Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Bioengineering

Organidi neurali umani per lo studio del cancro al cervello e delle malattie neurodegenerative

doi: 10.3791/59682 Published: June 28, 2019
* These authors contributed equally

Summary

Questo studio introduce e descrive protocolli per derivare due organoidi neurali umani specifici come un modello rilevante e accurato per lo studio 1) lo sviluppo del glioblastoma umano all'interno di organoidi neurali umani esclusivamente negli esseri umani e 2) neuronergico differenziazione generando un organoide tridimensionale.

Abstract

La mancanza di modelli neurali in vitro rilevanti è un ostacolo importante sul progresso medico per le neuropatologie. La creazione di modelli cellulari pertinenti è fondamentale sia per comprendere meglio i meccanismi patologici di queste malattie sia per identificare nuovi obiettivi e strategie terapeutiche. Per essere pertinenti, un modello in vitro deve riprodurre le caratteristiche patologiche di una malattia umana. Tuttavia, nel contesto della malattia neurodegenerativa, un modello in vitro rilevante dovrebbe fornire la sostituzione delle cellule neurali come una preziosa opportunità terapeutica.

Tale modello consentirebbe non solo lo screening di molecole terapeutiche, ma potrebbe anche essere utilizzato per ottimizzare la differenziazione del protocollo neurale [ad esempio, nel contesto del trapianto nella malattia di Parkinson (PD)]. Questo studio descrive due protocolli in vitro di 1) lo sviluppo del glioblastoma umano all'interno di un organoids neurale umano (NO) e 2) differenziazione neurone dopaminergico (DA) generando un organoide tridimensionale (3D). A questo scopo, è stato stabilito un protocollo ben standardizzato che consente la produzione di neurosfere calibrate in base alle dimensioni derivate dalla differenziazione delle cellule staminali embrionali umane (hESC). Il primo modello può essere utilizzato per rivelare eventi molecolari e cellulari che si verificano durante lo sviluppo del glioblastoma all'interno dell'organoid neurale, mentre l'organoid DA non solo rappresenta una fonte adatta di neuroni DA per la terapia cellulare nella malattia di Parkinson, ma può anche essere utilizzati per il test antidroga.

Introduction

L'Organizzazione Mondiale della Sanità (OMS) classifica gli astrocitomi come di basso grado (grado da I a II) o di alto grado (grado III e IV). Glioblastoma multiforme (GBM) è un astrocitoma di grado IV, il più letale dei tumori cerebrali primari, che è resistente a tutte le forme attuali di trattamenti1. Nonostante la terapia standard di cura tra cui neurochirurgia, chemioterapia e radioterapia, GBM rimane fatale e il tasso di sopravvivenza globale di 15 mesi non è cambiato drasticamente negli ultimi 15 anni2. Per compiere progressi significativi nella comprensione della patogenesi GBM, l'uso di modelli pertinenti è fondamentale. Finora, lo studio di GBM ha fatto affidamento su linee cellulari, fette organotipiche e xenotrapianto di cellule derivate dal paziente in topi o topi transgenici sviluppando tumori spontanei3,4. Anche se questi modelli sono stati utili per studiare la metastasi cerebrale e l'aggressività tumorale, sono limitati da differenze tra le specie, e le conclusioni risultanti possono essere tradotte in modo errato nei tessuti umani. Inoltre, i modelli esistenti con cellule umane sono limitati anche dall'assenza di interazioni tra tessuto ospite3,4. I modelli sperimentali sono fondamentali per la traduzione dalla scienza di base agli obiettivi terapeutici. Pertanto, la descrizione di un protocollo per produrre organoidi neurali umani in vitro co-coltivati con cellule che hanno invitato GBM (GIC) può fornire un sistema rilevante che imita le caratteristiche morfologiche e funzionali dello sviluppo GBM. Questo sistema riproduce alcune caratteristiche in vivo dello sviluppo gbM, come la migrazione diffusa di cellule invasori e aree di necrosi, e mette in evidenza l'espressione genica rilevante per la biologia tumorale. Come rivelato in precedenza, alcuni microRNA critici vengono indotti durante lo sviluppo di GIC all'interno del tessuto nervoso 3D5,6.

La PD è un disturbo neurodegenerativo importante e associata alla degenerazione di più sottotipi neuronali7. Anche se un progressivo insorgenza dei sintomi (ad esempio, bradicinesia, tremore di riposo asimmetrico, rigidità e instabilità della postura) caratterizza la malattia, la sua eziologia esatta non è chiaramente stabilita. Infatti, molti studi hanno evidenziato che i principali fattori di rischio possono derivare da una combinazione di fattori genetici e ambientali. I sintomi di Parkinson sono associati alla degenerazione bilaterale dei neuroni dopaminergici nella substancia nigra (SN), che porta alla scomparsa degli assoni dopaminergici (DA) che si proiettano allo striato8,9. Pertanto, la riduzione dei livelli di dopamina striatale è correlata con la progressione della disfunzione motoria nei pazienti affetti da PD. I neuroni dopaminergici contengono idrossilasi di tirosina (TH), un enzima chiave nella sintesi di neurotrasmettitori catecholaminergici che converte l'amminoacido L-tirosina in L-3,4-diidrossifenilina (L-DOPA, un precursore della dopamina) alla dopamina10. La perdita precoce dell'attività di TH seguita da un declino dell'espressione della proteina TH è un segno distintivo della PD.

Questo studio descrive due protocolli che utilizzano organoidi neurali umani, uno specificamente orientato verso un fenotipo midbrain-like arricchito con cellule TH-positive.

Protocol

Questo protocollo segue le linee guida del comitato etico della ricerca umana dell'Università di Ginevra.

1. Manutenzione e coltura di cellule staminali embrionali umane indifferenziate (hESC)

  1. Esegui la manutenzione e l'espansione degli hSEC in condizioni di liberazione dell'alimentatore pre-rivestimento con una specifica matrice extracellulare.
    1. Scongelare 300 l di matrice extracellulare a 4 gradi centigradi (concentrazione tipica della gamma 18-22 mg/mL, tenere sul ghiaccio) e mescolare delicatamente con 15 mL di mezzo DMEM freddo per evitare una gelazione prematura della matrice extracellulare. Aggiungere 7,5 mL dell'extracellulare matrico a entrambi i flaconi T150.
    2. Incubare i piatti rivestiti con matrice extracellulare a 37 s per almeno 1 h (massimo durante la notte).
    3. Rimuovere gli hESC medi e semi a una densità di 6,5 x 104 celle/cm2.
  2. Mantenere H1 (linea cellulare hESC) in hESC medio e 1% penicillina/streptomycin.
  3. Passare le cellule con procedura ezimatica: aggiungere 7,5 mL di soluzione ezimatica a un flacone T75 cm2 per un periodo di 1-2 min a 37 gradi centigradi. Una volta che le cellule sono completamente staccate, aggiungere 7,5 mL di DMEM-F12 quindi centrificare per 5 min a 300 x g. Per consentire una migliore sopravvivenza, ri-piastrare le cellule alla densità desiderata su piatti extracellulari rivestiti a matrice, nello stesso mezzo contenente inibitore della chinasi proteica associata al Rho (ROCK) (10 M) per 24 ore.

2. organoidi neurali derivati da hESC per studi GBM

  1. 24 h prima di iniziare la coltura 3D, sostituire il mezzo hESC con un mezzo privo di siero integrato con 10 inibitori di ROCK di 10 M (entrambi i componenti sono necessari per sostenere la sopravvivenza delle cellule e la formazione spontanea della neurosfera durante la fase di aggregazione in un microwell piatto). Le cellule devono essere al 60% di confluenza. Il giorno successivo (giorno 0), staccare le colonie hESC come singole cellule: rimuovere il mezzo, quindi risciacquare con PBS senza Ca2 oMg2, aggiungere 5 mL di soluzione di dissoluzione enzimatica e incubare a 37 gradi centigradi per 1-2 min.
  2. Raccogliere le cellule in un mezzo privo di siero con 10 M di inibitore ROCK e centrificare le cellule a 300 x g per 5 min. Rimuovere il supernatante e contare le cellule in 10 mL di mezzo senza sieri integrato con 10 M di inibitore ROCK.
  3. In parallelo, sciacquare la piastra microwell con 2 mL di mezzo senza sieri per pozzo e centrifugare la piastra a 1200 x g per 5 min per rimuovere tutte le bolle, che possono prevenire la formazione della neurosfera.
  4. Preparare 28,2 x 106 cellule in 12,5 mL di mezzo senza sieri integrato con 10 inibitore ROCK m. Distribuisci 1000 cellule/microwell. Centrifugare le cellule a 300 x g per 5 min e posizionare la piastra nell'incubatrice a 37 gradi durante la notte (massimo 36 h). Per esempio: per ottenere 30 organoidi neurali umani, utilizzare una fiaschetta T150 al 70%-80% della confluenza (circa 30 milioni di cellule).
  5. Il giorno successivo (giorno 1), raccogliere le sfere (con un P1000) e metterle in un 6 bene piastra. In ogni pozzo, aggiungere 2 mL di B27 medio e DMEM-F12 GlutaMAX e Neurobasal medio (mix a 1:1), integrato con 1% B27 integratori e 1% aminoacidi non essenziali (NEAA). Per promuovere l'induzione neurale veloce, integrare il mezzo con un doppio cocktail di inibizione SMAD, composto da 10 inibitori di TGF/Nodal e inibitore della proteina morfogena dell'osso 0,5 M (BMP). Da questo passo in avanti, le sfere sono coltivate in rotazione (60 rpm, shaker orbitale). La rotazione è fondamentale per evitare che le sfere si attacchino insieme o alla piastra.
  6. Cambiare il mezzo ogni 2-3 giorni: piegare la piastra e lasciare cadere le sfere per 5 min, rimuovere metà del mezzo (2 mL), e aggiungere 2 mL di fresco B27 medio integrato con fattori di crescita e inibitori. Non centrifugare le sfere.
  7. Eseguire l'induzione neurale in base al seguente corso temporale:
    1. Dai giorni 1-4, la cultura le sfere in B27 medio integrato con dual-SMAD. Il doppio cocktail di inibizione sMAD (10 M TGF/Activin/Nodal inibitore e 0,5 M bMP inibitore) promuove l'induzione neurale.
    2. Dai giorni 4-11, promuovere la proliferazione di rosette neurali derivate da hESC (nelle sfere), aggiungendo 10 fattore di crescita epidermico ng/mL (EGF) e 10 fattore fibroblasto di base ng/mL (bFGF) al mezzo B27 integrato con cocktail dual-SMAD.
      NOTA: il giorno 11, la maggior parte delle celle dovrebbe essere positiva per Nestin.
    3. Dai giorni 11-13, coltura le sfere in B27 medio integrato con 0,5 M inibitore BMP.
    4. Dai giorni 13-21, coltura le sfere in B27 medio integrato con 10 ng/mL gliale fattore neurotrofico derivato (GDNF), 10 ng/mL cervello derivato fattore neurotrofico (BDNF) e 1 M di inibitore di z secretasi. GDNF e BDNF promuovono la differenziazione neuronale e gliale. L'inibitore della segretasi a z consente una maggiore maturazione neurale.
    5. Il giorno 21, placcare le sfere (circa 1.000 sfere) su una membrana idrofila politetrafluoroetilene (PTFE) depositata su un inserto di piastra di coltura progettato per 6 pozzetti. Interrompere qualsiasi rotazione da questo passaggio. La presenza di rosette, osservate con un microscopio a campo luminoso, indicano l'avvio della differenziazione neurale. Le rosette neurali possono essere osservate 2-3 giorni dopo le sfere di placcatura sulla membrana PTFE.
    6. Aggiungere 1 mL di B27 medio integrato con fattori di crescita e inibitori (come seguito) per ogni ben sotto l'inserto della membrana, ogni 2-3 giorni (di solito il Lunedi, Mercoledì e Venerdì), per un successivo 3 settimane di differenziazione.
    7. Dai giorni 21-25, coltivare gli organoidi neurali umani nello stesso mezzo di maturazione neurale (Cf. passo 2.7.4).
    8. Dai giorni 25-28, completa solo il mezzo B27 con 1 - inibitore di segreto.
    9. Dai giorni 28-39, smetti di aggiungere l'inibitore della segretesi -z e continua la coltura degli organoidi neurali umani solo nel mezzo B27.
      NOTA: Dopo 3 settimane, gli organoidi neurali sono pronti all'uso per l'impianto GIC. Lungo la maturazione neurale, è stata osservata una diminuzione del marcatore nevralgico immaturo Nestin e un aumento dei marcatori neurali maturi3-tubulina e GFAP.

3. Isolamento e coltivazione di cellule che hanno invitato il glioblastoma (GIC)

  1. Isolare le GIC frammentando una biopsia GBM umana di alto grado. Trasferire il pezzo di tumore in un becher contenente 0.25% di prova in 0.1 mM EDTA (4:1) e mescolare lentamente a 37 s per 30-60 min (a seconda delle dimensioni del tumore).
  2. Piastra delle cellule dissociate in 75 cm2 flaconi di coltura tissutale placcate a 2.500-5.000 cellule per cm2 nel mezzo GIC: DMEM/F-12 medio (1:1) contenente 1% N2, 1% B27, e 1% G5 integratori (per favorire la sopravvivenza del GIC), integrati con bFGF e EGF (entrambi a 10 ng/Ml, per promuovere la stesità) e l'1% della penicillina/streptomicina.
  3. Una volta che il GIC è ben consolidato e in crescita, rimuovere i supplementi N2 e G5 dal supporto GIC.
  4. Un giorno prima di aggiungere le cellule sull'organoide, dissociare le GIC e contarle.
  5. Sciacquare la piastra microwell con 2 mL di mezzo GIC e centrifugare la piastra alla velocità massima per rimuovere le bolle (1000 x g). Posizionare le GIC a 1.000 cellule per ottenere una gliomasfera per microwell. Incubare pernottamento a 37 gradi centigradi (Figura1C). Questo passaggio è fondamentale e consente GIC ben calibrate (un esempio di GIF necrotiche e di dimensioni eccessive è illustrato nella Figura 2A,C).
  6. Per avviare l'invasione GBM, aggiungere una gliomasfera sopra il tessuto neurale con una grande punta del tubo di foro (Figura 1F). Riporre con cura la piastra 6 dell'incubatrice.

4. organoidi dopaminergici derivati da hESC per studi pd

  1. Giorno 0: amplifica gli hESC nella cultura 2D fino al 60% di confluenza (giorno 0), quindi sostituisci i supporti delle cellule staminali utilizzate per mantenere le caratteristiche di pluripotenza degli HESC con un mezzo privo di siero. Iniziare l'induzione neurale completando il mezzo di coltura con 0,5 M di inibitore di BMP e 10 -M inibitore TGF/Activin/Nodal (cocktail di inibizione a doppio SMAD), quindi aggiungere 10 inibitore ROCK m per 24 h per aumentare il tasso di sopravvivenza delle cellule durante il passaggio.
  2. Giorno 1: Preparare la piastra microwell con 2,5 mL per pozzo di mezzo senza siero integrato con 0,5 inibitori BMP, 10 inibitore TGF/Activin/Nodal e 10M inibitore rock. Per specificare le cellule verso il modello ventrale del tubo neurale, aggiungere 100 ng/mL Sonic Hedgehog (SHH), 100 ng/mL fattore di crescita fibroblasto 8 (FGF8) e 2 agonista levigato. Centrifugare la piastra (solo con cellule medie e senza cellule) a 1200 x g per 5 min per rimuovere le bolle d'aria dai micropozzi.
    1. Dopo 1 giorno di induzione neurale in 2D, rimuovere il mezzo e lavare rapidamente con PBS senza Ca2 o/MgCl2. Dissociare le colonie in sospensione a celle singole aggiungendo 7,5 mL di soluzione enzimatica ricombinante in un flacone T75 cm 2. Incubare per 2 min a 37 s poi completare con 7,5 mL di DMEM-F12.
    2. Raccogliere la sospensione cellulare e la centrifuga a 300 x g per 5 min. Rimuovere il supernatante e contare le cellule nello stesso mezzo utilizzato per preparare la piastra di microwell.
    3. Regolare il volume medio per ottenere una sospensione cellulare che consenta di formare neurosfere contenenti 1000 cellule per micropolo (ad esempio, la piastra di microwell utilizzata qui contiene 4.700 micropozzi per pozzo). Quindi, preparare 4,7 milioni di cellule in 2,5 mL di mezzo e aggiungerlo al precedente 2,5 mL di mezzo già collocato nella piastra.
    4. Al fine di distribuire correttamente le cellule in ogni micropolo, scuotere delicatamente la piastra e centrifugare la piastra microwell 300 x g per 5 min. Incubare la piastra a 37 gradi centigradi per 24 h per generare sfere.
  3. Giorno 2: Lavare delicatamente i micropozzi con il mezzo e raccogliere quindi trasferire le sfere in una piastra a sei pozzeti trattata con i tessuti. Sostituire medio con mezzo Neurobasal integrato con 1% B27, 1x NEAA, 2 mM L-glutamine, e 1% di penicillina / streptomicina. Inoltre, aggiungere fattori di regionalizzazione SHH, FGF8, agonista levigato, e doppia-SMAD inibizione piccole molecole.
    1. Posizionare le sfere a rotazione a 37 gradi centigradi (60 giri, agitatore orbitale) e cambiare metà medio appena integrato ogni 2-3 giorni.
  4. Giorno 3: Per migliorare l'induzione neurale e convertirsi in progenitori neurali con un'identità midbrain, integrare il mezzo con 3 inibitori GSK-3, che attiva la via Wnt / - catenina. Mantenere l'inibitore di GSK-3 nel mezzo fino al giorno 13. Dividi litibio in due nuove placche di 6 pozzetti trattati con i tessuti per ridurre sia la densità della sfera per pozzo ed evitare l'aggregazione della sfera.
    NOTA: al giorno 8, la maggior parte delle celle dovrebbe essere positiva per Nestin.
  5. Giorno 8: Avviare la maturazione neurale: sostituire i fattori di regionalizzazione SHH, FGF8, agonista levigato, e doppio-SMAD cocktail inibizione con 0,5 mM dibutyryl cAMP (per favorire la maturazione), 20 nM inibitore di istone deacetylase (per l'uscita del ciclo cellulare), 1 inibitori e fattori di crescita, 10 ng/mL GDNF, 10 ng/mL BDNF, 1 ng/mL che trasforma il fattore di crescita di trasformazione 3 (TGF) e 5 ng/mL FGF20 (entrambi favoriscono la sopravvivenza del progenitore DA). Cambiare il mezzo ogni 2-3 giorni.
  6. Giorno 21: Generare l'organoide neurale: semi circa 100 neurosfere in condizioni di interfaccia aria-liquido sulla membrana PTFE (6 mm di diametro). Trasferire la membrana in un inserto piastra di coltura (0,4 mm) e aggiungere 1,2 mL di mezzo di maturazione neurale utilizzato per la differenziazione della neurosfera, come descritto in precedenza.
    1. Interrompere qualsiasi rotazione da questo passaggio. Cambiare il mezzo ogni 2-3 giorni fino a ottenere il punto di tempo di differenziazione richiesto.
      NOTA: Per quanto riguarda la maturazione neurale, è stata osservata una diminuzione del marcatore nevralgico immaturo Nestin e l'aumento dei marcatori neurali maturi di 3 tubuline e GFAP. Sono state osservate espressioni TH e NURR1 elevate (Figura 3C) e confermano la maturità degli organidici neurali11.

5. Quantificazione dell'espressione genica TH e Nurr1 per la convalida della differenziazione dopaminergica

  1. Estrazione dell'RNA: il giorno di differenziazione indicato, lisse 40 neurosfere con 350 l di tampone RLT (fornito nel kit di estrazione dell'RNA) completate da 3,5 :L di 2-mercaptoetanolo. Estrarre l'RNA dalle neurosfere lismi utilizzando un kit di estrazione dell'RNA seguendo le istruzioni del produttore.
  2. Quantificare le concentrazioni totali di RNA.
  3. Eseguire la trascrizione inversa di 300 ng dell'estrazione totale dell'RNA utilizzando il kit di trascrizione inversa per la reazione quantitativa della catena di polimerasi in tempo reale (qPCR) e seguire le istruzioni del produttore .
  4. Eseguire l'analisi qPCR su sistemi di rilevamento PCR in tempo reale, sulla base del rilevamento asimmetrico dei coloranti di cianina. Normalizzare i dati con i geni delle pulidi: dehydrogenasi gliceraldeide-3-fosfato (GAPDH) e fattore di allungamento 1-alfa (EF1). Le sequenze di primer sono descritte nella Tabella 1.

6. Rilevamento di cromatografia liquida ad alta pressione (HPLC)

  1. Utilizzare cromatografia liquida ad alta pressione (HPLC) con rilevamento elettrochimico per rilevare la presenza di dopamina. La dopamina è stata estratta da organoidi neurali lisci in 100 mL di 0,1 N acido perclorico (HClO4) per 15 min a 4 gradi centigradi con un vortice vigoroso ogni 5 min. Dopo la centrifuga, raccogliere e conservare il supernatante a -20 gradi centigradi per il dosaggio della dopamina.
  2. Utilizzare una colonna C-18 (5 m, 4,6 mm x 150 mm) per separare gli analiti con HPLC in fase invertita in modalità isocratica a una velocità di flusso di 1 mL/minuto. La rilevazione della dopamina deve essere effettuata utilizzando un rilevatore coulometrico con la cella di condizionamento impostata ad un potenziale di 200 mV.

7. Registrazione dei dati grezzi con piattaforma MEA (microelectode array)

  1. Utilizzare un microscopio a dissezione per trasferire le neurosfere al centro di un dispositivo MEA poroso.
  2. Utilizzare un amplificatore e un sistema di acquisizione dati per registrazioni elettrofisiologiche. Misurare il rapporto segnale-rumore (SNR) come deviazione standard della tensione durante una registrazione di 5 min, utilizzando il segnale come tensione media picco-picco dei picchi registrati negli stessi 5 periodi min.

Representative Results

Le fasi critiche di questo protocollo devono essere ben identificate e gestite correttamente. Pertanto, un diagramma delle condizioni di coltura che indica il time-lapse per ogni passaggio, nonché i composti utilizzati per il protocollo di differenziazione sono illustrati nella figura 1A e nella figura 3A per gli organoid neurali NO più GBM e DA, rispettivamente. Figura 1B,C,D,E,F illustra le cellule, sfere, e NO e mostra la morfologia tipica per ogni passo. Figura1G,H,I illustra la colorazione dell'immunofluorescenza con alcuni marcatori neurali.

Figure 1
Figura 1 : organoide neurale umano (NO) protocollo di differenziazione. (A) Protocollo standardizzato per la generazione di NO derivato da cellule staminali embrionali umane (hESC). (B) gli hESC sono mantenuti su matrice extracellulare nel mezzo hESC. (C) Le piastre di microwell sono state utilizzate per generare neurosfere calibrate. A 2 settimane, le neurosfere sono state placcate sull'inserto contenente una membrana PTFE (barra di scala n. 50 m). (D) Vista macroscopica di NO nell'inserto in un pozzo di una piastra 6 pozzo. Durante i primi giorni, le rosette sono state osservate (freccia nera) (E). (F) Vista macroscopica di una sfera NO più GIC in alto. (G-I) L'analisi dell'immunofluorescenza della sfera NO più GIC (EGFR-positivo; barra della scala - 50 m) (G) e NO da sola, che ha mostrato reattività immunitaria per il marcatore neuronaleIII-tubulina e leggermente positiva per la nestina; tuttavia, la sinapsi 1 ha mostrato un segnale debole (H,I) (barre di scala : 100 m e 50 m, rispettivamente). Fare clic qui per visualizzare una versione più grande di questa figura. 

Figure 2
Figura 2 : Illustrazione di sfere necrotiche e NO immaturo. Le neurosfere (A) e NO (B) possono subire necrosi quando sono troppo numerose nel pozzo o sovradimensionate (C) (barra di scala 10 m). (D) Un GIC infettato da un giornalista di pomodoro aiuta a rintracciare l'invasione delle cellule tumorali in NO, barra della scala, 10 m. Esempio di NO immaturo con tubi neurali (E) e nessun tubo neurale (F) (barra di scala - 50m). Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3 : protocollo standardizzato per la generazione di organoide neurale DA e l'analisi elettrofisiologica e morfologica. (A) Protocollo standardizzato per la generazione di organoidi neurali DA. (B) Analisi dell'immunofluorescenza dell'organoide neurale DA; Le cellule TH-immunoreattive co-esprimono Nurr1, un marcatore specifico del midbrain (barra di scala - 50 m). I dati sono rappresentati come media : SEM (n - 3). (C) I grafici rappresentano la cinetica dell'espressione genica di TH e Nurr1 valutata da qRT-PCR. (D) Rappresentante HPLC: picco di dopamina (freccia) è stato rilevato da HPLC da LYsato organoide neurale DA. (E) Esempio di dati grezzi registrati con la piattaforma MEA. Ogni picco viene visualizzato da una linea verticale (timestamp), mentre la traccia rimanente è il rumore. (F) Immagine che rappresenta una neurosfera depositata sul MEA. (G) Superposizione dei picchi tipici (curve blu e rosse) rilevati dai dati grezzi. La curva nera in grassetto indica la media delle curve rosse corrispondenti. (H) Grafico raster che mostra gli indicatori di data e ora associati a ciascun picco rilevato. I diversi colori evidenziano i diversi elettrodi. Fare clic qui per visualizzare una versione più grande di questa figura. 

gene Foward fare retromarcia
Nurr1 GGCTGAGAAGCCATCTCTGT GTGAGGTCCATGCTAACTTGACA
Th GCACCTTGCGCAGTTCT CCCGAACTCCACCGTGAA
EEF1 AGCAAAAATGACCCACCAATG GCCTGGATGGTTCAGGATA
GAPDH GCACAAGAGAGAAGAAGAAACCACC AGGGGAGATTCAGTGTGGGGGT

Tabella 1: Primer utilizzati in questo protocollo.

Discussion

Uno degli aspetti più critici di questo protocollo include il mantenimento della pluripotenza hESC durante la coltura cellulare e il monitoraggio attento delle sfere e della morfologia degli organili neurali. Gli hESC sono molto sensibili e ogni manipolazione può portare a una differenziazione incontrollata precoce e alla morte cellulare. Al fine di aumentare la riproducibilità sperimentale ed evitare il verificarsi di eventi anormali di cariotipo, si consiglia di crioconservare diversi lotti di hESC al passaggio più basso dopo la convalida della loro stabilità cromosomica. Inoltre, si consiglia di scongelare una nuova fiala per ogni esperimento e controllare il comportamento delle cellule ogni giorno. Se le sfere sono meno rifrattive con dimensioni anormali più alte, probabilmente inizieranno ad aggregarsi e morire.

Un miglioramento di questo sistema è la perfusione o l'implementazione di un sistema vascolarizzato (aggiungendo cellule endoteliali o all'interno di un microchip fluidico 3D)12,13. Tuttavia, il controllo dello spessore dell'organoid neurale (300 m) consente un'efficiente perfusione passiva di ossigeno e nutrimenti e previene la necrosi. Un altro miglioramento è l'introduzione di cellule immunitarie (microglia). Con queste limitazioni in mente, organoidi neurali più un sistema GIC può essere uno strumento rilevante per diversi motivi. In primo luogo, questo sistema consente lo screening farmacologico per monitorare come un composto terapeutico può influenzare una cellula organoide o tumorale. In secondo luogo, le interazioni cellula-cellula possono essere studiate, e determinanti micro-ambientali alla base delle invasioni individuali e collettive possono essere visualizzate ed esplorate5,6,13.

Nel contesto del morbo di Parkinson, un organoide neurale arricchito nei neuroni DA può rappresentare un modello 3D pertinente e accurato per studiare lo sviluppo della malattia. In studi precedenti, le cellule staminali pluripotenti indotte derivate dal paziente di Parkinson differenziate verso i neuroni DA sono state utilizzate per studiare i sottotipi neuronali colpiti. Da notare che sono stati osservati alcuni fenotipi correlati alla malattia, come l'accumulo di sinucleina e la sensibilità allo stress ossidativo14,15. Inoltre, l'organoid neurale può essere utilizzato come strumento per lo screening delle molecole terapeutiche. Tuttavia, letture specifiche e rilevanti dovrebbero essere istituite per valutare la sopravvivenza e la funzionalità del neurone DA, come la produzione di dopamina e l'attività elettrofisiologica. Complessivamente, questo protocollo fornisce due approcci standardizzati e accurati basati sulle cellule staminali per generare organoidi neurali.

Disclosures

Gli autori non dichiarano interessi finanziari concorrenti.

Acknowledgments

Gli autori ringraziano la Ligue Genevoise Contre le Cancer (Geneva, Svizzera), la Fondazione ISREC (Losanna, Svizzera) e la Clayton Foundation for Research (Houston, TX, USA) per il sostegno finanziario. Inoltre, gli autori ringraziano HES-HO e il Wyss Center per il sostegno finanziario. Ringraziamo il laboratorio del Krause per le discussioni e il supporto utili e il dottor Halah Kutaish per la correzione delle bozze.

Materials

Name Company Catalog Number Comments
6-well plate (6-well plate) Falcon / Corning 07-201-588
ABI Prism 7900 HT detection system  (Real-Time PCR detection systems) Applied Biosystems Discontinued
Aggrewell 400 (Microwell culture plates ) StemCell Technologies 34421
Amplifier (W2100-HS32)  (Amplifier) Multi Channel Systems
Anti-EGFR (phospho Y1101) antibody Abcam ab76195 1/100 dilution
Anti-GFAP Antibody Dako  Z334  1/1000 dilution
Anti-Nestin, Human Antibody Millipore  ABD69  1/400 dilution
Anti-Synapsin I Antibody Chemicon  AB1543P  1/500 dilution
B27 supplements (B27) Life Technologies / Invitrogen 1238 For both protocol, stock solution 100x, final solution 1x
Brain-derived neurotrophic factor  (BDNF) Cell Guidance GFH1-2 For both protocol,  stock solution 100 µg/mL in pure H2O, final solution 20 ng/mL
CHIR-99021 (GSK-3β inhibitor ) Axon Medchem ct99021 For Dopaminergic protocol,  stock solution 7.5 mM in DMSO, final solution 3 µM
Compound E a γ–secretase inhibitor (γ–secretase inhibitor) Calbiochem CAS 209986-17-4 For both protocol (gamma-secretase inhibitor XXI),  stock solution 5 mM in DMSO, final solution 1 µM
Coulochem III  (Coulometric detector parameters) Thermo scientific
Dibutyryl cyclic-AMP (Dibutyryl cAMP) Sigma D0627 For Dopaminergic protocol,  stock solution 0.5 M in DMSO, final solution 0.5 mM
Dimethyl Sulfoxide Pure (DMSO) Sigma-Aldrich C6164 Compounds solvent, ready to use
Dulbecco's Modified Eagle Medium (DMEM) Life Technologies 12491-015 For cell culture, ready to use
Dulbecco's Modified Eagle Medium Mixture F-12 (DMEM-F12) Gibco 11320033 For cell culture, ready to use
EDTA 0.1 mM (EDTA) Life Technologies AM9912 For cell culture, ready to use
Epidermal Growth Factor (EGF) Gibco PHG0313 For GIC culture,  stock solution 100 µg/mL in pure H2O, final solution 10 ng/mL
Fibroblast Growth Factor 20 (FGF20) Peprotech 100-41 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 5 ng/mL
fibroblast growth factor 8  (FGF8) Peprotech GFH176-5 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 100 ng/mL
Fibroblast growth factor-basic (bFGF) Gibco PHG0024 For GIC culture,  stock solution 100 µg/mL in pure H2O, final solution 10 ng/mL
G5 supplements (G5) Invitrogen 17503012 For GIC culture, stock solution 100x, final solution 1x
Glial cell-derived neurotrophic factor (GDNF) Cell Guidance GFH2-2 For both protocol,  stock solution 100 µg/mL in pure H2O, final solution 20 ng/mL
Hydrophilic polytetrafluoroethylene  membrane (PTFE membrane) BioCell-Interface Discontinued
LDN-193189 (BMP inhibitor) Axon Medchem /Stemgen 04-0072-02 /1509 Dual/Smad,  stock solution 5 mM in DMSO, final solution 0.5 µM
L-glutamine (L-glutamine) Gibco 25030081 L-Glutamine (200 mM), stock solution 200 mM, final solution 2 mM
Matrigel (extracellular matrix) BD Biosciences 354277 hESC-qualified Matrix, stock solution 18-22 mg/mL, final solution 180-220 µg/mL
Millicell-CM Culture plate insert  (0.4 µm) (Culture plate insert) Millipore PICM03050
Monoclonal Anti-β-Tubulin III antibody Sigma  T8660  1/1000 dilution
MS Orbital Shaker, MS-NOR-30 (Orbital shaker) Major Science MS-NRC-30
N2 supplements (N2) Invitrogen 17502-048 For GIC culture, stock solution 100x, final solution 1x
Nanodrop (Nanodrop) Thermo Fisher Scientific Discontinued
Neurobasal (Neurobasal) Life Technologies / Gibco 21103049 Maintenance and maturation embryonic neuronal cell populations , ready to use
Non-Essential Amino Acids  (NEAA) Gibco 11140 Non-essential Amino Acids 100X, stock solution 100x, final solution 1x
Nurr1 Antibody (M-196) Santa Cruz Sc-5568 1/100 dilution
Nutristem  (hESC medium ) Biological Industries 05-100-1A Stem cell media, ready to use
Penicilin / Streptomycin  (Penicilin / Streptomycin ) Life Technologies / Gibco 15140122 For cell culture, stock solution 5 mg/mL, final solution 50 µg/mL 
Perchloric acid 0.1N (HCLO4) Merck 100519 For HPLC, ready to use
Phosphate Buffered Saline without Ca2+/Mg2+  (PBS without Ca2+/Mg2+ ) Life Technologies 14190250 For cell culture, ready to use
PrimeScript RT-PCR Kit (Reverse transcription kit) Takara RR014A
Purmorphamin (smoothened agonist) Calbiochem SML0868 For Dopaminergic protocol,  stock solution 10 mM in DMSO, final solution 2 µM
Rho-associated Kinase Y-27632 (ROCK) Abcam Biochemicals ab120129-1 Rock Inhibitor,  stock solution 50 mM in DMSO, final solution 10 µM
RNeasy mini kit (RNA extraction kit ) Qiagen 74104
SB-431542 (TGFβ/Activin/Nodal inhibitor ) Ascent Asc- 163 Dual-Smad,  stock solution 50 mM in DMSO, final solution 10 µM
Sonic Hedgehog (SHH) Cell Guidance GFH168-5 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 100 ng/mL
StemPro Accutase (hESC enzymatic solution) Gibco A11105-01 hESC enzymatic solution, ready to use
Symmetry C-18,5 mm (4.6 150mm2)  (Reversed-phase column) Waters Corporation
T150 flask (T150 flask) Falcon 08-772-1F
TH Antibody (F-11) Santa Cruz Sc-25269 1/200 dilution
Transforming Growth Factors beta 3 (TGFβ3) Cell Guidance GFH109-2 For Dopaminergic protocol,  stock solution 100 µg/mL in pure ethanol , final solution 1 ng/mL
Trichostatine A (inhibitor of histone deacetylase ) Sigma T8552 For Dopaminergic protocol,  stock solution 100 µM in DMSO, final solution 20 nM
TrypLE (recombinant enzymatic solution) Invitrogen 12604021 recombinant enzymatic solution, ready to use
Trypsin 0.25% (enzymatic solution) Life Technologies 15050065 enzymatic solution, ready to use
W2100, Multi Channel Systems (Data acquisition system ) WAT045905
X-vivo (serum free medium) Lonza BE04-743Q serum free medium, ready to use

DOWNLOAD MATERIALS LIST

References

  1. Louis, D. N., et al. The 2016 World Health Organization Classification of Tumors of the Central Nervous System: a summary. Acta Neuropathologica. 131, (6), 803-820 (2016).
  2. Stupp, R., et al. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. New England Journal of Medicine. 352, (10), 987-996 (2005).
  3. Daphu, I., et al. In vivo animal models for studying brain metastasis: value and limitations. Clinical and Experimental Metastasis. 30, (5), 695-710 (2013).
  4. Huszthy, P. C., et al. In vivo models of primary brain tumors: pitfalls and perspectives. Neuro Oncology. 14, (8), 979-993 (2012).
  5. Nayernia, Z., et al. The relationship between brain tumor cell invasion of engineered neural tissues and in vivo features of glioblastoma. Biomaterials. 34, (33), 8279-8290 (2013).
  6. Cosset, E., et al. Human tissue engineering allows the identification of active miRNA regulators of glioblastoma aggressiveness. Biomaterials. 107, 74-87 (2016).
  7. Pringsheim, T., Jette, N., Frolkis, A., Steeves, T. D. The prevalence of Parkinson's's disease: a systematic review and meta-analysis. Movement Disorders. 29, (13), 1583-1590 (2014).
  8. Rajput, A. H., et al. Globus pallidus dopamine and Parkinson's motor subtypes: clinical and brain biochemical correlation. Neurology. 70, (16 Pt 2), 1403-1410 (2008).
  9. Jellinger, K. A. Pathology of Parkinson's's disease. Changes other than the nigrostriatal pathway. Molecular and Chemical Neuropathology. 14, (3), 153-197 (1991).
  10. Bernheimer, H., Birkmayer, W., Hornykiewicz, O., Jellinger, K., Seitelberger, F. Brain dopamine and the syndromes of Parkinson’s and Huntington. Clinical, morphological and neurochemical correlations. Journal of Neurological Science. 20, (4), 415-455 (1973).
  11. Tieng, V., et al. Engineering of midbrain organoids containing long-lived dopaminergic neurons. Stem Cells and Development. 23, (13), 1535-1547 (2014).
  12. Chen, C. S. 3D Biomimetic Cultures: The Next Platform for Cell Biology. Trends in Cell Biology. 26, (11), 798-800 (2016).
  13. Friedl, P., Sahai, E., Weiss, S., Yamada, K. M. New dimensions in cell migration. Nature Reviews Molecular Cell Biology. 13, (11), 743-747 (2012).
  14. Byers, B., et al. SNCA triplication Parkinson's's patient's iPSC-derived DA neurons accumulate alpha-synuclein and are susceptible to oxidative stress. PLoS ONE. 6, (11), e26159 (2011).
  15. Flierl, A., et al. Higher vulnerability and stress sensitivity of neuronal precursor cells carrying an alpha-synuclein gene triplication. PLoS ONE. 9, (11), e112413 (2014).
Organidi neurali umani per lo studio del cancro al cervello e delle malattie neurodegenerative
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Cosset, E., Locatelli, M., Marteyn, A., Lescuyer, P., Dall Antonia, F., Mor, F. M., Preynat-Seauve, O., Stoppini, L., Tieng, V. Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases. J. Vis. Exp. (148), e59682, doi:10.3791/59682 (2019).More

Cosset, E., Locatelli, M., Marteyn, A., Lescuyer, P., Dall Antonia, F., Mor, F. M., Preynat-Seauve, O., Stoppini, L., Tieng, V. Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases. J. Vis. Exp. (148), e59682, doi:10.3791/59682 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter