Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Стволовые клетки- производные вирусные Ag-специфические T Лимфоциты подавить HBV репликации у мышей

doi: 10.3791/60043 Published: September 25, 2019

Summary

Представлен протокол для эффективного подавления вируса гепатита В (HBV) репликации у мышей с помощью приемной передачи клеток (ACT) стволовых клеток полученных вирусных антигенов (Ag)-специфических Т-лимфоцитов. Эта процедура может быть адаптирована для потенциальной аСТ на основе иммунотерапии HBV инфекции.

Abstract

Инфекция, связанная с вирусом гепатита В (HBV), является глобальной проблемой здравоохранения. С более чем 350 миллионов людей, пострадавших во всем мире, HBV инфекции остается ведущей причиной рака печени. Это вызывает серьезную озабоченность, особенно в развивающихся странах. Неспособность иммунной системы смонтировать эффективный ответ против HBV приводит к хронической инфекции. Хотя вакцина против ог. ВГВ присутствует и создаются новые противовирусные препараты, искоренение вирусно-резервуарных клеток остается одной из основных тем для здоровья. Описано здесь метод для генерации вирусного антигена (Ag) -специфические CD8и цитотоксические Т-лимфоциты (CtL), полученные из индуцированных плюрипотентных стволовых клеток (iPSCs) (т.е. iPSC-CTL), которые имеют возможность подавлять репликацию HBV. Репликация HBV эффективно индуцируется у мышей через гидродинамический инъекций плазмиды экспрессии HBV, pAAV/HBV1.2, в печень. Затем, HBV поверхности Ag-специфической мыши iPSC-CTLs являются приемно переданы, что значительно подавляет репликации HBV в печени и крови, а также предотвращает HBV поверхности Ag выражение в гепатоцитов. Этот метод демонстрирует репликацию HBV у мышей после гидродинамических инъекций и что стволовые клетки, полученные вирусных Ag-специфических CTL может подавить репликацию HBV. Этот протокол предоставляет полезный метод иммунотерапии HBV.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

После острой инфекции адаптивная иммунная система (т.е. гуморальный и клеточный иммунитет) контролирует основную часть острого гепатита, связанного с ВГВ. Тем не менее, ряд людей в Эндемичных регионах HBV не могут устранить вирусы и впоследствии преобразовать в качестве хронических лиц. Более 25% хронических пациентов (250 миллионов человек) во всем мире развивают прогрессирующее заболевание печени, в результате чего цирроз печени и/или гепатоцеллюлярной карциномы (HCC)1. В результате искоренение настойчивых инфицированных клеток остается общей проблемой здоровья, несмотря на то, что имеется вакцина2 и в настоящее время разрабатывается множество противовирусных препаратов. Стандартное лечение HBV-инфекции включает в себя аналоги ИФН-З, нуклеозида и нуклеотида. Эти агенты обладают непосредственной противовирусной активностью и иммуномодулирующими способностями. Тем не менее, сероконверсия HBe антигена (Ag)- носители антител (Ab) и потеря сывороточной дезоксирибонуклеиновой кислоты (ДНК) появляются индивидуально примерно у 20% пациентов, а также весь иммунологический контроль вируса проверено лишением HBsAg составляет не более 5%3. Кроме того, реакция на лечение часто не является прочной. Профилактическая вакцинация с помощью рекомбинантных HBs Ag очень эффективна в профилактике инфекции, но терапевтическая вакцинация HBs Ag неэффективна. Очевидно, что При опосредованный Т-клеточными иммунными реакциями играет решающую роль в борьбе с инфекцией ВГВ и нарушением функции печени; однако, в хронических больных гепатитом, HBV-реактивные Т-клетки часто удаляются, дисфункциональные, или конвертировать исчерпаны4,5,6. Следовательно, у людей с постоянной инфекцией ВГВ не удалось ни одного попытки восстановить иммунитет, специфический вХВ (т.е. Т-клеточный иммунитет) с помощью противовирусного средства, иммуномодулирующих цитокинов или лечебной иммунизации.

Приемная передача клеток (ACT) HBV Ag-специфических Т-клеток является эффективным лечением, направленным на то, чтобы в конечном итоге искоренить оставшиеся гепатоциты wih HBV7,8. ACT HBV-специфических CTLs в HBV-инфицированных мышей было показано, что причиной переходного, легкого гепатита, и резкое падение ВГВ рибонуклеиновой кислоты (РНК) стенограммы в гепатоцитов. В этих исследованиях, CTLs не ингибировать транскрипцию генов HBV но усилил деградацию транскриптов HBV9. HBV-специфических CTL важны для предотвращения вирусной инфекции и посредничать в очистке HBV10,11. Для ACT основе средств правовой защиты, in vitro расширение HBV-специфических Т-клеток с высокой реактивностью для переселения in vivo было предложено быть идеальным методом12,13,14; тем не менее, нынешние подходы ограничены в отношении их способности генерировать, отделять и расти соответствующие количества и качества HBV-специфических Т-клеток от пациентов для потенциальных методов лечения.

Хотя клинические испытания представляют безопасность, осуществимость и перспективную терапевтическую активность клеточного лечения с помощью инженерных Т-клеток, которые специфичны для Инфицированных вирусом ВпГ гепатоцитов, есть опасения по поводу неблагоприятных последствий происходящих из аутоиммунных реакций из-за перекрестной реактивности от неправильного T-клеточного рецептора (TCR)15,16, вне целевого распознавания Ag неспецифическим TCR17 и на цель вне токсичности химерных рецепторов Ag (CAR) 18 лет , 19 со здоровыми тканями. В настоящее время генетически модифицированные Т-клетки, которые имеют только краткосрочную стойкость in vivo, обычно являются промежуточными или более поздними Т-клетками. На сегодняшний день, плюрипотентные стволовые клетки (PSCs) являются единственным источником для создания большого количества наивных однотипных Ag-специфических Т-клеток20,21,22,23. Индуцированные ПЦ (iPSCs) просто преобразуются из соматических клеток пациента с помощью трансдукции генов нескольких транскрипционных факторов. В результате, iPSCs имеют те же характеристики, как у эмбриональных стволовых клеток (ESCs)24. Благодаря гибкости и возможности для бесконечной способности к самообновлению, в дополнение к замене тканей, iPSC основе лечения могут быть широко применены в регенеративной медицине. Кроме того, полки, лежащие в основе iPSCs, могут существенно улучшить текущую клеточную терапию.

Общая цель этого метода заключается в генерации большого количества HBV-специфических CtLs из iPSCs (т.е. iPSC-CTLs) для иммунотерапии на основе АКТ. Преимущества по сравнению с альтернативными методами в том, что HBV-специфические iPSC-CTL имеют однотипный TCR и наивный фенотип, что приводит к большему развитию Т-клеток памяти после ACT. Показано, что ACT HBV-специфических iPSC-CTLs увеличивает миграцию функциональных CD8и Т-клеток в печени и уменьшает репликацию HBV как в печени, так и в крови управляемых мышей. Этот метод показывает потенциальное использование вирусных Ag-специфических iPSC-CTL для иммунотерапии HBV и может быть адаптирован для генерации других вирусных Ag-специфических iPSC-T-клеток для вирусной иммунотерапии.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Все эксперименты на животных одобрены Комитетом по уходу за животными Техасского университета (IACUC; #2018-0006) и проводятся в соответствии с руководящими принципами Ассоциации по оценке и аккредитации лабораторных животных. Мыши используются в возрасте 6-9 недель.

1. Поколение вирусных AG-специфических CD8и Т-клеток из iPSCs (iPSC-CD8и Т-клетки)

  1. Создание ретровирусных конструкций
    ПРИМЕЧАНИЕ: TCR и гены связаны с 2A самостоятельной последовательности. Ретровирусный вектор MSCV-IRES-DsRed (MiDR) dsRedNo 23.
    1. Суб-клон HBs183-191 (FLLTRILTI) конкретных A2-ограниченный человек-мурнина гибридных TCR (s183 TCR) генов (ВЗ34 и ВЗ28) в MiDR для создания s183 MiDR построить (Рисунок 1A)25.
  2. Ретровирная трансдукция
    ПРИМЕЧАНИЕ: Платиновые-E (Plat-E) клетки используются для упаковки ретровирусов (несущих s183 TCR генов), которые будут использоваться для ретровирусной трансдукции. Клетки Plat-E являются эффективными ретровирусными упаковочными клетками, лежащими в основе 293T-клеток, которые были разработаны с помощью уникальных упаковочных конструкций с помощью промотора EF1, чтобы выразить ретровирусную структуру белка, включая кляп, поль и экотропный env.
    1. На 100 мм культуры блюдо, семена 3 х 106 Plat-E клеток в 8 мл DMEM культуры среды, содержащей 10% плода икроножной сыворотки (FCS) в инкубаторе на 37 градусов по Цельсию с 5% CO2, 1 день до трансфекции.
    2. На день 0, transfect s183 MiDR построить в Клетки Plat-E с помощью реагента трансфекционного25ДНК .
    3. На 1-й день, семена 1 х 106 iPSCs (GFP)в желатин предварительно покрытием культуры пластины.
    4. В дни 2-3, собирать ретровирусы, содержащие супернатант из культуры клеток Plat-E, чтобы преобразовать iPSCs с s183 TCR в присутствии 1,6-дибромохексан решение25.
    5. На 4-й день, trypsinize s183 TCR ген-транскорпорированных iPSCs, центрифуга на 400 х г в течение 5 мин и семян 3 и 105 iPSCs в 100 мм культуры блюдо предварительно покрытием с 3 х 106 облученных SNL76/7 (irSNL76/7) кормушки25.
    6. На 5 или 6 день слияния, трипсинизовать клетки, центрифуга на 400 х г в течение 5 минут и процесс для сортировки клеток. Гатинг на живых клетках, сортировать GFP и DsRED двойных положительных клеток (s183 TCR ген-трансиндуированных iPSCs) с помощью высокоскоростного сортировки клеток. Как и шаг 1.2.5, совместной культуры отсортированных ячеек на irSNL76/7 фидерных ячеек для будущего использования25.
  3. Дифференциация HBV-специфических iPSC-CD8- Т-клеток
    ПРИМЕЧАНИЕ: OP9-DL1/DL4 стромальные клетки переэкспрессируют как Нотч лиганды DL1 и DL4, и совместное культивирование iPSCs с iPSCs может способствовать Нотч сигнализации опосредоченных T-клеточная дифференциация26.
    1. Выращивайте s183 TCR генно-трансиндуированные iPSCs (s183/iPSCs) в монослойе клеток OP9-DL1-DL4 в средствах массовой информации, содержащей 20% сыворотки крупного рогатого скота плода (FBS)27. Включите в культуру лиганд murine Flt3 (mFlt-3L; окончательная концентрация 5 нг/мл).
    2. На 0 день, семена 0,5-1,0 х 105 S183/iPSCs в 10 см культуры блюдо ранее выросли с OP9-DL1-DL4 клеток. Проверка того, что op9-DL1-DL4 клетки находятся в состоянии 80%-90% выпуклость.
    3. На день 5, промыть iPSCs с 10 мл фосфат-буферного солованого раствора (PBS), аспирот от PBS, добавить это к 4 мл 0,25% трипсин, и инкубировать в инкубаторе 37 кС в течение 10 мин. После этого, добавить дополнительные 8 мл iPSC средств массовой информации до конца digestion. Накопить все пищеварительные растворы, содержащие клетки и центрифуги на 400 х г в течение 5 мин при 15-30 градусов по Цельсию.
    4. Аспирируй сверхнатант и оттачивай клетки в 10 мл iPSC-носителей. Перенесите суспензию клетки на новую 10-сантиметровую пластину Петри и инкубатор в инкубаторе в течение 30 мин при 37 градусах Цельсия.
    5. После 30 минут соберите медиаi-носители, содержащие плавающие ячейки. Передайте суспензию клетки через 70 мкм ячейки ситечко и вычислить номер ячейки.
    6. Семена 5 х 105 5 клеток в культуре блюдо ранее выросли OP9-DL1-DL4 клеток с условием 80%-90% слияния, как описано в шаге 1.3.1.
      ПРИМЕЧАНИЕ: Для дифференциации Т-клеток, каждые 2-3 дня, iPSC полученных клеток необходимо повторно семян со свежим слоем OP9-DL1-DL4 клеток.
  4. Оценки
    1. Морфологические изменения дифференциациационных iPSCs
      1. Наблюдайте клетки под микроскопом в разные дни.
        ПРИМЕЧАНИЕ: На 5-й день, колонии имеют мезодер-подобные характеристики, демонстрируя классическую морфологию шпинделя, напоминающую человеческие кожные фибробласты и устойчивый рост в пробирке. К 8-му дню начинают появляться небольшие круглые скопления клеток.
    2. Анализ дифференциирования iPSCs по цитометрии потока
      1. В различные дни совместной культуры, анализiруем клетки, полученные из iPSC, как описано ранее25 (рисунок 1B,C).
    3. Функциональный анализ дифференциационирования iPSCs
      1. На 28-й день совместной культуры, собирать iPSC-CD8и Т-клетки из культур через сбор плавающих клеток, trypsinize оставшихся клеток с 0,25% трипсин, повторно приостановить в 8 мл iPSC средств массовой информации, центрифуга в течение 5 мин при 400 х г при 15-30 С, удалить средства массовой информации, затем повторно приостанавливает сяки в 10 мл носителей.
      2. Держите повторно подвешенные клетки в свежей 10-сантиметровой тарелке в инкубаторе 37 градусов по Цельсию в течение 30 минут и соберите плавающие клетки. Затем промыть клетки один раз с холодной PBS.
      3. Инкубировать 3 х 106 Т-клеточных спленоцитов (CD4-CD8-) из селезенки H-2 класса I нокаут, HLA-A2.1-трансгенных (HHD) мышей с 5 ММ s183 пептида (FLLTRILTI) в 200 qL средств массовой информации при 4 кС в течение 30 минут.
      4. Производить смесь iPSC-CD8и Т-клеток с спленоцитами, пульсированными с пептидом s183 (Т-клетки: спленоциты 1:4; используйте 0,75 x 106 Т-клеток). Инкубировать смесь клеток при 37 градусах Цельсия в инкубаторе CO2 на 40 ч. В течение последних 7 ч, добавить 4 л разбавленного брефельдина А в культуру (окончательная концентрация 1000x, которая будет разбавлена в 1x культуры средств массовой информации), чтобы блокировать транспортные процессы во время активации клеток.
      5. Пятно клеток и выполнять поток цитометрический анализ внутриклеточного IFN-З, как описано ранее(Рисунок 2).

2. Индукция репликации HBV через гидродинамическую доставку плазмида HBV

ПРИМЕЧАНИЕ: pAAV/HBV1.2 конструкция была создана, как описано ранее9. Полная ДНК HBV 1.2 включена в векторный ПААВ.

  1. Гидродинамические поставки плазмида HBV через хвостовую вену
    1. Тепло HHD мышей с помощью тепловой лампы в течение 5 минут в клетке для того, чтобы раскидывать хвоствены.
    2. Задержите животное с помощью удерживающего средства, и чистые мышиные хвосты с 70% этанол овый спрей.
    3. Доставка плазмиды в печень.
    4. Измерьте вес тела мыши с помощью измерительной шкалы.
    5. Разбавить 10 мкг плазмида HBV в 8% эквиваленте массы тела PBS (например, 1,6 мл для 20 г мыши). Загрузите разбавленную плазмид в 3 мл шприца с подкожной иглой 26 G и 1и2" (0,45 и 12 мм).
    6. Найдите одну из двух боковых хвостовых вен в средней трети хвоста и поместите иглу в боковую вену. Администрирование инъекции, содержащей плазмид HBV через хвостовую вену в течение 3 - 5 с.
  2. Количественная оценка виремии из сыворотки крови инфицированных мышей
    ПРИМЕЧАНИЕ: Репликация HBV происходит с 3-35-го дня в сыворотке мыши. Репликация ДНК достигает пика на 7-й день и постепенно уменьшается. ДНК HBV не очищается от сыворотки до 35-го дня.
    1. Сбор сыворотки крови у инфицированных мышей
      1. Соберите около 0,1 мл крови в микроцентрифуговой трубке от каждой мыши на 3, 5, 7 и 10 дней после инфекции ретро-орбитальным кровотечением в микроцентрифуге объемом 1,5 мл, затем инкубировать при комнатной температуре (РТ) в течение 20 мин.
      2. Centrifuge образец на 6000 х г в течение 15 мин при 4 кв и собирать сыворотки супернатант после центрифугации.
    2. Очистите ДНК из сыворотки крови с помощью коммерчески доступного комплекта для извлечения ДНК в соответствии с рекомендациями производителя. Кратко, lyse клетки в кремнезема основе колонки, выполнять мойки, и извлечь ДНК, добавив 100% этанола в столбец elution и центрифугии на 6000 х г в течение 1 мин. Утматировать ДНК в 50 ЗЛ без RNase воды.
    3. Используйте 100 нг ДНК HBV из elution для анализа ПЦР в режиме реального времени. Используйте следующие грунтовки и зонды: вперед 5' TAGGAGGCTGTAGGCATAATTGG 3'; обратный 5' GCACAGCTTGGAGGCTTGT3'; зонд 5' TCACCTCTCTCTAATC 3'.
      1. Используйте геном HBV, содержащий плазмид (pAAV/HBV1.2) для стандартной кривой и выполняйте ПЦР в реальном времени в общем объеме 10 КЛ(рисунок 3).
    4. Настройка реакции ПЦР в общем объеме 10 Зл, как показано в таблице 1.
    5. Настройка программы ПЦР в термоцикле, как показано в таблице 2. Запрограммированный температурный переходный курс составляет 20 градусов по Цельсию/с для денатурации/аннулирования и 5 градусов по Цельсию/с для расширения. Измерьте флуоресценцию в конце фазы аннулирования для каждого цикла для мониторинга ПЦР в режиме реального времени.

3. Уменьшение репликации HBV АКТ вирусных Ag-специфических iPSC-CD8и Т-клеток

  1. Приемная передача клеток (ACT)
    1. Дифференцируйте s183/iPSCs (1.3.7) на стромальных ячейках OP9-DL1-DL4 в присутствии mFlt-3L и mIL-7 в течение 8 дней, как описано в разделе 1.3.
    2. На 22-й день соберите iPSC-CD8и Т-клетки из 10 см пластины с трипсином, затем промойте и переприкосите каждую тарелку по 10 см в 10 мл свежих носителей. Добавьте клетки в свежую 10-сантиметровую тарелку и вернитесь в инкубатор на 30 мин, как это делается в разделе 1.3. После 30 минут, собирать плавающие клетки.
    3. Используйте 70 мм нейлона ситечор передать клетки для устранения клеточных кластеров и подсчитать число клеток. Адаптировать клетки к концентрации 1,5 х 107 клеток / мл в холодном растворе PBS и использовать 70 мкм нейлона ситечко пройти клетки для устранения клеточных кластеров снова, если это необходимо. Храните клетки на льду до ACT.
    4. Введите 200 суспензий клеток (3 х 106 клеток) в 4-6 недельных hHD мышей через хвоствены.
  2. Индукция репликации HBV
    1. На 14 день после передачи клеток, выполнять гидродинамические поставки HBV плазмид через хвоственную вену, как описано в разделе 2.1.
  3. Обнаружение вируса белка из инфицированной печени
    1. Пожертвование мышей на 3, 5, 7, 14 и 21 после инфекции. Для эвтаназии, в каждой клетке, используйте 1-2 л углекислого газа (CO2) на первом этапе. Когда животное развивается потеря сознания, получить скорость потока CO2 около 4-5 л / мин. Выполните эвтаназии мыши с использованием CO2 ингаляции.
    2. Отделить печень, разрезая поверхностную кожу перитонеума с использованием ножниц и щипцы и слегка перетаскивания печени обратно, чтобы раскрыть внутреннюю кожу подкладка перитонеальной полости. Соберите и разрезайте образцы печени (длина х ширина х высота 0,5 см х 0,5 см X 0,3 см) инфицированных мышей, чтобы легко вписаться в встраивающую кассету и заблокировать в 10% нейтральный буфер формалина для 4-24 ч.
    3. Декальцифифицировать образцы печени, используя 2,5 М формической кислоты; промыть ксиленом в течение 3 мин, промыть 2x в 100% этанола, промыть 2x в 95% этанола, промыть 2x в деионизированной (DI) воде в течение 2 мин, затем декальцифицировать образцы печени в 1 мМ этилэндениатететраацекислоты (EDTA) соответственно. Ручка при температуре под кипячения (90 градусов по Цельсию) в течение 20 мин.
    4. Охладите фиксированные ткани печени в течение 30 мин. Промыть ткани с 1x PBS в течение 4 мин и вставлять ткани в парафин. Обезвоживать ткани в серии увеличения концентрации этанола, чтобы заменить воду, а затем погрузить в ксиленовый погружения. Встраивайте проникнутые ткани в восковые блоки. Сделать равномерно вертикальное и горизонтальное сечение для окрашивания. Подготовьте 4 мкм секции с раздвижным микротомом.
    5. Передайте секции через депарафинизацию и регидратацию с использованием ксилена и этанола, а затем выполнить иммунофлуоресцентное окрашивание секций.
    6. Пятно разделов с 200 л поверхности HBV Ag-специфических антител (1:100 разбавления в блокирующем растворе). Инкубировать секции с антителами для 2 ч на RT в 75%-100% увлажненной камере, и мыть 5x в 1x PBS в течение 5 мин.
    7. Используйте анти-увядание реагент, содержащий 4',6-диамидино-2-фенилиндинол (DAPI) для ядерного окрашивания для противодействия пятна слайдов. Добавьте крышку с около 300 юанем разбавленного раствора окрашиваемого DAPI (300 нм в 1x PBS) и проверь весь покрывало покрыто. Держите слайды в темноте при 4 градусах Цельсия до осмотра под флуоресцентным микроскопом.
  4. Воспалительная инфильтрация клеток у инфицированных мышей
    1. Пожертвование мышей, как описано в шаге 3.3.1. Соберите печень и сделать разделы, как описано в шаге 3.3.4.
    2. Пятно сечение с гематоксилин и эозин (H и E) для оценки проникновения воспалительных клеток в печень.
    3. Храните слайды в темноте при 4 градусах Цельсия до дальнейшего анализа под флуоресцентным микроскопом.
    4. Визуализируйте слайды под флуоресцентным микроскопом для обнаружения проникновения воспалительных клеток в печень(рисунок 4).
  5. HBV ДНК обнаружения инфицированной печени
    1. Изоляция вирусной ДНК.
    2. Эвтанизировать мышей и собирать образцы печени в соответствии с разделом 3.3.
    3. Лысы ткани печени в Nonindet P-40 (NP-40) лиза буфера (50 мм Tris-HCL, 1 мМ EDTA, 1% NP-40), содержащий коктейль-ингибитор протеазы.
    4. Кратко центрифуги на 16000 х г для удаления ядер и клеточных мусора.
    5. Инкубировать цитоплазмический лизат с микрококковой нуклеазой (нуклея S7; 150 единиц/мл) и CaCl2 (5 мМ) при 37 кВ в течение 90 минут, чтобы деградировать нуклеиновую кислоту вне нуклеокапсидов (NCs).
    6. Инактивируйте нуклеаза S7 путем добавления 10 мМ EDTA.
    7. Осажгите нуклеокапсиды полиэтиленовым гликолем (ПЭГ), нарушить на 0,5% сульфат натрия (SDS) и переварить 0,6 мг/мл протеиназа K (PK) при 37 градусах по Цельсию на 1 ч.
    8. Восстановление вирусных нуклеиевых кислот путем экстракции фенола хлороформа и осадков этанола.
    9. Разрешить извлеченные вирусные ДНК на 1,2% агарозный гель и обнаружить стандартным южным анализом помарки с помощью32 P-маркировки HBV ДНК зонда.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Как показано здесь, HBV вирусных Ag-специфических iPSC-CD8и Т-клетки генерируются системой культуры in vitro. После ACT этих вирусных Ag-специфических iPSC-CD8- Т-клеток существенно подавляют репликацию HBV в модели мурина(Дополнительный файл 1). Мышь iPSC трансумции с MIDR ретровирусной конструкции кодирования человека-мышь гибридный ген HBV TCR (HBs183-191-специфический,s183), то ген-трансиндуцированных iPSCs совместно с OP9-DL1/DL4 клетки, выражающие Нотч ligands (как DL1 и DL4) молекулы в присутствии rFlt3L и rIL-7. На 28 день совместной культуры in vitro, клетки, полученные по iPSC, существенно выражают CD3 и Ag-специфические TCR (T-клеточные маркеры). Цитометрический анализ потока CD3иCD8- населения показывает, что трансдукция HBV TCR резко увеличивает генерацию вирусных s183-специфических CD8и Т-клеток (Рисунок 1).

На 28 день совместной культуры in vitro, CD4-CD8- однозначные (SP) iPSC-CD8- Т-клетки изолированы и стимулируются Т-обедированными спленоцитами, пульсируемыми пептидом s183, и оценивается выработка цитокинов. iPSC-CTL производят большое количество IL-2 и IFN-я, как обнаружено внутриклеточного окрашивания или ELISA (Рисунок 2). HBV инфекция индуцируется в HLA-A2.1 трансгенных (HHD) мышей гидродинамической инъекции 10 мкг pAAV / HBV1.2 ДНК плазмид через хвостовые вены мышей. Репликация HBV обнаруживается с 3-го дня в сыворотке мыши HHD. Репликация ДНК достигает пика на 6-й день и постепенно уменьшается с помощью анализа ПЦР в реальном времени(рисунок 3).

Через две недели после ACT, мышей оспаривается с гидродинамической инъекции pAAV / HBV1.2 ДНК плазмида. Вирусный титр измеряется в режиме реального времени ПЦР из сыворотки в различные точки времени после инъекции. Результаты показывают, что репликация вирусов значительно снижается во всех временных точках у мышей, получающих HBV вирусные Т-клетки Ag-специфических по сравнению с мышами, получающими контрольные клетки(Рисунок 4A). Выражение поверхностного белка HBV также исследуется в печени в вышеуказанной обстановке лечения. Мышей усыпливается в разные дни после инъекции HBV и образцы печени изолированы для гистологического обследования. Образцы окрашены для поверхностного белка HBV и рассмотрены под флуоресцентным микроскопом. HBV поверхностный белок наблюдается как существенно снижается у мышей, получающих HBV вирусных Ag-специфических предварительно iPSC-CTLs, по сравнению с мышами, получающими контрольные клетки (Рисунок 4B). Этот эксперимент ясно показывает, что вирусные Ag-специфические iPSC-CD8и Т-клетки имеют возможность уменьшить репликацию HBV в модели мурина.

Figure 1
Рисунок 1: Поколение HBV вирусных Ag-специфических iPSC-CD8и Т-клеток.
Мыши ные iPSCs трансцируются со следующими ретровирусными конструкциями: HBs183-91 TCR (MiDR-s183 TCR) или OVA257-264 TCR (MiDR-OVA TCR), а трансиндуцированные iPSCs совместно культивируются с стромальными клетками OP9-DL1/DL4 для дифференциации линии T. (A) Схематическое представление ретровирусной конструкции MiDR-s183 TCR, выражающей s183-специфический TCR. Упаковочный сигнал; 2A - пизкорнавирус, самоосвящееся последовательность 2A; LtR - длинный терминал повторяется. (B) Морфология дифференциации Т-клеток в дни 0, 7, 14 и 22. (C)Поток цитометрического анализа для iPSC-производных клеток на 28-й день. Клетки CD3иCD8 (слева) закрыты, как указано и проанализированы для выражения CD8 и TCRV-28 (справа). Показанные данные являются репрезентативными для трех отдельных экспериментов. Значения представляют среднее значение SD (Зп злитро; 0,01; парные t-тесты). Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 2
Рисунок 2: Функциональный анализ HBV вирусных Ag-специфических iPSC-CD8и Т-клеток.
На 28-й день совместной культуры in vitro сортируются sp CD8s183TCR pentamer- iPSC-T-клетки. Клетки iPSC-T и CD8и Т-клетки, трансцированные с помощью MiDR-s183 TCR, стимулируются Т-обедированными спленоцитами (АПК) от hHD мышей и пульсируют пептидом s183 (FLLTRILTI). (A) Внутриклеточное окрашивание ИФН-Я после 7 ч (пришвартовано на CD8и клетках) (T/APCs - 1:4). (B) ELISA ifN-я после 40 h. Данные показаны репрезентативны 3 индивидуальных экспериментов. Значения представляют среднее значение SD (n.s., p sgt; 0.05; парные t-тесты). Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 3
Рисунок 3: Индукция репликации HBV у мышей HHD гидродинамическим впрыском.
HHD мышей i.v. администрируется с плазмид HBV через гидродинамические инъекции хвостовой вены. 10 мкг плазмиды вводится с 8% от общей массы тела PBS. На указанные временные моменты после инъекции, сыворотка изолирована от крови и ДНК извлекается для ПЦР в режиме реального времени. Показанные данные являются репрезентативными для трех отдельных экспериментов. Значения представляют среднее значение SD. Данные являются репрезентативными для пяти мышей на группу из трех независимыхэкспериментов. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 4
Рисунок 4: Уменьшение репликации HBV АКТ вирусных Ag-специфических iPSC-CD8и Т-клеток.
HHD мышей i.v. adoptively перенесены с вирусным Ag-специфическим iPSC-CD8и потомками клетки T (на день 22 культуры in vitro) и управляемы с плазмидом HBV на неделе 2 после переноса клетки. (A) Сыворотка HBV копии. В указанные временные точки после инъекции сыворотка изолирована от крови, а ДНК извлекается для анализа ПЦР в режиме реального времени. Показанные данные являются репрезентативными для трех отдельных экспериментов. Значения представляют среднее значение SD. (B) гистология тканей печени. Мышей усыпили на 8-й день после HBV инфекции. Образцы печени изолированы и окрашены для гистологического обследования. Верхняя панель показывает выражение белка HBsAg у инфицированных мышей (IHC окрашивания) и нижней панели показывает воспалительные инфильтрации клеток (HE-окрашивания). Данные представляют пять мышей на группу из трех независимых экспериментов. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Шаблон ДНК 2 мл
Смесь гибридизации ДНК ((Так ДНК-полимераза, буфер реакции ПЦР, 10 мМ MgCl2 и смесь dNTP) 1 мл
25 мМ MgCl2 0,8 мл
0,3 мкм зонда 3 мл
5 км от каждой грунтовки 3,2 мл
Общая 10 мл

Таблица 1: Объем реакции ПЦР

Температура Время
Денатурация 95 кв. c 5 с
Отжига 53 кк с 10 с
Расширение 72 кк с 20 с
5 кк с

Таблица 2: Программа ПЦР

Дополнительный файл 1: Пожалуйста, нажмите здесь, чтобы загрузить этот файл.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Этот протокол представляет собой метод для создания вирусных Ag-специфических iPSC-CTLs для использования в качестве ACT для подавления репликации HBV в модели murine. При хронической инфекции HBV вирусный геном образует стабильную мини-хромосому, ковалентно закрытую круговую ДНК (cccDNA), которая может сохраняться на протяжении всей жизни гепатоцита. Ориентация на очистку вирусной мини-хромосомы может привести к излечению хронической инфекции HBV. Текущая противовирусная терапия нацелена на обратную транскриптаза вируса, но редко устанавливает иммунологический контроль над репликацией ВГВ, управляемой cccDNA. HBV-специфические CD8и CTL могут посредничать умерщвлять зараженных гепатоцитов и ускорять расчистку cccDNA. Тем не менее, HBV-специфических CTL удаляются, дисфункциональные, или поддаются истощению у пациентов с хронической инфекцией ВГВ. ACT с HBV-специфических CTLs является благоприятным для лечения хронической инфекции ВГВ28,29. Наивная или центральная память Т-клеток, полученных Т-лимфоцитами (т.е. высокореактивные иммунные клетки) являются идеальными эффекторами для терапии на основе АКТ из-за их большой пролиферации, более низкой тенденции к смерти по сравнению с неизлечимо дифференцированными клетками, и отличными способность реагировать на гомеостатические цитокины. Однако такая АКТ зачастую оказывается неосуществимой из-за трудностей с получением достаточного количества КТЛ от пациентов. Ранее было показано, что перепрограммирование Ag-специфических CTLs илиT-регов от iPSCs может быть использовано для клеточной терапии20,23,27,30. Этот доклад демонстрирует метод для генерации вирусных Ag-специфических iPSC-CTLs и использовать эти клетки для АСТ на основе иммунотерапии в модели murine репликации HBV.

Хотя существуют трансгенные мышиные модели репликации HBV, эти модели являются сложными, поскольку центральная толерантность, индуцированная трансгенными генными продуктами, заставляет мышей быть невосприимчивыми к HBV Ags. Кроме того, трансгенные мыши не подходят для мониторинга вирусного зазора, так как интегрированный геном HBV сохраняется в каждой клетке мыши31,32. Кроме того, несмотря на то, что успешные вакцины были разработаны для профилактики инфекции, лечение или иммунотерапия после Инфекции ВГВ не была разработана. Кроме того, экспериментальные подходы к патогенеза ВГВ были затруднены, поскольку диапазон инфекции HBV ограничен мужчинами и шимпанзе, а система культуры in vitro для распространения HBV недостаточна. CD8- Т-клетки являются перспективными клетками-эффекторами против различных типов вирусной инфекции; однако, ответ Т-клеток против HBV не в изобилии. Причиной могут быть специфичность, функционирование и отсутствие достаточного количества для установки иммунного ответа. Этот отчет показывает метод гидродинамической инъекции, который эффективно индуцирует репликацию HBV у мышей. Метод позволяет доставлять большое количество плазмида HBV непосредственно в печень. Модель проявляет непрерывную виремию в течение более 8 недель с обнаружением HBV mRNA, белка и ДНК в разные дни после инъекции. Этот метод для репликации HBV у мышей полезен для иммунотерапии HBV.

Таким образом, репликация HBV была успешно индуцирована у мышей с помощью процедуры гидродинамических инъекций, и вирусные Ag-специфические iPSC-CTL были использованы в качестве иммунотерапии для репликации HBV. Однако существует два ограничения метода: (1) более трех недель дифференциации клеток in vitro T может уменьшить переводческие применения генерируемых Т-клеток для ACT; и (2) Гидродинамический инъекция HBV может эффективно вызвать репликацию HBV в печени; однако, он не образует cccDNA, который является основной причиной стойких инфекции HBV. Тем не менее, метод обеспечивает альтернативный подход для репликации и лечения HBV. Комбинированный режим с использованием анти-HBV препаратов и ACT вирусных Ag-специфических iPSC-CTL, вероятно, приведет к сокращению резервуаров ВИЧ, что приведет к терапии хронической ВИЧ-инфекции.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторам нечего раскрывать.

Acknowledgments

Авторы благодарят д-ра Адама J Геринга из Торонто больницы научно-исследовательский институт для предоставления cDNA для HBs183-91 (s183) (FLLTRILTI) - конкретные A2-ограниченный человек-мурин гибридных генов TCR, и д-р Пей-Джер Чен из Национального университета Тайваня для обеспечения конструкция pAAV/HBV 1.2. Эта работа поддерживается Национальным институтом здравоохранения Грант R01AI121180, R01CA221867 и R21AI109239 до J. S.

Materials

Name Company Catalog Number Comments
HHD mice Institut Pasteur, Paris, France H-2 class I knockout, HLA-A2.1-transgenic (HHD) mice
iPS-MEF-Ng-20D-17 RIKEN Cell Bank APS0001
SNL76/7 ATCC SCRC-1049
OP9 ATCC CRL-2749
pAAV/HBV1.2 plasmid Dr. Dr. Pei-Jer Chen (National Taiwan University Hospital, Taiwan) HBV DNA construct
HBs183-91(s183) (FLLTRILTI)-specific TCR genes Dr. Adam J Gehring (Toronto General Hospital Research Institute, Toronto, Canada) FLLTRILTI-specific A2-restricted human-murine hybrid TCR genes (Vα34 and Vβ28)
OVA257–264-specific TCR genes Dr. Dario A. Vignali (University of Pittsburgh, PA) SIINFEKL-specific H-2Kb-restricted TCR genes
Anti-CD3 (17A2) antibody Biolegend 100236
Anti-CD44 (IM7) antibody BD Pharmingen 103012
Anti-CD4 (GK1.5) antibody Biolegend 100408
Anti-CD8 (53-6.7) antibody Biolegend 100732
Anti-IFN-γ (XMG1.2) antibody Biolegend 505810
Anti-TNF-a (MP6-XT22) antibody Biolegend 506306
α-MEM Invitrogen A10490-01
Anti-HBs antibody Thermo Fisher MA5-13059
ACK Lysis buffer Lonza 10-548E
Brefeldin A Sigma B7651
DMEM Invitrogen ABCD1234
FBS Hyclone SH3007.01
FACSAria Fusion cell sorter BD 656700
Gelatin MilliporeSigma G9391
GeneJammer Agilent 204130
HLA-A201-HBs183-91-PE pentamer Proimmune F027-4A - 27
HRP Anti-Mouse Secondary Antibody Invitrogen A27025
mFlt-3L Peprotech 250-31L
mIL-7 Peprotech 217-17
Nuclease S7 Roche 10107921001
Paraformaldehyde MilliporeSigma P6148-500G Caution: Allergenic, Carcenogenic, Toxic
Permeabilization buffer Biolegend 421002
Polybrene MilliporeSigma 107689
ProLong™ Gold Antifade Mountant with DAPI Invitrogen P36931
QIAamp MinElute Virus Spin Kit Qiagen 57704

DOWNLOAD MATERIALS LIST

References

  1. Scaglione, S. J., Lok, A. S. Effectiveness of hepatitis B treatment in clinical practice. Gastroenterology. 142, (6), 1360-1368 (2012).
  2. Osiowy, C. From infancy and beyond... ensuring a lifetime of hepatitis B virus (HBV) vaccine-induced immunity. Human Vaccines & Immunotherapeutics. 14, (8), 2093-2097 (2018).
  3. Gish, R. G., et al. Loss of HBsAg antigen during treatment with entecavir or lamivudine in nucleoside-naive HBeAg-positive patients with chronic hepatitis B. Journal of Viral Hepatitis. 17, (1), 16-22 (2010).
  4. Kurktschiev, P. D., et al. Dysfunctional CD8+ T cells in hepatitis B and C are characterized by a lack of antigen-specific T-bet induction. Journal of Experimental Medicine. 211, (10), 2047-2059 (2014).
  5. Fisicaro, P., et al. Antiviral intrahepatic T-cell responses can be restored by blocking programmed death-1 pathway in chronic hepatitis B. Gastroenterology. 138, (2), 682-693 (2010).
  6. Schurich, A., et al. The third signal cytokine IL-12 rescues the anti-viral function of exhausted HBV-specific CD8 T cells. PLoS Pathogens. 9, (3), 1003208 (2013).
  7. Gehring, A. J., et al. Engineering virus-specific T cells that target HBV infected hepatocytes and hepatocellular carcinoma cell lines. Journal of Hepatology. 55, (1), 103-110 (2011).
  8. Xia, Y., et al. Interferon-gamma and Tumor Necrosis Factor-alpha Produced by T Cells Reduce the HBV Persistence Form, cccDNA, Without Cytolysis. Gastroenterology. 150, (1), 194-205 (2016).
  9. Huang, L. R., Wu, H. L., Chen, P. J., Chen, D. S. An immunocompetent mouse model for the tolerance of human chronic hepatitis B virus infection. Proceedings of the National Academy of Sciences U.S.A. 103, (47), 17862-17867 (2006).
  10. Wong, P., Pamer, E. G. CD8 T cell responses to infectious pathogens. Annual Review of Immunology. 21, 29-70 (2003).
  11. Murray, J. M., Wieland, S. F., Purcell, R. H., Chisari, F. V. Dynamics of hepatitis B virus clearance in chimpanzees. Proceedings of the National Academy of Sciences USA. 102, (49), 17780-17785 (2005).
  12. Hinrichs, C. S., et al. Adoptively transferred effector cells derived from naive rather than central memory CD8+ T cells mediate superior antitumor immunity. Proceedings of the National Academy of Sciences U.S.A. 106, (41), 17469-17474 (2009).
  13. Hinrichs, C. S., et al. Human effector CD8+ T cells derived from naive rather than memory subsets possess superior traits for adoptive immunotherapy. Blood. 117, (3), 808-814 (2011).
  14. Kerkar, S. P., et al. Genetic engineering of murine CD8+ and CD4+ T cells for preclinical adoptive immunotherapy studies. Journal of Immunotherapy. 34, (4), 343-352 (2011).
  15. Kuball, J., et al. Facilitating matched pairing and expression of TCR chains introduced into human T cells. Blood. 109, (6), 2331-2338 (2007).
  16. van Loenen, M. M., et al. Mixed T cell receptor dimers harbor potentially harmful neoreactivity. Proceedings of the National Academy of Sciences USA. 107, (24), 10972-10977 (2010).
  17. Cameron, B. J., et al. Identification of a Titin-derived HLA-A1-presented peptide as a cross-reactive target for engineered MAGE A3-directed T cells. Science Translational Medicine. 5, (197), (2013).
  18. Fedorov, V. D., Themeli, M., Sadelain, M. PD-1- and CTLA-4-based inhibitory chimeric antigen receptors (iCARs) divert off-target immunotherapy responses. Science Translational Medicine. 5, (215), (2013).
  19. Maus, M. V., et al. T cells expressing chimeric antigen receptors can cause anaphylaxis in humans. Cancer Immunolology Research. 1, (1), 26-31 (2013).
  20. Haque, R., et al. Programming of regulatory T cells from pluripotent stem cells and prevention of autoimmunity. Journal of Immunology. 189, (3), 1228-1236 (2012).
  21. Vizcardo, R., et al. Regeneration of human tumor antigen-specific T cells from iPSCs derived from mature CD8(+) T cells. Cell Stem Cell. 12, (1), 31-36 (2013).
  22. Nishimura, T., et al. Generation of rejuvenated antigen-specific T cells by reprogramming to pluripotency and redifferentiation. Cell Stem Cell. 12, (1), 114-126 (2013).
  23. Lei, F., et al. In vivo programming of tumor antigen-specific T lymphocytes from pluripotent stem cells to promote cancer immunosurveillance. Cancer Research. 71, (14), 4742-4747 (2011).
  24. Kim, J. B., et al. Oct4-induced pluripotency in adult neural stem cells. Cell. 136, (3), 411-419 (2009).
  25. Lei, F., Haque, R., Xiong, X., Song, J. Directed differentiation of induced pluripotent stem cells towards T lymphocytes. Journal of Visualized Experiments. (63), e3986 (2012).
  26. Lei, F., Haque, M., Sandhu, P., Ravi, S., Ni, Y., Zheng, S., Fang, D., Jia, H., Yang, J. M., Song, J. Development and characterization of naive single-type tumor antigen-specific CD8+ T lymphocytes from murine pluripotent stem cells. OncoImmunology. 6, (2017).
  27. Haque, M., et al. Melanoma Immunotherapy in Mice Using Genetically Engineered Pluripotent Stem Cells. Cell Transplantation. 25, (5), 811-827 (2016).
  28. Tan, A. T., et al. Use of Expression Profiles of HBV DNA Integrated Into Genomes of Hepatocellular Carcinoma Cells to Select T Cells for Immunotherapy. Gastroenterology. (2019).
  29. Wu, L. L., et al. Ly6C(+) Monocytes and Kupffer Cells Orchestrate Liver Immune Responses Against Hepatitis B Virus in Mice. Hepatology. (2019).
  30. Haque, M., et al. Stem cell-derived tissue-associated regulatory T cells suppress the activity of pathogenic cells in autoimmune diabetes. Journal of Clinical Investigation Insights. (2019).
  31. Chisari, F. V., et al. Structural and pathological effects of synthesis of hepatitis B virus large envelope polypeptide in transgenic mice. Proceedings of the National Academy of Sciences USA. 84, (19), 6909-6913 (1987).
  32. Wirth, S., Guidotti, L. G., Ando, K., Schlicht, H. J., Chisari, F. V. Breaking tolerance leads to autoantibody production but not autoimmune liver disease in hepatitis B virus envelope transgenic mice. Journal of Immunology. 154, (5), 2504-2515 (1995).
Стволовые клетки- производные вирусные Ag-специфические T Лимфоциты подавить HBV репликации у мышей
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Xiong, X., Lei, F., Haque, M., Song, J. Stem Cell-Derived Viral Ag-Specific T Lymphocytes Suppress HBV Replication in Mice. J. Vis. Exp. (151), e60043, doi:10.3791/60043 (2019).More

Xiong, X., Lei, F., Haque, M., Song, J. Stem Cell-Derived Viral Ag-Specific T Lymphocytes Suppress HBV Replication in Mice. J. Vis. Exp. (151), e60043, doi:10.3791/60043 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter