRA-MS2 klonlar üretimi için gereken adımları ayrıntılı olarak açıklamak için burada resimli Protokolü amacı budur.

TERRA-MS2 klonlar üretmek için MS2 kaset telomer 15q, bölgenin subtelomeric tümleşiktir, TERRA organizatörü bölge ve transkripsiyon başlangıç sitesi aşağı akım. Füme balığı-p siteleri tarafından çevrili bir paromisin direnç gen MS2 kaset içerir ve onun entegrasyon subtelomere 15q, CRISPR/Cas9 sistem22kullanılarak gerçekleştirilir. Kaset, tek klonlar MS2 transfection seçilir ve subtelomeric entegrasyon-in kaset PCR tarafından doğrulandıktan sonra DNA sekanslama ve Güney leke. Pozitif klonlar Cre ifade adenovirus ile sadece MS2 dizileri ve subtelomere 15q tek somon balığı-p sitesinde bırakarak kasete, seçim işaretçisi kaldırmak için bulaşmış. TERRA MS2 öğesini transkript Tel15q üzerinden ifade RT-qPCR tarafından doğrulanır. Son olarak, MS2 GFP füzyon protein ifade edilir MS2-TERRA transkript floresans mikroskobu tarafından görselleştirmek için retroviral enfeksiyon via TERRA-MS2 klonlar içinde. TERRA transkript RNA-balık tarafından kolayca tespit edilebilir ve1,2,15,23telomeric tekrar özel kullanarak canlı hücre görüntüleme sondalar. Bu yaklaşımlar TERRA molekülleri tek hücre çözünürlükte toplam nüfusu lokalizasyonu üzerinde önemli bilgiler sağlar. Klonlar MS2 dizileri, tek bir subtelomere içeren nesil araştırmacılar tek-telomer TERRA transkript işlevi ve mekanizmaları TERRA eylem tanımlamak yardımcı olacaktır canlı hücrelerdeki dinamikleri çalışmaya olanak sağlar.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Paromisin dayanıklı klonlar yelpazesi

  1. %10 Fetal sığır Serum (FBS) 2 mM L-glutamin, penisilin (orta mL başına 0.5 birim) ve streptomisin (orta mL başına 0.2 µg) 37 ° C ve % 5 CO2ile takıma Ham'ın F-12_K (Kaighn'ın) orta AGS hücreleri büyümek. Vektör ve MS2 Kaset 1:10, ifade sgRNA/Cas9 ile % 50-60 izdiham hücreleri transfect molar oranı21.
    Not: paralel bir deneyde, GFP ifade vektör (Yani, Cas9-GFP vektör) transfecting tarafından transfection verimliliği doğrulayın. En az 60-%70 transfection verim elde.
  2. Ertesi gün, paromisin, 0.7 µg/mL nihai toplama (Seçmeli Orta) içeren orta kodlamayla orta yerine.
    Not: hücreleri bölme ve onları transfection seçim sürecini hızlandıracaktır ertesi günü seçici ortamda tohum. Tüm sigara transfected hücreleri hemen ölür. Transfection 6 iyi levha gerçekleştirilirse, her şey % 60 Bu durumda izdiham yaklaşık 0,7 x 106 hücreler, hücre tek bir kuyudan bir 10 cm çanak içeren seçmeli orta bölünebilir ertesi gün içerir.
  3. Hücrelerin seçici ortamda 7-10 gün boyunca orta her biri değişen tutmak ya da iki gün, tek klonlar kadar görünür.
  4. Hücre klonlar seçmek
    1. % 0.25 tripsin her iyi 10 µL içeren bir 96 iyi tabak hazırlamak.
      Not: iki hazırlamak 96 de tabaklar-dibi takdirde fazla 96 klonlar çekilmesi bekleniyor.
    2. Mikroskop kullanımı ile her klon konumunu görünür 10 cm tabak içinde bir nokta alt kısmında bir işaretleyici kullanarak yemek yaparak işaretleyin. Her nokta bir koloni için çekilecek karşılık gelir.
    3. Kodlamayla orta ile yeterli fosfat tamponlu serum fizyolojik (sıvı ince bir film üzerinde klonlar formu ve klon malzeme çekme sırasında kuru hücreleri değil izin vermek için PBS) değiştirin.
    4. Tek kolonileri 10 µL pipet kullanarak seçin. Tripsin kolonisi 5 µL içeren ipucu ekleyin ve yavaş yavaş koloni lokalize kalır tripsin bırakın. Tripsin hücreler için 1 dk, ayırmak o zaman koloni ucu scrape ve ucunu emmek izin.
      Not: PBS hikayesidir koloni çevresinde azaltmak için malzeme çekme işlemi koloni çevresinde tripsin sulandrarak kaçınarak yardımcı olacak bu yüzden bu işlem sırasında bir tarafta biraz çanak çevirme. Bir klon ring kullanarak da tek klonlar seçmek yardımcı olabilir.
    5. Hücreleri koloni 96 iyi plaka 10 µL % 0.25 tripsin içeren bir kuyunun içine yerleştirin.
    6. Oda sıcaklığında 5 dk kuluçkaya sonra iyi Seçmeli Orta (%10 FBS, 2 mM L-glutamin, penisilin (orta mL başına 0.5 birim), streptomisin (orta mL başına 0.2 µg) ile desteklenmiş ve paromisin de içeren Ham'ın F - 12 K (Kaighn'ın) orta 150 µL ile doldurmak 0.7 µg/mL konsantrasyonu.
      Not: kuluçka süre içinde diğer klonlar olabilir aldı. Bu mümkün olduğu kadar çok klonlar almak için tavsiye edilir. Daha fazla klon toplanır yüksek şansını pozitif olanlar tanımlama olacaktır.
    7. Bir kez tüm klonlar aldı ve 96 iyi plaka transfer, Seçmeli Orta Ham'ın F - 12 K (Kaighn'ın) orta takıma %10 FBS, 2 mM L-glutamin, penisilin (orta mL başına 0.5 birim), streptomisin (0.2 µg mL başına birkaç gün büyümeye hücreleri bekleyin Orta) ve paromisin % 90 izdiham ulaşan kadar 0.7 µg/mL 37 ° C ve % 5 CO2' adlı bir konsantrasyon içeren.
  5. Klonlar keskin
    1. Üç hazırlamak 96 iyi tabak iyi, başına jelatin ekleyerek 100 µL tarafından jelatin ile kaplı, oda sıcaklığında 30 dk için kuluçkaya sonra PBS ile iki kez yıkayın. Bu tabakları ve dondurma (dondurma kaplamalar) klon DNA ekstraksiyon (DNA plaka) için kullanılır.
      Not: Jelatin kuyuları bağlanma hücrelerinin ve DNA'ın teşvik edeceklerdir. Özellikle, jelatin kaplama kuyu dibinde DNA ekstraksiyon sırasında sopa ve prosedürleri (aşağıda açıklanmıştır) yıkama DNA sağlayacaktır. Clone bölme işlemi sırasında bir çok kanallı pipet kullanılması önerilir.
    2. Klonlar % 90 izdiham ulaştığınızda, orta 96 iyi plaka her kuyudan Aspire edin, PBS ile yıkayın, 30 µL % 0.25 tripsin iyi ücret eklemek ve 37 ° C'de 5 min için kuluçkaya
      Not: Klonlar da klon aldı hücreleri bağlıdır farklı fiyatlarla büyüyecek. Böylece, bu adımı farklı klonlar % 90 izdiham ulaştığınız zaman birkaç gün boyunca gerçekleştirilecek.
    3. İyi başına seçmeli orta 70 µL ekleyin, yukarı ve aşağı kuyu içinde pipetting tarafından hücre kümeleri bozabilir, sonra 100 µL 30 µL Seçmeli Orta gelatinized Dondurucu levha doldurulmuş zekâ için iyi ve 30 µL başına 120 µL ile doldurulmuş gelatinized DNA plaka transfer h 50 µL Orta (seçme) olmadan.
    4. DNA plaka da kuluçka makinesine yerleştirin ve hücrelerin % 90 izdiham kadar 37 ° C ve % 5 CO2 ' de büyümeye sağlar.
    5. (% 70 etanol ile püskürtülür) parafilm kadar her şey mühür, kapağı üstüne yerleştirin ve plaka alüminyum folyo ile sarın için plaka üstüne ekleyin, buz gibi 80 µL taze 2 x Orta (% 80 FBS ve % 20 dimetil sülfoksit (DMSO)) dondurma yapılmış dondurma plaka her şey için ekleyin. -80 ° C'de yer donma tabaklar
    6. İyi başına Seçmeli Orta 90 µL bölünmüş olan ve kültür sonuçları eleme PCR kadar devam klonlar içeren orijinal 96 iyi plaka ekleyin. Bu plaka yedek plaka kullanılacaktır.

2. eleme paromisin dayanıklı klonları

  1. DNA ekstraksiyon 96 iyi DNA plaka.
    1. DNA plaka kültürlü klonlar % 90 izdiham ulaştığınızda, 2 kez PBS ile yıkayın, sonra 50 µL lysis ile tampon (10 mM Tris pH 7.5, 10 mM EDTA, 10 mM NaCl, % 0.5 SDS ve 1 mg/mL İndinavir K) koşullar. Parafilm ile plaka kapak, sızdırmazlık her şey, üzerinde streç ile kapak kapak koyun ve 37 ° C'de gecede yer.
    2. Soğuk etanol (Et-OH) 100 µL Ekle / NaCl çözüm (% 100 etanol 0,75 M NaCl) her şey ve 6 h veya gecede oda sıcaklığında çökelti.
      Not: Protokol burada duraklatılmış.
    3. Plaka ters çevirme tarafından Et-OH/NaCl çözümü kaldırmak ve 200 µL % 70 etanol iyi başına 3 kez yıkayın.
    4. RNAse A çözüm 25 µL distile su ekleyin ve 1 h için 37 ° C'de kuluçkaya.
  2. Genomik DNA'ın 3 µL PCR güçlendirme için kullanın. Besleme paromisin direnç gen ve subtelomere 15q içinde primerler kullanılarak seçilen klonlar PCR tarama gerçekleştirin. PCR güçlendirme standart polimeraz enzimleri ve PCR protokolleri21kullanılarak gerçekleştirilir.
    Not: MS2 astar (MS2-subtel15q-astar-S ve MS2 astar olarak) ve to astar (to Başbakan S ve to astar olarak) için PCR koşullar şunlardır: 20 98 ° C olarak denatürasyon adım ve sonra 34 döngü 98 ° C 10 s, 58° C 20 s, 72 ° C 15 s s , bir 25 µL polimeraz enzimi kullanarak tepki mix ( Tablo malzemelerigörmek). Astar dizileri Tablo 1' de belirtilmiştir.
  3. PCR reaksiyonları özel jel üzerinde çalıştırmak ve olumlu klonlar ( Tablo malzemeleri jel ayıklama kimyasalları görmek) standart jel çıkarma yordamları kullanarak elde edilen PCR bantları çıkarın.
  4. DNA sıralama jel çıkarılan PCR ürününün MS2 dizileri21varlığını onaylamasını çözümlemesi.
    Not: Sıralama analizleri PCR tarama için kullanılan primerler kullanılarak gerçekleştirilir.
  5. PCR olumlu klonlar Southern blot testi ile taranması
    1. Klonlar PCR ve Ham'ın F - 12 K (Kaighn'ın) orta takıma %10 FBS, 2 mM L-glutamin, penisilin (orta mL başına 0.5 birim), streptomisin (0.2 µg başına 6 iyi levha için sıralama filtreleme dışında orijinal 96 iyi plaka (yedek plaka) pozitif büyümeye Orta mL) ve paromisin, 0.7 µg/mL 37 ° C % 5 CO2konsantrasyonu içeren.
      Not: bazı bu klonlar kayıp olması, alternatif olarak, bir (bkz: Protokolü 2.6) dondurma plakaların onlardan çözülme.
    2. Bir kez klonlar % 90 izdiham içinde 6 iyi plaka, PBS hücrelerle yıkayın ve lizis arabelleği 0,5 µg İndinavir K iyi ücret içeren 250 µL ekleyin.
    3. Bir hücre kazıyıcı kullanarak hücreleri scrape ve lysate bir 1,5 mL tüp aktarmak.
    4. 16 h için 37 ° C'de kuluçkaya.
    5. 1 mL % 100 etanol ekleyin, şiddetle çalkalanır ve en az 2 h çökelti veya bir-20 ° C'de gece DNA izin
      Not: Protokol burada duraklatılmış.
    6. 13.400 x g 10 dk 4 ° C'de, spin, süpernatant atmak ve granül % 70 etanol ile yıkayın. Oda sıcaklığında Kuru granül hava girsin. Alternatif olarak, bir vakum yoğunlaştırıcı kullanın.
    7. DNA parçaları içinde 50 µL distile su RNAse A içeren resuspend ve 37 ° C'de 1 h için kuluçkaya
    8. 5-10 µg sindirim reaksiyonları 37 ° C'de gecede kuluçka tarafından 100 µL tepki hacmindeki NcoI ve BamHI enzimleri (iki bağımsız sindirim) kullanarak genomik DNA'ın sindirmek.
    9. Sindirim 4 µL üzerinde özel jel (% 0,8 özel) tam sindirim onay için çalıştırın.
    10. 1/10 birim sodyum asetat 3 M çözüm pH 5.2 ve 2 hacimli % 100 etanol kısıtlama sindirim reaksiyonları için ekleme ve en az 2 h kuluçkaya veya bir DNA çökelti-20 ° C'de gece.
      Not: Protokol burada duraklatılmış.
    11. 13.400 x g 20 dk için 4 ° C'de, santrifüj kapasitesi, supernatants atmak ve granül % 70 etanol ile yıkayın. Hava Pellet kuru oda sıcaklığında izin. Alternatif olarak, bir vakum yoğunlaştırıcı kullanın.
    12. Granül 20 µL distile su içinde resuspend ve sindirilmiş DNA % 0,8 özel jel üzerinde yük.
      Not: Daha iyi bir çözünürlük sindirilir DNA için jel en az 15 cm uzun hazırlamak ve gecede alçak gerilim (̴30 volt) çalıştırın. Kurmak Elektroforez optimize edilmelidir.
    13. Ertesi gün, jel gibi etidyum bromür 1 µL/10 mL son konsantrasyon, oda sıcaklığında 30 dakika, bir DNA etiketleme aracı ile leke ve enstrüman Imaging bir jel üzerinde jel yakın cetvelle fotoğrafını çek.
    14. DNA transferini bir naylon membran ayarla ve membran hibridizasyon standart prosedürler21kullanarak bir MS2 fingerprinting sonda ile gerçekleştirebilirsiniz.
    15. PCR, DNA sekanslama ve Güney pozitif klonlar leke birinden (sonraki adıma bakın) iki dondurma tabak çözülme.
  6. Çözdürme klonları
    1. 5 mL, önceden ısıtılmış Ham'ın F - 12 K içeren bir 15 mL Tüp hazırlayın (Kaighn'ın) orta %10 FBS, 2 mM L-glutamin, penisilin (orta mL başına 0.5 birim) ve streptomisin (orta mL başına 0.2 µg) her klon çözdürülen için ile desteklenmiştir.
    2. Bir dondurma plakaların-80 ° çıkarmak ve önceden ısıtılmış F12K tam orta 100 µL de çözdürülen için olumlu klon içeren için ekleyin.
      Not: Bu yordam hızlı bir şekilde uygulanmalıdır ve her klon, diğer klonlar donmuş kalmasını sağlamak amacıyla çözdürülen sonra 96 iyi plaka Kuru buz üzerinde yer almalıdır. Birden fazla klon aynı 96 iyi plaka çözdürülen gerekiyorsa, bu özellikle önemlidir.
    3. Hücreleri orta ve oda sıcaklığında 5 min için vasıl 800 x g santrifüj 5 mL içeren 15 mL tüp aktarın.
    4. Orta Aspire edin, önceden ısıtılmış tam F12K orta 500 µL hücrelerde resuspend ve her klon 12 iyi plaka tek bir şey için transfer.
  7. Paromisin direnç gen MS2 kaset üzerinden kaldırılması subtelomere 15q entegre.
    1. Klonlar tam F12K ortamda 10 cm çanak 12 iyi tabağı büyümeye izin.
      Not: Paromisin ortamda aksi belirtilmedikçe dahil edilmemesini.
    2. 10 cm çanak tam F12K orta 10 ml % 70 izdiham, kültürlü hücrelerde Cre ifade adenovirus ekleyin.
      Not: Cre-GFP ifade adenovirus kullanmak % 100 yaklaşım gerektiğini enfeksiyon verimliliğini değerlendirilmesi olanak tanır. Çoğaltma-arızalı adenovirus kültür kaç pasajlar sonra kaybolur.
    3. 48 saat sonra enfeksiyon, üç 10 cm yemeklerinde hücreleri bölün. Paromisin içeren hücrelerde büyüyen negatif seçime göre iki tabak paromisin gen Temizleme doğrulaması için kullanılacak Orta (ilk yemek) ve Güney tarafından (ikinci çanak) leke.
    4. Hücre dondurma ve RNA ayıklama için klon içeren üçüncü yemek kültürü.

3. TERRA-MS2 transkript ifade RT-qPCR tarafından doğrulanması

  1. Paromisin gen kaldırma doğrulama toplam RNA çekme--dan TERRA-MS2 klonlar organik çözücüler (fenol ve guanidin isothiocynate çözüm)21kullanarak gerçekleştirin.
    1. Bir 10 cm tabak 100 µL dietil pyrocarbonate (DEPC) su içinde çıkarılan RNA resuspend.
    2. RNA'ın 3 µL konsantrasyon ve RNA bütünlüğünü doğrulamak için bir denaturating (% 1 formaldehit içeren) 1 x 3-(N-Morpholino) propanesulfonic asit (paspas) jel üzerinde çalıştırın. Ayrıca bir spektrofotometre kullanarak RNA konsantrasyon inceliyorlar.
    3. DNaz ile RNA'ın 3 µg DNaz 1 adet kullanarak davranıyorum ben 60 µL son tepki birimindeki enzim.
    4. Reaksiyon 37 ° C'de 1 h için kuluçkaya
  2. Ters transkripsiyon tepki ve qPCR analizler
    1. Nükleaz ücretsiz microcentrifuge tüp için aşağıdaki bileşenleri ekleyin: 1 µM TERRA belirli astar, 1 µL dNTPs Mix (10 mM her), (̴300ng RNA için karşılık gelen) DNaz-tedavi RNA'ın 6 µL 2 µL. 4 µL DEPC su ile 13 µL için ses düzeyini ayarlayın.
      Not: aynı reaktifler ama TERRA belirli astar, yerine bir başvuru belirli astar içeren ikinci bir tüp her RNA analiz hazırlanmalıdır.
    2. İla 65 ° C 5 min için karışım ısı ve buz en az 1 dk. için kuluçkaya.
    3. Tüpler içeriğini tarafından kısa aralıklarla toplamak ve 5 X RT enzim arabellek, 1 µL 0.1 M dithiothreitol (DTT), 1 µL RNAse inhibitörü (4 adet) ve ters transkriptaz 1 µL 4 µL ekleyin ( Tablo malzemelerigörmek).
    4. 60 dk 42 ° C'de örnekleri kuluçkaya sonra 2 µL RT tepki qPCR analizleri için kullanın.
  3. 20 µL 2 x qPCR ana mix, 2 µL cDNA şablonunun, ileri astar (10 µM), ters astar (10 µM) 1 µL ve su 6 µL 1 µL 10 µL oluşan son hacmi qPCR reaksiyon karışımı hazırlayın.
  4. QPCR reaksiyon bir thermocycler standart protokolleri21kullanarak gerçekleştirin.

4. ifade MS2 GFP retrovirüsü imalatı

  1. MS2 GFP ifade retrovirüsü üretmek için % 80'i konfluent phoenix ambalaj hücreleri retrovirüsü vektör (pBabe-MS2-GFP PURO) ve molar oranı 4:1 / kullanarak vektör (örneğin pCMV-VSVG) ifade bir env gen ifade MS2 GFP füzyon proteini ile transfect iki vektörel çizimler.
  2. Ertesi gün, (DMEM FBS, 2 mM L-glutamin ve kalem/Strep % 10 ile desteklenmiş) kodlamayla orta ile taze orta içeren 10 mM sodyum bütrat değiştirin.
  3. 37 ° c, % 5 CO2, 8 h için kuluçkaya sonra taze kodlamayla orta virüs toplanan gireceği orta yerine.
  4. 48 saat sonra phoenix hücrelerden retrovirüsü içeren orta kaldırma. Bu orta doğrudan TERRA-MS2 klonlar enfeksiyon için kullanılabilir, bu durumda orta 0,45 µm filtre, polybrene (30 µg/mL nihai toplama) ekleyin ve bu hücrelerde (Bu durumda protokol 5 adımda devam eder) ekleyin. Alternatif olarak, retrovirüs bir 50 mL şahin tüpe 1/5inci birimi % 50 PEG-8000/900 mm NaCl çözüm ekleme ve bir gecede bir rotator tekerlek üzerinde 4 ° C'de kuluçka çöktürülmüş.
  5. Ertesi gün, Pelet retrovirüsü moleküller tarafından Santrifüjü 2.000 x g 30 dk için de süpernatant kaldırmak ve Pelet serum olmadan F12K ortamda resuspend.
    Not: Virüs partikülleri içinde 1/100th orijinal süpernatant hacminin resuspended. Bir enfeksiyon test retrovirüsü verimli bir şekilde hücreleri enfekte için gereken en küçük birim doğrulamak için yapılmalıdır.

5. TERRA-MS2 transkript canlı hücrelerdeki görselleştirme

  1. TERRA-MS2 klonlar ve cam popolu yemekleri hücrelerde WT AGS plaka. Enfeksiyon günü, polybrene (30 µg/mL nihai toplama) orta ve MS2 GFP ifade retrovirüsü ekleyin.
  2. 24 saat sonra virüs içeren orta atın ve fenol kırmızısı olmadan taze orta ekleyin.
  3. Hücreler uygun mikroskop ayarı kullanarak bir ters mikroskobu, analiz. Görüntü 100 X hücrelerle veya 60 X amacı ile büyük sayısal diyafram (1.4 X) ve hassas kamera (EMCCD) kullanarak. Bir çevresel kontrol sistemi örnekleri CO2 37 ° C ve %5, görüntüleme sırasında korumak için kullanın.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Şekil 1 deneysel stratejisi genel bir bakış temsil eder. Protokol ve TERRA-MS2 klonlar AGS hücrelerdeki nesil için Gösterge niteliğindeki bir zaman çizelgesi ana adımları (Şekil 1A) gösterilir. Gün 1, 6 iyi tabakta birden çok kuyu MS2 kaset ve sgRNA/Cas9 ( Şekil 1'Bgösterilen) vektörel çizimler ifade ile transfected. İki farklı subtelomere 15q özgü Kılavuzu RNA dizileri klonlanmış Cas9 nickase-ifade içinde pX335 vektör, üreten MS2 kaset ile birlikte transfected iki sgRNA pX335 vektörel çizimler. Bir şey plaka transfection etkinliğini doğrulamak için vektör ifade bir GFP ile transfected. Gün 2, hücreleri trypsinized ve tek bir kuyudan Seçmeli Orta içeren bir 10 cm çanak transfer. En untransfected hücreler ölü olarak gün 3, orta değiştirilmelidir. Klonlar görünür ve çekilmek üzere hazır olana hücreleri seçimde yetiştirilmektedir. Bu süre boyunca, hücreleri değil trypsinized ve kodlamayla orta 1-2 günde değiştirilmelidir ilk hafta ve daha sonra her 2-3 gün sonra. Tek klonlar görünür olduğunda, onlar aldı ve burada izdiham yüzde 80-90'ını erişene dek büyümeye izin verilen bir 96 iyi tabak içinde transfer. Bu noktada, klonlar bir renk kodu ile Şekil 1 ' deki işaretlenen 4 farklı 96 iyi tabak, bölünür. DNA plaka (yeşil) kültürlü klonlar % 80 izdiham ulaştığınızda, onlar lysed ve genomik DNA PCR tarama için çıkarılan; klonlar yedek plaka (mavi) kırmızı Dondurucu levha-80 ° C'de dondurulmuş iken PCR, eleme sonuçları kadar kültür tutulacaktır. Şekil 2 B temsilcisi paromisin dayanıklı klonlar bir PCR tarama sonuçlarını gösterir. Bu tarama için astar iki kümesi kullanılır: bir astar çifti (MS2 astar) paromisin gen ve subtelomere 15q dizisi içinde tavlama (astar yerelleştirme temsilcisi bir görüntü gösterilir içinde MS2 kaset varlığını denetlemek için kullanılır Bir yolunu 2A). Bir ikinci astar çifti (to astar) bir iç kromozom bölgesini tavlama (astar dizileri tablo 1' de belirtilen) yanlış negatif klonlar varlığını denetlemek için kullanılır. Kaset entegrasyonu için negatif klonlar MS2 astar amplifikasyon için negatif ve pozitif to astar amplifikasyon için olmalıdır. Genomik DNA ekstraksiyon genomik DNA veya onun kontaminasyon olmaması durumunda ortaya çıkan teknik sorunları PCR güçlendirme MS2 ve to astar tepkiler gelen engel. Bu gibi durumlarda, ilgili klonlar PCR tarafından genomik DNA ekstraksiyon yedek plaka üzerine yeniden gösterimi. Pozitif klonlar MS2 astar amplifikasyon elde edilen bantları jel çıkarılan ve on MS2 dizileri varlığını doğrulamak için MS2 primerler kullanılarak sıralanmış olabilir.

PCR tarama, pozitif klonlar genomik DNA ekstraksiyon ve Güney leke analizleri için lysed sonra 96 de yedek plaka ( Şekil 1' deki mavi tabak) 6 iyi plakasına kültürlenir. Şekil 2 D bir jel (solda) ve bir radioactively etiketli MS2 sıra belirli probe PCR olumlu klonlar Southern blot taranması ile (sağda) melezleşmiştir membran temsilcisi görüntüleri gösterir. İçin onay MS2 dizileri entegrasyon subtelomere 15q, genomik DNA her klon çıkarılan iki farklı enzimleri ile (NcoI ve BamHI) iki ayrı sindirim reaksiyonları sindirmek. NcoI ve BamHI enzimleri MS2 kaset Integration subtelomere 15q, doğrulanması için uygundur. Diğer enzimler de kullanılabilir. Jel genomik DNA'ın tam bir sindirim BamHI Restriksiyon enzimi kullanarak bir smear varlığı tarafından belirtildiği şekilde gösterir. Southern blot sonuçlarından birkaç klonlar birden fazla tümleştirme kaset, birden çok grup varlığı tarafından belirtildiği şekilde gösterilir iken o bir klon MS2 kaset subtelomere 15q, tümleştirme için olumlu olduğunu gösteriyor. Olumlu bir klon NcoI sindirim genomik DNA21üzerine ikinci bir Güney leke analiz edilmelidir. Subtelomere 15q MS2 içeren kaset temsilcisi bir görüntüsünü ve BamHI ve NcoI Restriksiyon enzimi siteleri konumunu Şekil 2'Cgösterilir.

Klonlar pozitif PCR ve Güney leke analizleri ile Cre-GFP ifade adenovirus paromisin gen MS2 kasete mevcut kaldırmak için bulaşmış. Şekil 3 A tasvir bir MS2 öğesini subtelomere 15q önce ve sonra Cre ifade. Cre GFP ifade adenovirus Şekil 3' teBgösterilir bir klon subtelomere 15q MS2 kaset entegrasyon için olumlu bir görüntü bulaşmış. Paromisin gen tüm hücrelerdeki tamamen kaldırılması için enfeksiyon verimliliği yaklaşık %100 ulaştırılması gerekmektedir. Şekil 3' teCgösterildiği gibi paromisin gene, ortadan kaldırılması doğrulamak için Cre-GFP enfekte hücreler üç levha enfeksiyon 48 saat sonra ayrılır. Bir tabak paromisin huzurunda kültürlü. Bu plaka tüm hücrelerde 6-7-gün içinde ölmeli. İkinci bir tabak içinde hücre seçimi olmadan tam orta % 80-90 izdiham için büyümek için izin verilir. Bu noktada, genomik DNA çıkarılan ve Southern blot tarafından analiz. Üçüncü plaka donmuş stokları klonu ve RNA çıkarılması için hazırlanması ve RT-qPCR analizleri TERRA-MS2 transkript ifade izin veren tam ortamda kültürlenir. Şekil 3 D önce ve sonra Cre-GFP enfeksiyon pozitif bir klonu Güney leke analizleri temsilcisi görüntüleri gösterir. DNA özel jel (soldaki resim) NcoI Restriksiyon enzimi kullanarak genomik DNA'ın tam sindirim onaylar. Southern blot Analizi bir radioactively etiketli MS2-sıra belirli sonda (resim) kullanılarak gerçekleştirildi. Bu analiz paromisin gen kaldırılması onaylar. Cre-GFP enfekte örnek bir smear varlığı MS2 dizileri telomeric entegrasyonu onaylar. Subtelomere 15q NcoI kısıtlama sitelerle konumunu Şekil 3' teAgösterilir.

Paromisin direnç geni ortadan kaldırılması onayladıktan sonra klonlar TERRA-MS2 transkript ifade için test edilebilir. Bu amaçla, toplam RNA her klon çıkarılan ve üzerinde bir denaturating bezleri jel bütünlüğünü (Şekil 4A) onaylamak için çalıştırın. Ribozomal RNA bantları 4.700 üssü (rRNA 28S) görünür olmalı ve 1,900 (rRNA 18S) temelleri. Retrotranscription tepki telomeric tekrar özgü astar kullanarak gerçekleştirilir ve başvuru gene özgü astar (Şekil 4B, üst) qPCR analizleri TERRA ifade ederken astar iki kümesi kullanarak gerçekleştirilir: bir astar çift besleme MS2 sıra ve subtelomere 15q sıra içinde; subtelomere 15q içinde tavlama astar ikinci bir çifti. Astar dizileri tablo 1' de belirtilmiştir. Şekil 4' deB grafik RT-qPCR analizleri AGS WT hücreleri ve iki farklı TERRA-MS2 klon TERRA ifade gösterir. Bu analizler, subtelomere 15q WT hücrelerdeki üzerinden ifade TERRA transkript karşılaştırılabilir düzeyde iki klon TERRA-MS2 transkript ifade onaylayın. Bu veriler seçili iki TERRA-MS2 klon TERRA-MS2 transkript yanında canlı hücre düşsel analizleri için uygun olduğunu gösteriyor.

TERRA-MS2 transkript canlı hücrelerdeki görselleştirmek için seçili klonlar MS2 GFP füzyon protein ifade retrovirüsü ile bulaşmış. Şekil 5 A Protokolü adım 4'te açıklandığı gibi MS2 GFP ifade retrovirüsü, oluşturmak için bu yordamı gösterir. AGS WT hücreleri ve TERRA-MS2 klonlar cam popolu yemekleri bulaşmış. Enfeksiyon üzerinden 24 saat sonra hücreleri floresan mikroskopi tarafından incelenir. Sinyal özgüllük TERRA-MS2-GFP foci TERRA-MS2 klonlar çekirdeği ve AGS WT hücreleri (Şekil 5B) tespit varlığı ile doğrulanır. Vaha'da MS2 GFP hücreleri, heterojenlik hücreleri arasında MS2 GFP düzeyleri açısından ifade bekleniyor ve düşük seviyelerde ifade hücreleri görüntüleme analizleri için seçilmelidir. Alternatif olarak, MS2 GFP ifade hücreleri FACS önceki Mikroskobu analizleri tarafından GFP seviyesinin düşük ifade hücreleri subpopulation toplamak için sıralanabilir. Biz daha önce TERRA-MS2-GFP foci hücreleri AGS TERRA-MS2% %40 60 olarak klonlar21tespit etti. Bu hücreler, hücre başına bir ile dört TERRA-MS2-GFP foci görüntüsü. TERRA-MS2-GFP foci farklı boyutları ve dinamikleri gösterilen tespit edilen21olabilir. TERRA-MS2 klonlar tek-telomer TERRA transkript canlı hücrelerdeki dinamiklerini incelemek için kullanılabilir. Bu uygulama örneği, Şekil 5C temsilcisi Mikroskobu analizleri MS2 GFP füzyon protein ve TRF2 mCherry için erimiş telomer bağlanıcı proteinler ifade bir TERRA-MS2 klonu görüntüleri gösterir. TERRA MS2 öğesini transkript ve yaşam hücrelerindeki telomerlerin görselleştirin. Bu yaklaşımı kullanarak, biz daha önce TERRA-MS2-GFP foci telomerlerin %44 hücrelerin ile birlikte yerelleştirmek ki TERRA transkript sadece geçici kromozom uçları AGS hücreleri21ile birlikte yerelleştirmek olduğunu belirten gözlemledim.

Figure 1
Şekil 1 . Deneysel strateji ve TERRA-MS nesil için gösterge zaman çizelgesi bakış2 klonlar AGS hücrelerde. A) TERRA-MS2 yelpazesi klonlar için protokol ve gösterge zaman çizgisi içinde açıklanan adımları gösterilmektedir. Hücreleri bir 6 iyi plaka Doğrusallaştırılmış MS2 kaset ve sgRNA/Cas9 vektörler ifade ile transfected. Bir renk kodu yedek plaka ve Dondurucu levha Protokolü bölümünde belirtilen DNA plaka ayırt etmek için kullanılır. B) MS2 kaset MS2 dizileri 10 tekrarlama tarafından takip 800 nt uzun subtelomere 15q dizisi oluşur ve somon balığı-p tarafından çevrili bir paromisin direnç gen siteleri ve bir 300 nt uzun telomeric tekrar yolu onun 3' ucunda ile sona erer. sgRNA/Cas9 ifade vektörel çizimler subtelomere 15q özgü Kılavuzu RNA dizileri pX335 vektör BbsI kısıtlama sitesi21,22kullanarak klonlama tarafından üretildi. İki farklı sgRNA-pX335 vektörler oluşturulan ve iki vektörel çizimler 1:1 karışımı transfection için kullanıldı. SgRNAs dizisi tablo 1' de belirtilmiştir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Şekil 2 . Temsili resim PCR ve Güney leke paromisin dayanıklı klonlar testi ile taranması. A) subtelomere 15q MS2 kaset içeren temsilcisi görüntü. PCR tarama için kullanılan MS2 astar (MS2-subtel15q-astar-S ve MS2 astar olarak) konumunu belirtilir. LoxP siteleri kaset içinde mevcut kırmızıyla gösterilir. B) PCR tarama astar, MS2 astar ve to astar (to Başbakan S ve to astar olarak) iki kümesi kullanarak paromisin dayanıklı klonların temsili resim. C) subtelomere 15q MS2 kaset içeren temsilcisi görüntü. BamHI ve NcoI kısıtlama siteleri ve Southern blot tarama için kullanılan MS2 sonda görünür. D) sol: klon başına genomik DNA'ın 10 µg BamHI ve bir özel jel kaçak sindirmek. Görüntü bir gecede 30 volt çalıştırın sonra satın alınmıştır. Sağ: Genomik DNA BamHI Restriksiyon enzimi ile sindirilmiş bir pozitif yüklü naylon membran transfer ve bir radioactively etiketli MS2 fingerprinting sonda ile melezleşmiştir. Kırmızı kutu olumlu grubun beklenen boyutunu gösterir. Kırmızı ok bir pozitif klon gösterir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 3
Şekil 3 . Paromisin direnç gen ve doğrulama denemeleri ortadan kaldırılması. A) MS2 kaset önce ve sonra Cre ifade içeren subtelomere 15q temsilcisi görüntü. Güney leke analizleri ve NcoI Restriksiyon enzimi siteleri için kullanılan MS2 belirli sonda gösterilir. LoxP siteleri kaset içinde mevcut kırmızıyla gösterilir. B) floresan mikroskopi analiz Cre-GFP ifade adenovirus ile enfekte bir TERRA-MS2 klonu. Bir tek odak düzlemi alınan temsili resim gösterilir. MOI, enfeksiyon, çokluğu konak hücre sayısı ve virüs enfeksiyonu için kullanılan sayısı arasındaki oran'dir. Ölçek çubuğu: 30 µm C) paromisin gen ortadan kaldırılması doğrulamak için kullanılan deneysel stratejisi genel bakış. Cre-GFP enfekte hücreler üç levha i) negatif seçimi, ii) Güney leke analizleri ve III) dondurulmuş hücre stokları ve RNA ayıklama hazırlanması için enfeksiyon 48 saat sonra ayrılır. D) Güney leke analizleri TERRA MS2 önce ve sonra Cre-GFP adenovirus enfeksiyonu klonu. 10 µg genomik DNA Restriksiyon enzimi ile NcoI sindirilmiş. Özel jel tam sindirim hem klonlar (solda) elde edilir onaylar. Sindirilir genomik DNA pozitif yüklü naylon membran için transfer oldu ve bir MS2 fingerprinting sonda kullanarak melezleşmiştir. Paromisin gen tam ortadan kaldırılması belirli Grup yokluğunda tarafından onaylanır. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 4
Şekil 4 . RT-qPCR analizlerini Tel15q-TERRA ve Tel15q-TERRA-MS2 transkript ifade. A) toplam RNA AGS WT hücreleri ve TERRA-MS2 klonlar çıkarılan gösterilen bir süpürgeyi jel temsili resim. Karşılık gelen grup ribozomal RNA 28S ve 18S belirtilir. B) Top: TERRA transkript ifade MS2 öğesini subtelomere 15q şematik. TERRA retrotranscription (sarı) ve qPCR analizler Tel15q-TERRA (mavi) ve Tel15q-MS2 TERRA (kırmızı) için kullanılan astar gösterilir. LoxP sitesi kırmızı renkte gösterilir. Alt: RT-qPCR analizleri Tel15q-TERRA ve Tel15q MS2 TERRA transkript ifade AGS WT hücrelerinde ve TERRA-MS2 klonlar. p < 0,05, unpaired t-test. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 5
Şekil 5 . TERRA-MS analizleri Imaging canlı hücre2 klonlar. A) MS2 GFP ifade retrovirüsü Protokolü adım 4'te açıklandığı gibi üretmek için yordamı genel bir bakış. Subtelomere 15q MS2 öğesini ve TERRA transkript MS2 GFP füzyon protein tarafından tanınan bir şematik sağ tarafta gösterilir. B) AGS WT ve iki TERRA-MS2 temsilcisi floresans mikroskobu görüntüsü klonlar MS2 GFP ifade. TERRA-MS2-GFP foci oklarla belirtilmiştir. Görüntüleri bir EMCCD fotoğraf makinesi ile donatılmış dönen disk confocal mikroskop kullanarak elde. Görüntüleri bir 100 X kullanarak ele geçirildi / 1,46 apochromat objektif bir görüntüleme odasında tutulan 37 ° c % 5 CO2. 488 lazer ışık kaynağı olarak kullanıldı. Ölçek çubuğu: 5 µm. C) canlı hücre analizleri TERRA-MS2-GFP foci ve TRF2-mCherry görüntüleme telomerlerin etiketli. TERRA-MS2-GFP odak ve bir tek telomer Co yerelleştirme olay gösterilir. Görüntüleri B488 ve 520 lazer ışık kaynağı olarak kullanarak, olduğu gibi elde. Hızlandırılmış görüntüleme denemenin noktası gösterilir bir tek seferde gerçekleştirilen bir z yığın deney maksimal bir projeksiyon. Ölçek çubuğu: 5 µm. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Astar adı Astar sıra Uygulama
MS2-subtel15q-astar-S TGCATTAAAGGGTCCAGTTG İleri paromisin dayanıklı klonlar PCR tarama için kullanılan MS2 astar
MS2 astar olarak CCTAACTGACACACATTCCACAGA Paromisin dayanıklı klonlar PCR tarama için kullanılan MS2 astar ters
TO astar S TGT ACG CCA ACA CAG TGC TG İleri paromisin dayanıklı klonların PCR tarama kullanılan to astar
TO astar olarak GCT GGA AGG TGG ACA GCG A Paromisin dayanıklı klonların PCR tarama kullanılan to astar ters
Tel15q-S1 GCAGCGAGATTCTCCCAAGC QPCR tarafından Tel15q ve Tel15q-MS2 TERRA ifade algılamak için kullanılan anlamda astar
hTel15q-AS TAACCACATGAGCAATGTGGGTG QPCR tarafından Tel15q ve Tel15q-MS2 TERRA ifade algılamak için kullanılan antianlamlı astar
Tel15q-MS2-AS ATGTTTCTGCATCGAAGGCATTAGG QPCR tarafından Tel15q-MS2 TERRA ifade algılamak için kullanılan antianlamlı astar
TERRA-RT-astar CCCTAACCCTAACCCTAACCCTAACCCTAA TERRA transkript retrotranscription için kullanılan astar
sgRNA1 TTGGGAGAATCTCGCTGGCC Kısa Kılavuzu RNA 1 dizisi pX335 vektörde klonlanmış ve subtelomere 15q Cas9 nickase enzimatik aktiviteye yönlendirmek için kullanılan
sgRNA2 TGCATTAAAGGGTCCAGTTG Kısa Kılavuzu RNA 2 dizisi pX335 vektörde klonlanmış ve subtelomere 15q Cas9 nickase enzimatik aktiviteye yönlendirmek için kullanılan

Tablo 1 : Bu çalışmada kullanılan astar listesi. Astar ve bu protokol için kullanılan sgRNAs dizileri listesi sağlanır. Dizileri 5'-3' vardır.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Bu makalede biz insan kanser hücre klonlar subtelomere 15q içinde entegre MS2 dizileri içeren oluşturmak için bir yöntem mevcut. Bu klonlar kullanma, subtelomere 15q transkripsiyonu MS2 öğesini TERRA molekülleri floresans mikroskobu tarafından MS2 GFP füzyon protein ortak ifade tarafından tespit edilir. Bu yaklaşım tek bir ifade TERRA dinamiklerini incelemek araştırmacılar sağlar telomer yaşayan hücreleri21. Bu protokol için TERRA-MS2 klonlar TERRA, TERRA ifade upregulated insan mide kanseri örnekleri24yılında bu yana eğitim için ilginç bir model sistem temsil eden AGS hücre satırı seçilir. Ancak, burada açıklanan protokol TERRA-MS2 klonlar diğer hücre hatlarında seçimi için adapte edilebilir. MS2 dizileri bütünleştirilmesi ilke olarak telomer 15q farklı bir subtelomere, bir belirli MS2 kaset ve CRISPR strateji kullanarak terfi edebilir. Burada sunulan yönteminde Cas9 nickase enzim ve Çift Kişilik Kılavuzu RNA'ların tümleştirme22özgüllüğü artırmak için istihdam edilmektedir. Bu stratejiyi kullanarak, bir genel %2 pozitif klonların AGS hücrelerde tespit edilmesi bekleniyor. Cas9 enzim diğer sürümleri girişim klonlar seçim25başarı oranını artırmak için test edilebilir. Buna ek olarak, iletişim kuralı aşağıdaki adımları göz önünde klon seçimi verimliliğini en üst düzeye çıkarmak için kritik olanlar şunlardır:

I) TERRA-MS2 klonlar seçme şansını artırmak için MS2 kaset ve CRISPR vektörler yüksek transfection verimliliğini elde etmek önemlidir. Kötü transfected hücre hatları olasılıkla olumlu klonlar seçmek için birkaç tur transfection, klon seçimi ve tarama gerektirir.

II) bu klonlar seçimi için kullanmak üzere paromisin kesin konsantrasyonu belirlemek önemlidir. Gerçekten de, yüksek pozitif klonlar tanımlaması engel süre ilaç düşük konsantrasyon kullanarak yanlış pozitif klonlar neden olur. Bu protokol için belirtilen paromisin konsantrasyon AGS hücrelere 6-7 gün içinde kodlamayla orta için ek öldürücü değil.

III) klon malzeme çekme kritik bir adımdır. Nitekim, bu işlem sırasında gerekli sadece tek klonlar toplanır. Bu nedenle, yakın birbirine karıştırma önlemek için kaçınılması gereken çoğu kolonileri farklı klonlar hücreleri, nüfus MS2 dizileri içerebilir klonların seçiminde ortaya çıkan birden fazla genomik sitelerinde entegre. Bu olaylar Southern blot tarama sırasında tespit edilmelidir.

IV) birleşmesi 96 iyi DNA tabağı (2 iletişim kuralı) çıkarılan genomik DNA miktarı 5 µg olduğu tahmin edilmektedir ve her klon PCR ve bir tek Restriksiyon enzimi sindirim ile Southern Blot tarafından ekran için yeterli olacaktır. Ancak, beklenen telomer adlı kaset entegrasyonu onaylamak için bu iki farklı enzimleri ile genomik DNA sindirerek tarafından Southern blot tarafından her klon ekran önemli olacaktır. Bu amaç için iletişim kuralında, belirtildiği şekilde klonlar PCR tarama, pozitif 6 iyi levha kültürlü olmalıdır. 6 iyi plaka bir kuyudan çıkarılan genomik DNA miktarı Güney leke analizleri için gerekli en az iki kısıtlama kesimi için yeterli olacaktır.

Burada açıklanan protokolünde MS2 dizileri içinde subtelomere 15q nedenlerle bir dizi için entegre edilmiştir: Ben) TERRA organizatörü bölge ve TERRA transkripsiyon başlangıç siteleri bu subtelomere26,27tarihinde; tespit edilmiştir II) subtelomere 15q TERRA ifadeden vitro teknikleri4,27,28,29,30kullanılarak tarafından doğrulandı; III) sıralı kromozom 15q subtelomeric bölge ve benzersiz bir bölge bitişik MS2 Kasetli21entegrasyonu için hedef telomeric tekrar yolu içerir. PCR ve Southern blot yaklaşımlar içinde subtelomere 15q içinde TERRA-MS2 klonlar MS2 sıralarının tek tümleştirme onaylamak için geliştirilmiştir. Ayrıca DNA-balık deneyler sabit metafaz kromozomlarının MS2 serilerinde kromozom lokalizasyonu görselleştirmek için kromozom yayılır üzerinde gerçekleştirmek için ilginç olabilir. Ancak, 10xMS2 uzunluğu diziler (450 bp) genellikle kromozom yayılır (bakteriyel yapay kromozomu (Bac), cosmids veya plazmid)31DNA-balık deneylerde kullanılan problar ile karşılaştırıldığında çok kısa sonda kullanımı dayatır. Bu teknik sorun bize bir sınırlama Protokolü temsil eden kromozom yayılır MS2 dizileri görselleştirme engelledi. Bir başka yöntem zaman ve TERRA-MS2 klonlar seçmek için gereken çabayı kısıtlamasıdır. Buna ek olarak, belirli laboratuar ve virüsler, radyoaktif madde ve mikroskopi analizleri donatımın kullanımı için gereklidir.

Burada açıklanan yöntemi TERRA-MS2 klonlar farklı hücre hatlarında nesil için TERRA dynamics çeşitli biyolojik bağlamlarda gibi anlamak için bize yardım telomer disfonksiyon veya hücresel yaşlanma sırasında tanımlamak için uygulanabilir TERRA işlevi bu süreçlerde. İlginç bir gelişme bu yaklaşımın TetO içeren TERRA-MS2 klonlar nesil entegre MS2 öğesini telomer dahil olmak üzere belirli bir subtelomere, yinelenen denetim olacak. Floresan bir protein (yani mCherry) erimiş bir Tetra protein ifadesi bu görselleştirme sağlayacak belirli telomer yaşayan hücreleri32. Bu yaklaşım insan TERRA transkript yerelleştirilmesine ve BDT içinde telomer ve kromozom veya trans içinde diğer kromozom taşındıktan tarafından transkripsiyonu TERRA, hareket soruşturma sağlayacaktır. Netleştirilmelidir TERRA biyolojide bu soru kalır.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar hiçbir rakip mali çıkarlarının ilan

Acknowledgments

CIBIO Trento Üniversitesi, gelişmiş görüntüleme tesis ve Viyana BioOptics ışık mikroskobu tesiste Max F. Perutz Laboratuvarları (MFPL), personel için minnettarız. Bu sonuçlar için önde gelen araştırma Mahlke-Obermann Vakfı ve Avrupa Birliği'nin yedinci çerçeve programı araştırma, teknolojik gelişim ve gösteri için hibe sözleşmesi kapsamında hiçbir 609431 EC için fon aldı EC bir Rita Levi Montalcini bursu Eğitim Üniversite ve araştırma (MIUR) İtalyanca Bakanlığı tarafından desteklenmektedir.

Materials

Name Company Catalog Number Comments
AGS cells - - Gift from Christian Baron (Université de Montréal).
F12K Nut Mix 1X GIBCO 21127022 Culturing medium for AGS cells
L-Glutamine  CORNING MT25005CI Component of cell culturing medium
Penicillin Streptomycin Solution CORNING 30-002-CI Component of cell culturing medium
Fetal Bovine Serum Sigma Aldrich F2442 Component of cell culturing medium
DMEM 1X GIBCO 21068028 culturing medium for phoenix cell
CaCl2 Sigma Aldrich C1016 used in phoenix cell transfection
HEPES Sigma Aldrich H3375 used in phoenix cell transfection (HBS solution)
KCl Sigma Aldrich P9333 used in phoenix cell transfection (HBS solution)
Dextrose Sigma Aldrich D9434 used in phoenix cell transfection (HBS solution)
NaCl Sigma Aldrich S7653 used in phoenix cell transfection (HBS solution) and retrovirus precipitation
Na2HPO4 Sigma Aldrich S3264 used in phoenix cell transfection (HBS solution)
TRYPSIN EDTA SOLUTION 1X CORNING 59430C used in cell split
DPBS 1X GIBCO 14190250 Dulbecco's Phosphate Buffered Saline
DMSO Sigma Aldrich D8418 Component of cell freezing medium (80% FBB and 20% DMSO)
G-418 Disulphate Formedium G4185 selection drug for 
Gelatin solution Bioreagent Sigma Aldrich G1393 cotaing of 96 well DNA plate and freezing plate
Tris-base Fisher BioReagents 10376743 Component of Cell lysis buffer for genomic DNA extraction
EDTA Sigma Aldrich E6758 Component of Cell lysis buffer for genomic DNA extraction
SDS Sigma Aldrich 71729 Component of Cell lysis buffer for genomic DNA extraction
Proteinase K Thermo Fisher AM2546 Component of Cell lysis buffer for genomic DNA extraction
RNAse A Thermo Fisher 12091021 RNA degradation during DNA extraction
Agarose Sigma Aldrich A5304 DNA gel preparation
Atlas ClearSight Bioatlas BH40501 Stain reagent used for detecting DNA and RNA samples in agarose gel
ethanol Fisher BioReagents BP28184 DNA precipitation
Sodium Acetate  Sigma Aldrich 71196 Used for DNA precipitation at a 3M concentration pH5.2
Wizard SV Gel and PCR clean-Up system Promega A9282 Extraction of PCR fragments from agarose gel during PCR screening of neomycin positive clones
Trizol AMBION 15596018 Organic solvent used for RNA extraction
Dnase I THERMO SCIENTIFIC 89836 degradation of genomic DNA from RNA 
dNTPs mix Invitrogen 10297018 used in RT and PCR reactions
DTT Invitrogen 707265ML used in RT reactions
diethyl pyrocarbonate Sigma Aldrich D5758 used to inactivate RNAses in water (1:1000 dilution)
Ribolock Thermo Fisher EO0381 RNase inhibitor
MOPS Sigma Aldrich M9381 preparation of RNA gel
Paraformaldehyde Electron Microscopy Sciences 15710 preparation of denaturating RNA gel (1% PFA in 1x MOPS)
Superscript III Reverse transcriptase Invitrogen 18080-093 Retrotranscription reaction
Pfu DNA polymerase (recombinant) Thermo Scientific EP0501 PCR reaction
2X qPCRBIO SyGreen Mix Separate-ROX PCR BIOSYSTEMS PB 20.14 qPCR reaction
Cre-GFP adenovirus https://medicine.uiowa.edu/vectorcore 1174-HT used to infect TERRA-MS2 clones in order to remove the neomycn gene
Sodium Butyrate Sigma Aldrich B5887 used to promote retrovirus particles production in phoenix cells
PEG8000 Sigma Aldrich 89510 Precipitation of retrovirus partcles
35µ-Dish Glass Bottom Ibidi 81158 used in live cell imaging analyses of TERRA-MS2 clones

DOWNLOAD MATERIALS LIST

References

  1. Azzalin, C. M., Reichenbach, P., Khoriauli, L., Giulotto, E., Lingner, J. Telomeric repeat containing RNA and RNA surveillance factors at mammalian chromosome ends. Science. 318, (5851), 798-801 (2007).
  2. Schoeftner, S., Blasco, M. A. Developmentally regulated transcription of mammalian telomeres by DNA-dependent RNA polymerase II. Nature Cell Biology. 10, (2), 228-236 (2008).
  3. Diman, A., Decottignies, A. Genomic origin and nuclear localization of TERRA telomeric repeat-containing RNA: from Darkness to Dawn. FEBS Journal. (2017).
  4. Arnoult, N., Van Beneden, A., Decottignies, A. Telomere length regulates TERRA levels through increased trimethylation of telomeric H3K9 and HP1alpha. Nature Structural & Molecular Biology. 19, (9), 948-956 (2012).
  5. Montero, J. J., et al. TERRA recruitment of polycomb to telomeres is essential for histone trymethylation marks at telomeric heterochromatin. Nature Communications. 9, (1), 1548 (2018).
  6. Beishline, K., et al. CTCF driven TERRA transcription facilitates completion of telomere DNA replication. Nature Communications. 8, (1), 2114 (2017).
  7. Arora, R., et al. RNaseH1 regulates TERRA-telomeric DNA hybrids and telomere maintenance in ALT tumour cells. Nature Communications. 5, 5220 (2014).
  8. Balk, B., et al. Telomeric RNA-DNA hybrids affect telomere-length dynamics and senescence. Nature Structural & Molecular Biology. 20, (10), 1199-1205 (2013).
  9. Graf, M., et al. Telomere Length Determines TERRA and R-Loop Regulation through the Cell Cycle. Cell. 170, (1), 72-85 (2017).
  10. Lee, Y. W., Arora, R., Wischnewski, H., Azzalin, C. M. TRF1 participates in chromosome end protection by averting TRF2-dependent telomeric R loops. Nature Structural & Molecular Biology. (2018).
  11. Moravec, M., et al. TERRA promotes telomerase-mediated telomere elongation in Schizosaccharomyces pombe. EMBO Reports. 17, (7), 999-1012 (2016).
  12. Cusanelli, E., Romero, C. A., Chartrand, P. Telomeric noncoding RNA TERRA is induced by telomere shortening to nucleate telomerase molecules at short telomeres. Molecular Cell. 51, (6), 780-791 (2013).
  13. Moradi-Fard, S., et al. Smc5/6 Is a Telomere-Associated Complex that Regulates Sir4 Binding and TPE. PLoS Genetics. 12, (8), e1006268 (2016).
  14. Chu, H. P., et al. TERRA RNA Antagonizes ATRX and Protects Telomeres. Cell. 170, (1), 86-101 (2017).
  15. Lai, L. T., Lee, P. J., Zhang, L. F. Immunofluorescence protects RNA signals in simultaneous RNA-DNA FISH. Experimental Cell Research. 319, (3), 46-55 (2013).
  16. Zhang, L. F., et al. Telomeric RNAs mark sex chromosomes in stem cells. Genetics. 182, (3), 685-698 (2009).
  17. Gallardo, F., Chartrand, P. Visualizing mRNAs in fixed and living yeast cells. Methods in Molecular Biology. 714, 203-219 (2011).
  18. Querido, E., Chartrand, P. Using fluorescent proteins to study mRNA trafficking in living cells. Methods in Cell Biology. 85, 273-292 (2008).
  19. Cusanelli, E., Chartrand, P. Telomeric noncoding RNA: telomeric repeat-containing RNA in telomere biology. Wiley Interdisciplinary Reviews: RNA. 5, (3), 407-419 (2014).
  20. Perez-Romero, C. A., Lalonde, M., Chartrand, P., Cusanelli, E. Induction and relocalization of telomeric repeat-containing RNAs during diauxic shift in budding yeast. Current Genetics. (2018).
  21. Avogaro, L., et al. Live-cell imaging reveals the dynamics and function of single-telomere TERRA molecules in cancer cells. RNA Biology. 1-10 (2018).
  22. Ran, F. A., et al. Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell. 154, (6), 1380-1389 (2013).
  23. Yamada, T., et al. Spatiotemporal analysis with a genetically encoded fluorescent RNA probe reveals TERRA function around telomeres. Scientific Reports. 6, 38910 (2016).
  24. Deng, Z., et al. Formation of telomeric repeat-containing RNA (TERRA) foci in highly proliferating mouse cerebellar neuronal progenitors and medulloblastoma. Journal of Cell Science. 125, (Pt 18), 4383-4394 (2012).
  25. Casini, A., et al. A highly specific SpCas9 variant is identified by in vivo screening in yeast. Nature Biotechnology. 36, (3), 265-271 (2018).
  26. Nergadze, S. G., et al. CpG-island promoters drive transcription of human telomeres. RNA. 15, (12), 2186-2194 (2009).
  27. Porro, A., et al. Functional characterization of the TERRA transcriptome at damaged telomeres. Nature Communications. 5, 5379 (2014).
  28. Farnung, B. O., Brun, C. M., Arora, R., Lorenzi, L. E., Azzalin, C. M. Telomerase efficiently elongates highly transcribing telomeres in human cancer cells. PLoS One. 7, (4), e35714 (2012).
  29. Flynn, R. L., et al. Alternative lengthening of telomeres renders cancer cells hypersensitive to ATR inhibitors. Science. 347, (6219), 273-277 (2015).
  30. Scheibe, M., et al. Quantitative interaction screen of telomeric repeat-containing RNA reveals novel TERRA regulators. Genome Research. 23, (12), 2149-2157 (2013).
  31. Bolland, D. J., King, M. R., Reik, W., Corcoran, A. E., Krueger, C. Robust 3D DNA FISH using directly labeled probes. Journal of Visualized Experiments. (78), (2013).
  32. Masui, O., et al. Live-cell chromosome dynamics and outcome of X chromosome pairing events during ES cell differentiation. Cell. 145, (3), 447-458 (2011).
Canlı hücreler içinde tek bir telomer üzerinden ifade Telomeric tekrar içeren RNA TERRA görselleştirmek için kanser hücre klonlar nesil
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Avogaro, L., Oss Pegorar, C., Bettin, N., Cusanelli, E. Generation of Cancer Cell Clones to Visualize Telomeric Repeat-containing RNA TERRA Expressed from a Single Telomere in Living Cells. J. Vis. Exp. (143), e58790, doi:10.3791/58790 (2019).More

Avogaro, L., Oss Pegorar, C., Bettin, N., Cusanelli, E. Generation of Cancer Cell Clones to Visualize Telomeric Repeat-containing RNA TERRA Expressed from a Single Telomere in Living Cells. J. Vis. Exp. (143), e58790, doi:10.3791/58790 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter