Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Modification génétique des cyanobactéries par conjugaison à l'aide de la boîte à outils de clonage modulaire CyanoGate

doi: 10.3791/60451 Published: October 31, 2019
* These authors contributed equally

Summary

Ici, nous présentons un protocole décrivant comment i) assembler un vecteur auto-réplicant à l'aide de la boîte à outils modulaire de clonage CyanoGate, ii) introduire le vecteur dans un hôte cyanobactérieparpare par conjugaison, et iii) caractériser les souches transgéniques cyanobactéries en utilisant un lecteur de plaque ou cytométrie de flux.

Abstract

Les cyanobactéries sont un groupe diversifié d'organismes photosynthétiques procaryotiques qui peuvent être génétiquement modifiés pour la production renouvelable de produits industriels utiles. Les progrès récents de la biologie synthétique ont mené au développement de plusieurs boîtes à outils de clonage telles que CyanoGate, un système de clonage modulaire standardisé pour la construction de vecteurs plasmides pour la transformation ultérieure ou le transfert conjugal en cyanobactéries. Ici, nous énoncons une méthode détaillée pour l'assemblage d'un vecteur auto-réplication (par exemple, portant une cassette d'expression marqueur fluorescent) et le transfert conjugal du vecteur dans les souches cyanobactériennes Synechocystis sp. PCC 6803 ou Synechococcus elongatus UTEX 2973. En outre, nous décrivons comment caractériser la performance d'une partie génétique (par exemple, un promoteur) à l'aide d'un lecteur de plaque ou d'une cytométrie de flux.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Les cyanobactéries sont des bactéries autotrophes qui peuvent être utilisées pour la biosynthèse d'une grande variété de produits métaboliques naturels et hétérologues de haute valeur1,2,3,4 ,5, 6. Plusieurs obstacles doivent encore être surmontés pour accroître leur viabilité commerciale, notamment les rendements relativement faibles par rapport aux bio-plateformes hétérotrophes (p. ex. Escherichia coli et levure)7. L'expansion récente des outils de génie génétique disponibles et l'utilisation du paradigme de la biologie synthétique dans la recherche cyanobactérienne aide à surmonter ces défis et à développer davantage les cyanobactéries comme biousines efficaces8, 9,10.

Les principales approches pour introduire l'ADN dans les cyanobactéries sont la transformation, la conjugaison et l'électroporation. Les vecteurs transférés aux cyanobactéries par transformation ou électroporation sont des vecteurs « suicidaires » (c.-à-d. vecteurs intégratifs qui facilitent la recombinaison homologue), tandis que les vecteurs auto-répliquants peuvent être transférés aux cyanobactéries par transformation, conjugaison ou électroporation. Pour le premier, un protocole est disponible pour les espèces modèles d'ingénierie propices à la transformation naturelle11. Plus récemment, une boîte à outils modulaire de clonage (MoClo) pour les cyanobactéries appelée CyanoGate a été développée qui emploie une méthode standardisée d'assemblage vectoriel Golden Gate pour l'ingénierie utilisant la transformation naturelle, l'électroporation ou la conjugaison12.

Les techniques d'assemblage de type Golden Gate sont devenues de plus en plus populaires ces dernières années, et les normes d'assemblage et les bibliothèques de parties sont maintenant disponibles pour une variété d'organismes13,14,15,16 ,17. Golden Gate utilise des enzymes de restriction de type IIS (par exemple, BsaI, BpiI, BsmBI, BtgZI et AarI) et un costume d'accepteurs et de surplombs uniques pour faciliter l'assemblage hiérarchique directionnel de séquences multiples dans une réaction d'assemblage « un pot ». Les enzymes de restriction de type IIS reconnaissent une séquence asymétrique unique et coupent une distance définie par rapport à leurs sites de reconnaissance pour générer une coupe décalée et « collante » (généralement un surplomb de 4 nucléotides [NT]), qui peut être ensuite exploitée pour conduire l'ADN ordonné réactions d'assemblage15,18. Cela a facilité le développement de grandes bibliothèques de pièces modulaires de niveau 0 (p. ex., promoteurs, cadres de lecture ouverts et terminaisons) définies par une syntaxe commune, comme la norme PhytoBricks19. Les pièces de niveau 0 peuvent alors être facilement assemblées dans des cassettes d'expression de niveau 1, après quoi des assemblages d'ordre supérieur plus complexes (p. ex., des constructions d'expression multigène) peuvent être construits dans un vecteur d'accepteur de choix12,15. Un avantage clé des techniques d'assemblage de type Golden Gate est leur agréabilité à l'automatisation dans les installations à haut débit, telles que les fonderies d'ADN20,21, qui peuvent permettre l'essai de conceptions expérimentales complexes qui ne peut pas facilement être atteint par le travail manuel.

CyanoGate s'appuie sur le système Plant MoClo établi12,15. Pour incorporer une nouvelle pièce dans CyanoGate, la séquence de pièce doit d'abord être domestiquée, c'est-à-dire que les sites de reconnaissance « illégaux » pour BsaI et BpiI doivent être supprimés. Dans le cas d'une pièce codant pour un cadre de lecture ouvert (c.-à-d. une séquence de codage, CDS), les sites de reconnaissance peuvent être perturbés en générant des mutations synonymes dans la séquence (c.-à-d., en changeant un codon à une alternative qui code pour le même résidu d'acide aminé). Ceci peut être réalisé par une variété d'approches, allant de la synthèse de l'ADN à la réaction en chaîne de polymérase (PCR) des stratégies basées sur l'amplification telles que l'assemblage Gibson22. Selon l'expression hôte utilisé, il faut prendre soin d'éviter l'introduction de codons rares qui pourraient entraver l'efficacité de la traduction23. Supprimer les sites de reconnaissance dans les séquences de promoteur et de terminaison est généralement une entreprise plus risquée, car les modifications peuvent affecter la fonction et la pièce pourrait ne pas fonctionner comme prévu. Par exemple, les changements apportés aux sites de liaison des facteurs de transcription putatifs ou au site de liaison des ribosomes au sein d'un promoteur pourraient modifier la force et la réactivité à l'induction/répression. De même, les modifications apportées aux caractéristiques structurales clés du terminateur (p. ex., la tige riche en GC, la boucle et la queue poly-U) peuvent modifier l'efficacité de terminaison et l'expression des gènesd'effet 24,25. Bien que plusieurs ressources en ligne soient disponibles pour prédire l'activité des séquences de promoteur et de terminaison, et indiquer si une mutation proposée aura un impact sur les performances26,27, ces outils sont souvent de mauvais prédicteurs de performance en cyanobactéries28,29,30.. En tant que tel, la caractérisation in vivo des pièces modifiées est toujours recommandée pour confirmer l'activité. Pour aider au clonage des séquences récalcitrantes, CyanoGate inclut un vecteur d'accepteur de clonage à faible copie basé sur le vecteur BioBrick pSB4K512,16,31. En outre, un portail "Design and Build" est disponible par l'intermédiaire de la Fonderie du génome d'Édimbourg pour aider à la conception vectorielle (dab.genomefoundry.org). Enfin, et surtout, CyanoGate comprend deux conceptions vectorielles d'accepteur de niveau T (équivalentes aux vecteurs d'accepteur de niveau 2)15 pour l'introduction de l'ADN dans les cyanobactéries à l'aide de vecteurs de suicide, ou de larges vecteurs de portée hôte capables d'autoréplication dans plusieurs espèces cyanobactériennes32,33,34.

Ici, nous allons nous concentrer sur la description d'un protocole pour générer des vecteurs d'auto-reproduction de niveau T et la modification génétique de Synechocystis PCC 6803 et Synechococcus elongatus UTEX 2973 (Synechocystis PCC 6803 et S. elongatusus UTEX 2973 ci-après) par conjugaison (également connu sous le nom d'accouplement triparental). Le transfert conjugal de l'ADN entre les cellules bactériennes est un processus bien décrit et a été précédemment employé pour l'ingénierie des espèces cyanobactériennes, en particulier ceux qui ne sont pas naturellement compétents, tels que S. elongatus UTEX 297335, 36,37,38,39,40,41. En bref, les cultures cyanobactériennes sont incubées avec une souche E. coli transportant le vecteur à transférer (le vecteur de « cargaison ») et des vecteurs (soit dans la même souche E. coli ou dans des souches supplémentaires) pour permettre la conjugaison (« mobilisateur » et les vecteurs d'aide). Quatre conditions clés sont requises pour que le transfert conjugal se produise : 1) le contact direct entre les cellules impliquées dans le transfert d'ADN, 2) le vecteur de cargaison doit être compatible avec le système de conjugaison (c.-à-d., il doit contenir une origine appropriée de transfert (oriT), également connu sous le nom de site bom (base de la mobilité), 3) une protéine de nicking d'ADN (par exemple, codée par le gène de la mafia) qui entaille l'ADN à l'oriT pour initier le transfert à brin unique de l'ADN dans le cyanobacterium doit être présent et exprimé des vecteurs de cargaison ou d'aide, et 4) l'ADN transféré ne doit pas être détruit dans le cyanobacterium du receveur (c.-à-d. qu'il doit être résistant à la dégradation par, par exemple, l'activité d'endonucléase de restriction)35,42. Pour que le vecteur de cargaison persiste, l'origine de la réplication doit être compatible avec le cyanobacterium du destinataire pour permettre l'auto-réplication et la prolifération dans les cellules filles après la division. Pour aider avec les conditions 3 et 4, plusieurs vecteurs d'aide sont disponibles par Addgene et d'autres sources commerciales qui codent pour la foule ainsi que plusieurs méthylases pour se protéger contre les endonucabales indigènes dans le cyanobacteriumhôte 43. Dans ce protocole, la conjugaison a été facilitée par une souche MC1061 E. coli transportant des vecteurs mobilisateurs et d'aide pRK24 (www.addgeneorg/51950) et pRL528 (www.addgene.org/58495), respectivement. Il faut prendre soin de choisir les vecteurs à utiliser pour le transfert conjugal. Par exemple, dans le kit CyanoGate, le vecteur de cargaison auto-réplérant pPMQAK1-T code pour une protéine Mob12. Cependant, pSEVA421-T ne44, et en tant que tel, la foule doit être exprimée à partir d'un vecteur d'aide approprié. Les vecteurs utilisés doivent également être appropriés à l'organisme cible. Par exemple, le transfert conjugal efficace dans Anabaena sp. PCC 7120 nécessite un vecteur d'aide qui protège le vecteur mobilisateur contre la digestion (p.p.p. pRL623, qui code pour les trois méthylases AvaiM, Eco47iiM et Ecot22iM)45, 46.

Dans ce protocole, nous décrivons en outre comment caractériser la performance des pièces (c.-à-d. les promoteurs) avec un marqueur fluorescent à l'aide d'un lecteur de plaque ou d'un cytomètre de débit. Les cytomètres de débit sont capables de mesurer la fluorescence sur une seule base cellulaire pour une grande population. De plus, les cytomètres de débit permettent aux utilisateurs de « saisir » les données acquises et d'éliminer le bruit de fond (p. ex., des particules dans la culture ou la contamination). En revanche, les lecteurs de plaques acquièrent une mesure de fluorescence agrégée d'un volume donné de culture, généralement dans plusieurs puits de repli. Les principaux avantages des lecteurs de plaques par rapport aux cytomètres comprennent le coût inférieur, une disponibilité plus élevée et généralement aucune exigence de logiciels spécialisés pour les analyses de données en aval. Les principaux inconvénients des lecteurs de plaques sont la sensibilité relativement plus faible par rapport aux cytomètres et les problèmes potentiels avec la densité optique des cultures mesurées. Pour les analyses comparatives, les échantillons de lecteurs de plaques doivent être normalisés pour chaque puits (p. ex., pour mesurer la densité de culture, généralement prise comme absorption à la densité optique à 750 nm [OD750]),ce qui peut conduire à des inexactitudes pour les échantillons qui sont trop dense et/ou pas bien mélangé (p. ex., lorsqu'il est sujet à l'agrégation ou à la flocculation).

En résumé, nous démontrons ici en détail les principes de génération de pièces de niveau 0, suivies d'un assemblage hiérarchique à l'aide du kit CyanoGate et d'un clonage en un vecteur adapté au transfert conjugal. Nous démontrons alors le processus conjugal de transfert, la sélection des souches transconjugales axeniques exprimant un marqueur fluorescent, et l'acquisition ultérieure des données de fluorescence utilisant un cytomètre de flux ou un lecteur de plaque.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Assemblage de vecteurs à l'aide des boîtes à outils Plant MoClo et CyanoGate

REMARQUE : Avant de procéder à l'assemblage vectoriel, il est fortement recommandé aux utilisateurs de se familiariser avec les structures de niveau vectoriel des systèmes Plant et CyanoGate MoClo12,15.

  1. Construction de pièces de niveau 0
    REMARQUE : Les parties de niveau 0 peuvent être synthétisées en tant que vecteurs complets ou en séquences linéaires pour l'assemblage avec les accepteurs de niveau 0 (p. ex., gBlocks, IDT). Alternativement, les séquences peuvent être amplifiées à partir d'un modèle source (p. ex., un vecteur ou un ADN génomique purifié). Ici, comment générer une nouvelle pièce de niveau 0 à partir d'un produit amplifié est décrit. Un aperçu du processus d'assemblage du Golden Gate du niveau 0 au niveau T estFigure 1.
    1. Concevez les amorces.
      1. Décidez du module de niveau 0 à assembler et d'identifier les surplombs de 5 et 3 degrés appropriés (tableau 1)12,15. Vérifiez la séquence d'ADN pour cloner la présence de sites de restriction BpiI ou BsaI.
        REMARQUE : Une séquence contenant l'un de ces sites doit être domestiquée en modifiant un ou plusieurs TN dans la séquence du site de restriction. Une stratégie pour ce faire à l'aide de l'assemblage Golden Gate est décrite dans la figure 2.
      2. Pour amplifier une séquence d'ADN, concevez une paire d'apprêt avant et inverse appropriée. Pour l'apprêt avant, sélectionnez 18 à 30 pb complémentaire à l'extrémité de 5 degrés de la séquence de modèle d'ADN. Pour l'amorce inversée, sélectionnez 18 à 30 pb en version inverse complémentaire à l'extrémité 3 de la séquence de modèle d'ADN.
        REMARQUE : Les amorces dont les températures de fonte (Tm)de 58 à 62 oC donnent généralement les résultats d'amplification les plus constants (figure 1A).
      3. Ajoutez ce qui suit à l'extrémité 5 de l'amorce avant : 1) une chaîne aléatoire de 4 à 6 NT à l'extrémité 5 du site BpiI, 2) le site de restriction BpiI (GAAGAC), 3) deux NT aléatoires, et 4) le surplomb de 5 degrés sélectionné à l'étape 1.1.1.1. Ajoutez ce qui suit à l'extrémité 5 de l'amorce inversée : 1) une chaîne aléatoire de 4 à 6 NT à l'extrémité 5 du site BpiI, 2) le site de restriction BpiI (GAAGAC), 3) deux NT aléatoires, et 4) le surplomb de 3 degrés sélectionné à l'étape 1.1.1.1. Une fois finalisé, commandez les paires d'amorce.
        REMARQUE : Voir La figure 1A pour un exemple de paire d'amorce avant et inverse.
    2. Amplifier une séquence d'ADN à partir de l'ADN génomique.
      1. Extraire l'ADN génomique tel que décrit dans la section 5. Amplifier les produits par PCR à l'aide d'une polymérase d'ADN haute fidélité(Tableau des matériaux).
        REMARQUE : Par exemple, configurez les réactions PCR (20 à 50 l) selon les instructions du fabricant. Utilisez 100 ng d'ADN génomique par réaction. Utiliser un programme de vélo thermique composé d'une première étape de dénaturation de 98 oC pour 30 s, suivi d'au plus 25 cycles de dénaturation à 98 oC pour 10 s, d'une introduction anneale à 58 oC pour 15 s et d'une extension du produit à 72 oC pour 30 s (modifier ce dernier en fonction de la taille du produit/type de polymérase d'ADN utilisé), suivie d'une étape finale d'extension de 72 oC pendant 2 min.
      2. Si le produit PCR doit être purifié, exécutez toute la réaction PCR sur un gel d'agarose tel que décrit à la section 6. Couper la bande d'intérêt du gel d'agarose et le purifier à l'aide d'un kit d'extraction de gel (Table of Materials).
      3. Alternative à l'étape 1.1.2.2, si le produit PCR doit être utilisé sans purification de gel, vérifiez la taille de la bande en exécutant un aliquot de l'échantillon de réaction PCR (5 l) sur un gel d'agarose. Si le gel ne montre que la bande appropriée et aucune preuve de dimères d'apprêt, purifier le produit PCR à l'aide d'un kit de purification de l'ADN (Tableau des matériaux).
      4. L'ADN purifié d'Elute dans un petit volume d'eau déionisée (p. ex., 10 l) pour obtenir une concentration élevée d'ADN (-20 ng/L est généralement suffisant).
    3. Assembler le produit d'ADN amplifié (ou les produits, voir Figure 2) au niveau 0. Préparer un mélange de réaction de 20 L avec BpiI (figure 1B) et mettre en place le programme de cycle thermique tel que décrit dans le tableau 2. Procéder à la transformation d'E. coli à l'aide de 5 l du mélange de réaction de niveau 0 assemblé (tel que décrit à la section 2).
  2. Construction d'assemblages de niveau 1
    1. Décider des pièces de niveau 0 à assembler (Figure 1C et tableau 1). Choisissez un vecteur d'accepteur de niveau 1 approprié15.
      REMARQUE : À ce stade, il est important de savoir quelle sera la conception finale du vecteur au niveau T, car cela aura un impact sur le choix du vecteur d'acceptation de niveau 1. Le vecteur d'acceptation de position 1 (avant) (pICH47732) peut être utilisé par défaut si l'objectif est d'avoir un seul assemblage de niveau 1 (p. ex., une cassette d'expression génique) au niveau T. Toutefois, si deux ou plusieurs assemblages de niveau 1 doivent être assemblés au niveau T, la position et la direction de chaque assemblage de niveau 1 doivent être prises en considération. Jusqu'à sept assemblages de niveau 1 peuvent être assemblés dans un vecteur d'accepteur de niveau T en utilisant des vecteurs d'accepteur de niveau 1 avec des positions appropriées12.
    2. Assembler les pièces de niveau 0 au niveau 1. Préparer un mélange de réaction de 20 L avec BsaI et mettre en place le programme de cycle thermique tel que décrit dans le tableau 2. Procéder à la transformation d'E. coli à l'aide de 5 l du mélange de réaction de niveau 1 assemblé (tel que décrit à la section 2).
  3. Construction d'assemblages de niveau T
    1. Décider des assemblages de niveau 1 à assembler (Figure 1D). Choisissez un vecteur d'accepteur de niveau T approprié.
      REMARQUE : pUC19A-T (résistance à l'ampicilline) et pUC19S-T (résistance à la spectinomycine) sont des vecteurs intégratifs à nombre élevé qui ne sont pas capables de se répliquer chez les cyanobactéries et sont principalement utilisés pour l'intégration génomique (c.-à-d. knock-in ou knock-out des gènes) par l'intermédiaire recombinaison homologue12. La livraison de vecteurs intégratifs peut se faire par transformation naturelle chez les espèces cyanobactériennes acceptables11. pPMQAK1-T est un large vecteur réplicif de l'hôte qui est livré par transfert conjugal (section 3).
    2. Choisissez un lien de fin approprié pour lier la fin 3 de l'assemblage final de niveau 1 à l'épine dorsale de niveau T15.
      REMARQUE : Le lien final requis est le même nombre que la position de la partie finale. Par exemple, un vecteur de niveau T avec une seule partie de niveau 1 (avant ou inverse) nécessitera end-Link 1 (pICH50872) pour la ligature dans l'épine dorsale de niveau T.
    3. Assembler un ou plusieurs assemblages de niveau 1 au niveau T. Préparer un mélange de réaction avec BpiI et le vecteur End-Link requis et configurer le programme de cycle thermique tel que décrit dans le tableau 2. Procéder à la transformation d'E. coli à l'aide de 5 l du mélange de réaction de niveau T assemblé (tel que décrit à la section 2).

2. Transformation de e. coli et purification vectorielle

  1. Transformation d'E. coli (jour 1)
    1. Décongeler un aliquot (25 l) de cellules E. coli chimiquement compétentes(tableau des matériaux)et délicatement pipette dans un tube de 1,5 ml sur la glace. Ajouter 5 ll du mélange d'assemblage (niveau 0, 1 ou T) et couver le tube sur la glace pendant 30 à 60 minutes supplémentaires.
    2. Cellules de choc thermique en couvant le tube dans un bain d'eau à 42 oC pour 30 s, puis placez le tube sur la glace pendant 2 min. Ajouter le bouillon super optimal à température ambiante (RT) avec la répression catabolite (S.O.C.) moyen (250 l) au tube. Incuber le tube à 37 oC pendant 1 h à 225 tr/min dans un incubateur secouant.
    3. Plaque 40 'L de la culture sur une plaque d'agar LB contenant la concentration finale appropriée d'antibiotiques (100 'g/mL pour la spectinomycine dihydrochloride pentahydrate [niveau 0], 10 'g/mL de disodium de carbenicilline [niveau 1], ou 50 'g/mL de sulfate de kanamycin [ [ Niveau T]), 1 mM isopropyl-beta-D-thiogalactopyranoside (IPTG) et 40 g/mL de 5-bromo-4-chloro-3-indolyl--D-galactopyranoside (X-Gal) pour le criblage bleu-blanc. Incuber la plaque pendant la nuit à 37 oC.
      REMARQUE : La quantité de culture plaquée peut varier en fonction de l'efficacité des cellules compétentes d'E. coli et de la réaction de ligature. Plaquer un plus grand volume si lt;10 colonies sont observées après l'incubation de nuit.
  2. Sélection des colonies blanches et préparation des cultures liquides (jour 2)
    REMARQUE : Selon l'efficacité de la réaction d'assemblage et de la transformation subséquente, les plaques d'agar LB peuvent ne contenir aucune colonie, colonie bleue ou colonie blanche (figure 3). Les colonies bleues sont indicatrices des vecteurs d'accepteur qui n'ont pas subi de restriction (c.-à-d., une copie fonctionnelle de lacZ est toujours présente). Les colonies blanches indiquent que la cassette d'expression lacZ a été perdue et remplacée par une pièce/assemblage.
    1. En option, validez le fait que les colonies blanches contiennent le vecteur attendu en effectuant le PCR tel que décrit à la section 7.
    2. Choisissez des colonies blanches simples (ou colonies vérifiées par PCR) avec une pointe de 10 l et transférez-les dans un tube centrifugeuse de 15 ml contenant un milieu LB (5 ml) et des concentrations antibiotiques appropriées (étape 2.1.3). Incuber les tubes à 37 oC pendant la nuit à 225 tr/min dans un incubateur secouant.
  3. Purification vectorielle plasmide (jour 3)
    1. En option, préparez un stock de glycérol de la culture E. coli pendant la nuit pour le cryostockage à long terme des vecteurs. Ajouter 500 l de culture bactérienne à 500 oL de 50 % (v/v) de glycérol dans un tube approprié de 1,5 à 2,0 ml pour le cryostockage à -80 oC. Mélanger délicatement en inversant 5 à 10x. Échantillons de congélation éclair dans de l'azote liquide et conserver dans un congélateur de -80 oC.
    2. Faites tourner les cultures dans des tubes centrifugeuses de 15 ml à 3 000 x g pendant 5 à 10 min. Jetez le supernatant sans déranger le granule cellulaire. Purifier le vecteur à l'aide d'un kit de purification plasmide (Tableau des matériaux). Vecteur purifié d'Elute dans 35 l'eau déionisée.
      REMARQUE : Utilisez des volumes d'élution plus faibles pour augmenter davantage la concentration vectorielle. Le même élunement peut être mis à travers une colonne de purification deux fois pour des rendements accrus.
    3. Mesurer la concentration du vecteur dans l'éluence à l'aide d'un spectrophotomètre (Tableau des matériaux).
      REMARQUE : Les vecteurs à nombre élevé de copies dans E. coli, tels que le pUC19, donnent généralement des rendements de 50 à 300 ng/L. Les vecteurs à faible nombre de copies, tels que le pPMQAK1-T, donnent généralement des rendements de 15 à 60 ng/L.
  4. Validation vectorielle
    REMARQUE : Les vecteurs peuvent être vérifiés par digestion de restriction (étape 2.4.1) et/ou séquençage (étape 2.4.2).
    1. Limiter 0,5 à 1 g de vecteur avec une enzyme de restriction appropriée et vérifier la taille prévue de la bande telle que décrite à la section 6 (figure 4).
      REMARQUE : Les tailles incorrectes de bande indiquent typiquement l'assemblage erroné, auquel cas plus de colonies blanches peuvent être examinées ou l'assemblage peut être répété. BsaI et BpiI peuvent être utilisés pour valider la taille correcte de l'insert pour les assemblages de niveau 0 et de niveau 1, respectivement. BsaI ou BpiI peuvent être utilisés en conjonction avec une enzyme de restriction supplémentaire et compatible qui coupe dans l'insert et/ou l'épine dorsale vectorielle pour produire un ensemble distinct de bandes bien séparées après la digestion.
    2. Séquencer le vecteur par séquençage de Sanger à l'aide d'une amorce appropriée en amont de la région assemblée à l'aide d'installations de séquençage commercial (tableau 3).
      REMARQUE : Toutes les nouvelles parties de niveau 0 doivent être séquencées pour confirmer l'identité de séquence prévue. La validation de séquence des vecteurs de niveau 1 et T n'est généralement pas requise si elle est assemblée à partir de parties de niveau 0 précédemment séquencées.

3. Génération de mutants par conjugaison

REMARQUE : Ici, un protocole pour le transfert conjugal d'un vecteur de cargaison auto-réplicant dans Synechocystis PCC 6803 ou S. elongatus UTEX 297311,47 est décrit. Ce protocole s'applique à d'autres espèces modèles (p. ex. S. elongatus PCC 7942 et Synechococcus sp. PCC 7002). Tous les travaux avec les cyanobactéries (et les préparations tampons associées) doivent être effectués dans des conditions stériles dans une hotte à écoulement laminaire.

  1. Croissance de la culture cyanobactérienne (jour 1)
    1. Préparer le milieu BG11 selon Lea-Smith et coll.11, et les plaques d'agar avec LB-BG11 et BG11-Kan50 (section 8).
    2. Mettre en place une nouvelle culture de Synechocystis PCC 6803 ou S. elongatus UTEX 2973 en inoculé un flacon conique de 100 ml de milieu BG11 frais (50 ml) avec des cellules provenant d'une plaque d'agar axenic BG11. Cultivez Synechocystis PCC 6803 cultures à 30 oC, 100 photons m-2s-1 à 100 tr/min et cultivez S. elongatus UTEX 2973 à 40 oC, 300 photons m-2s-1 à 100 tr/min. Cultivez des cultures jusqu'à l'OD750 à 0,5 à 1,5 (généralement 1 à 2 jours).
      REMARQUE : Les cultures De S. elongatus UTEX 2973 peuvent être cultivées à 40 oC dans des intensités lumineuses élevées (p. ex., 2000 photons de mol m-2s-1)48.
  2. Croissance des souches E. coli (jour 2)
    1. Inoculer le milieu LB contenant de l'ampicilline (concentration finale de 100 g/mL) et du chloramphenicol (concentration finale de 25 g/mL) avec une souche MC1061 E. coli contenant des vecteurs pRK24 et pRL528 (c.-à-d. la souche d'aide) et se développent à 37 oC pendant la nuit à 225 tr/mpm dans un incubateur secouant. Cultivez un volume suffisant de culture de souche d'aide, en supposant que 1 ml de culture est nécessaire par conjugaison.
    2. Inoculer le milieu LB (5 ml) contenant des antibiotiques appropriés avec la culture E. coli transportant le vecteur de cargaison (c.-à-d. un vecteur de niveau T). Cultivez la culture à 37 oC pendant la nuit à 225 tr/min dans un incubateur secouant.
  3. Transfert conjugal (accouplement triparental) (jour 3)
    1. Préparer l'aide e. coli et les souches de fret. Centrifuger l'aide et la cargaison E. coli cultures de nuit à 3000 x g pendant 10 min à température ambiante. Jeter le supernatant sans déranger la pastille cellulaire.
    2. Laver la pastille en ajoutant un milieu LB frais sans antibiotiques. Utilisez le même volume que la culture initiale. Resuspendre la pastille en faisant doucement monter et descendre. Ne pas vortex la culture. Répétez cette étape 3x pour enlever les antibiotiques résiduels de la culture du jour au lendemain.
    3. Centrifuger la culture en suspension (comme à l'étape 3.3.1), jeter le supernatant et resuspendre dans la moitié du volume de lb moyen du volume de culture initial (par exemple, 2,5 mL si la culture du jour au lendemain était de 5 ml). Mélanger 450 l l de la souche d'aide avec 450 l de la souche de cargaison dans un tube de 2 ml et réserver (laisser à RT) jusqu'à l'étape 3.3.6.
    4. Préparer la culture cyanobactérienne. Pour chaque réaction de conjugaison, utilisez 1 ml de culture cyanobactérienne (OD750 à 0,5 à 1,5).
    5. Centrifuger le volume total requis de la culture cyanobactérienne à 1500 x g pendant 10 min à RT, puis jeter le supernatant soigneusement sans déranger la pastille cellulaire. Laver la pastille en ajoutant le milieu BG11 frais du même volume initial. Resuspendre la pastille en pipetting doucement de haut en bas, ne pas vortex la culture. Répétez cette étape 3x et mettre la culture lavée de côté.
    6. Ajouter un aliquot de culture cyanobactérienne lavée (900 l) aux souches combinées d'E. coli (aide et cargaison) (900 l) dans un tube de 2 ml. Mélanger les cultures en faisant doucement monter et descendre. Ne pas vortex. Incuber le mélange à RT pendant 30 min pour Synechocystis PCC 6803 ou 2 h pour S. elongatus UTEX 2973.
    7. Centrifuger le mélange à 1500 x g pendant 10 min à RT. Retirez 1,6 ml du supernatant. Suspendre la pastille dans les 200 euros restants de supernatant. Placez un filtre à membrane de 0,45 m sur une plaque d'agar LB-BG11 dépourvue d'antibiotiques (section 8). Étendre soigneusement 200 l du mélange de culture E.coli/cyanobacterial sur la membrane à l'aide d'un épandeur stérile ou d'une pointe bended stérile et sceller la plaque avec du film de paraffine.
    8. Incuber la plaque LB-BG11 avec la membrane pendant 24 h. Maintenir les membranes avec synechocystis PCC 6803 cultures à 30 oC, 100 photons de mol m-2s-1. Maintenir les membranes avec s. elongatus UTEX 2973 cultures à 40 oC dans 150 photons m-2s-1.
  4. Transfert de membrane
    1. Après 24 h, transférer soigneusement la membrane à l'aide de forceps stérilisés par flamme sur une plaque d'agar BG11 fraîche contenant des antibiotiques appropriés (section 8) à choisir pour le vecteur de cargaison. Sceller la plaque avec du film de paraffine.
    2. Incuber la plaque d'agar BG11 dans des conditions de croissance appropriées, comme décrit ci-dessus pour Synechocystis PCC 6803 ou S. elongatus UTEX 2973, jusqu'à ce que des colonies apparaissent.
      REMARQUE : Les colonies apparaissent généralement après 7 à 14 jours pour Le Pcc 6803 de Synechocystis et les 3 à 7 jours pour S. elongatus UTEX 2973.
  5. Sélection des conjugants
    REMARQUE : Seules les colonies cyanobactériennes transportant le vecteur de cargaison pourront se développer sur la membrane (figure 5).
    1. À l'aide d'une boucle stérile à la chaleur, sélectionnez au moins deux colonies individuelles de la membrane et stries sur une nouvelle plaque d'agar BG11 contenant des antibiotiques appropriés (figure 5C).
      REMARQUE : Les colonies fraîchement striels peuvent encore être contaminées par E. coli reporté de la conjugaison (c.-à-d. si de petites colonies blanches sont évidentes sur l'assiette), de sorte que deux ou trois séries supplémentaires de re-streaking sur les plaques d'agar BG11 fraîches sont généralement nécessaire pour obtenir une culture cyanobactérienne axenique.
    2. Confirmer l'absence de contamination par E. coli en inoculant une traînée de culture cyanobactérienne dans un tube centrifugeur de 15 ml contenant 5 ml de lb moyen et en couve à 37 oC pendant la nuit à 225 tr/min dans un incubateur secouant. Après une période de croissance suffisante (7 jours), choisissez des colonies hacheniques individuelles pour mettre en place des cultures liquides pour le cryostockage à long terme ou l'expérimentation ultérieure.
  6. Cryostockage de souches cyanobactériennes
    1. Cultivez une culture liquide cyanobactérienne en BG11 (tel que décrit dans la section 3.1) jusqu'à l'OD750 à 1,5 à 3,0. Centrifuger 10 ml de culture pendant 10 min à 1 500 x g,retirer le supernatant et resuspendre les cellules en 5 ml de milieu BG11 frais.
    2. Ajouter 3,5 ml de glycérol stérilisé automatique de 50 % (v/v) pour une concentration finale de glycérol de 20 % (v/v)49. Cette approche fonctionne bien pour Synechocystis PCC 6803. Alternativement, ajoutez 5 mL de filtre stérilisé BG11 contenant 16% (v/v) sulfoxide de diméthyle (DMSO) pour une concentration finale de DMSO de 8% (v/v)50. Cette approche est recommandée pour la plupart des souches, y compris S. elongatus UTEX 2973.
      CAUTION: DMSO est toxique et doit être manipulé avec une protection appropriée.
    3. Mélanger délicatement en inversant 5 à 10x. Subaliquot 1 ml de culture en tubes à capuchon compatibles de 1,5 mL de cryostockage séparé(Tableau des matériaux). Placer les tubes dans un congélateur de -80 oC pour le cryostockage. Ne pas clignoter dans l'azote liquide.
      REMARQUE : Au moins trois stocks par souche sont recommandés.
    4. Pour la récupération, retirer un tube du congélateur de -80 oC et décongeler la culture dans un bain d'eau de 35 oC tout en mélangeant doucement. Ajouter la culture décongelée à 50 ml de milieu BG11 frais et cultiver comme culture liquide (comme décrit à la section 3.1).
      REMARQUE: Alternativement, la culture peut être strié et cultivé sur une plaque d'agar BG11 frais. Les cultures transgéniques portant des marqueurs de sélection doivent d'abord être réanimées sur des plaques d'agar BG11 sans antibiotiques, puis restreaked sur des plaques d'agar BG11 avec des antibiotiques appropriés.

4. Caractérisation du promoteur

REMARQUE : Ici, une approche standard est décrite pour analyser la force d'une partie de promoteur en mesurant les niveaux d'expression d'un marqueur fluorescent (eYFP) suivant une période de croissance de 72 h utilisant soit un lecteur de plaque, soit un cytomètre de débit12.

  1. Croissance de la culture
    1. Mettre en place des cultures de graines en inoculé 10 ml de milieu BG11 contenant des antibiotiques appropriés avec une seule colonie de la souche cyanobactérienne transgénique portant la cassette d'expression de marqueur fluorescent. Préparez également les cultures de graines à des souches de contrôle négatives appropriées (p. ex., une souche de type sauvage et/ou une souche transgénique portant la même colonne vertébrale vectorielle, mais dépourvue de la cassette d'expression fluorescente).
      REMARQUE : Au moins quatre répliques biologiques sont recommandées.
    2. Cultivez les cultures de graines pendant 48 h ou jusqu'à l'OD750 à 1,5 dans des conditions de croissance appropriées à la souche de l'espèce.
    3. Pour suivre l'expression des promoteurs au fil du temps, mesurez d'abord l'OD750 de chaque culture de semences. Calculez les exigences de dilution pour amener chaque culture à un oD de départ750 à 0,2. Mettre en place des échantillons de culture expérimentale dilué (volume total de 2 ml) dans une plaque plate de 24 puits(tableau des matériaux).
    4. Incuber la plaque dans un incubateur secouant avec des lumières BLANCHES LED (Table of Materials) dans des conditions de croissance appropriées. Mesurer la densité de croissance de la culture (OD750) et la fluorescence améliorée des protéines fluorescentes jaunes (EYFP) à l'aide d'un lecteur de plaque (section 4.2) ou d'un cytomètre de débit (section 4.3).
      REMARQUE : Synechocystis PCC 6803 et S. elongatus UTEX 2973 cultures peuvent être cultivées comme dans l'étape 3.1.2. Il est fortement recommandé que la plaque soit maintenue sous une forte humidité (95%) pour éviter l'évaporation des échantillons de culture.
  2. Lecteur de plaque
    1. Mélangez brièvement les cultures dans la plaque de 24 puits (étape 4.1.4) avec la pipetage doux. Transférer un sous-échantillon de chaque culture dans une plaque noire à fond plat de 96 puits(tableau des matériaux). Diluer si nécessaire (volume final de 100 l). Évitez la formation de bulles car cela peut interférer avec la précision de la mesure.
      REMARQUE : Il est recommandé que toutes les mesures soient effectuées sur des échantillons dans une plage oD750 de 0,2 à 1,0. Comme la densité des cultures dans le puits 24 augmentera au fil du temps, les dilutions suivantes sont recommandées en fonction des augmentations attendues des conditions de croissance standard : pas de dilution à 0 h, 1:4 à 24 h, 1:10 à 48 h et 1:10 à 72 h. Ainsi, par exemple, à 24 h récolte 25 'L de culture et de mélanger avec 75 'L de bg11 milieu.
    2. Inclure deux puits vierges dans la plaque de 96 puits (c.-à-d. 100 l de bg11 moyen). Mettre la plaque de 96 puits dans un lecteur de plaque (Table des matériaux). Agiter la plaque pendant 60 s à 500 tr/min à l'aide du shaker orbital dans le lecteur de plaque pour mélanger les puits.
      REMARQUE : Les cultures cyanobactériennes peuvent s'agréger et/ou flocculer, de sorte qu'un bon mélange est essentiel avant la lecture pour des mesures précises.
    3. Mesurer la fluorescence de l'OD750 et de l'eYFP avec des longueurs d'onde d'excitation/émission à 485 nm/520 nm.
    4. Soustrayez la moyenne des mesures OD750 des deux puits vierges de la mesure OD750 de chaque puits contenant des cyanobactéries.
    5. Normaliser les valeurs de fluorescence de chaque échantillon de culture en divisant la mesure de fluorescence eYFP (étape 4.2.3) par l'OD750 ajusté de la culture (étape 4.2.4). Ensuite, soustrayez la valeur moyenne normalisée de fluorescence eYFP (fluorescence eYFP/OD750) des répliques biologiques d'une souche de contrôle négative appropriée provenant des souches transgéniques portant la cassette d'expression eYFP.
      REMARQUE : Les cyanobactéries fluorent naturellement en raison de la présence de pigments, comme la chlorophylle et les phycobiliprotéines.
    6. Tracer la croissance de la culture au fil du temps (figure 6A) et les valeurs moyennes normalisées de fluorescence du PFJe de chaque culture expérimentale aux moments souhaités (p. ex., 72 h; Figure 6B).
  3. Cytomètre de flux
    1. Choisissez une plaque compatible pour le système de manutention liquide du cytomètre d'écoulement. Par exemple, utilisez une plaque ronde de 96 puits(tableau des matériaux)avec le cytomètre de débit (Table of Materials) utilisé dans ce protocole.
    2. Mélangez brièvement les cultures dans la plaque de 24 puits (étape 4.1.4) avec la pipetage doux. Diluer les cultures à l'OD750 à 0,1 0,2 pour éviter les blocages de buses dans le système de manipulation des liquides. Ajoutez un volume approprié d'échantillon de culture à la plaque de 96 puits et amenez-le à un volume final de 250 L avec une solution saline 1x phosphate-tamponnée (PBS) stérilisée par filtre. Inclure un puits vierge pour la solution moyenne sur la plaque contenant 60 l de BG11 et 190 L de 1x PBS.
      REMARQUE : Ce volume est recommandé en cas de besoin de réexécuter des échantillons. Les volumes supérieurs à 250 L ne sont pas recommandés car le volume maximal de chaque puits est de 300 l.
    3. Une fois que le cytomètre d'écoulement est prêt à l'emploi, placez la plaque de 96 puits avec des échantillons de culture dans la station de manutention liquide. Configurez le protocole logiciel pour le cytomètre de débit afin de recueillir les mesures de 10 000 événements individuels (p. ex., les cellules). Mesurer la fluorescence eYFP avec des longueurs d'onde d'excitation/émission de 488 nm/515-545 nm. D'abord mesurer et vérifier la lecture du puits blanc (Figure 7A), puis exécuter les échantillons.
    4. Portez la population de cellules cyanobactéries dans les ensembles de données de diffusion vers l'avant et latérales, à l'exclusion des régions communes à la lecture vierge (figure 7B). Soustrayez les valeurs moyennes de fluorescence eYFP des répliques biologiques d'une souche de contrôle négative appropriée des souches transgéniques portant la cassette d'expression eYFP (Figure 7C,D). Tracer la moyenne des valeurs médianes de fluorescence par cellule pour chaque culture expérimentale aux moments souhaités (p. ex., 72 h; Figure 7E).

5. Extraction d'ADN génomique à partir de cyanobactéries

REMARQUE: Le protocole ci-dessous utilise un kit commercial d'extraction d'ADN (Tableau des matériaux).

  1. Cultivez une culture liquide cyanobactérienne en BG11 (tel que décrit dans la section 3.1) jusqu'à l'OD750 à 1,5 à 3,0. Faites tourner 10 ml de culture à 3 000 x g pendant 10 min et jetez le supernatant. Congeler la pastille en couvant les tubes à -20 oC pendant 30 min.
  2. Ajouter 400 l de tampon de lyse (tampon AP1) et 400 l de solution de ribonuclease (RNase A), et 50 % (w/v) de perles de verre (0,5 mm de diamètre). Perturber les échantillons à l'aide d'un moulin à perles (Table of Materials) à 30 Hz (c.-à-d. équivalent à 1 800 oscillations/min) pendant 6 min.
  3. Faites tourner l'échantillon à 17 000 x g pendant 5 minutes et transférez soigneusement le supernatant dans un nouveau tube et jetez la pastille. Procéder selon les instructions du fabricant (Tableau des matériaux).

6. Électrophoresis gel Agarose

  1. Jetez un gel d'agarose de 1 % (w/v) contenant 0,02 % (v/v) de bromure d'éthidium. Charger des échantillons et une référence appropriée d'échelle d'ADN.
  2. Exécuter les échantillons pendant 50 min à 125 V. Vérifier la séparation de la bande sur un transilluminateur ultraviolet (UV).
    REMARQUE : Le temps de fonctionnement et le pourcentage de gel d'agarose peuvent être modifiés en fonction de la taille prévue de la bande. Par exemple, un pourcentage plus élevé de gel agarose et un temps de fonctionnement plus long peuvent améliorer la résolution de la bande et la séparation des produits à base d'ADN de 500 pb.

7. Colonie PCR

  1. Configurer un mélange de réaction PCR à l'aide d'un kit standard(tableau des matériaux)et d'une combinaison appropriée d'amorces (p. ex., des amorces qui bordent la région d'assemblage ou qui sont spécifiques aux séquences dans la région d'assemblage (tableau 3). Pipette 10 l dans un tube PCR.
  2. Touchez délicatement le dessus d'une seule colonie blanche à l'aide d'un cure-dent stérile ou d'une pointe de pipette de 10 l et inoculez un tube PCR contenant un mélange de réaction PCR. Prenez soin de marquer la colonie et de faire correspondre avec le tube PCR spécifique. Remuer délicatement le mélange de réaction pour s'assurer que les cellules E. coli sont jetées dans la solution.
  3. Amplifier les produits par PCR. Utiliser un programme composé d'une première étape de dénaturation de 95 oC pour 60 s, 30 tours de 95 oC pour 15 s, 58 oC pour 15 s (quelques degrés en dessous des valeurs Tm des amorces) , 72 oC pour 30 s (30 s/kb d'insert) , suivie d'une dernière étape d'extension de 72 oC pendant 5 min.

8. Préparation du milieu et des plaques BG11

  1. Préparer des solutions de stock de 100x BG11 moyen, fer (citrate ferrique d'ammonium), oligo-éléments, phosphate (K2HPO4), Na2CO3 et tampon TES selon Lea-Smith et al.11. Autoclave phosphate et Na2CO3 stocks. Utilisez des filtres de 0,2 m pour filtrer la stérilisation des solutions de stock TES (pH 8.2) et NaHCO3.
  2. Préparer 1 L de BG11 moyen. Mélanger 10 ml de 100x BG11, 1 ml d'oligo-éléments et 1 ml de bouillon de fer et autoclave la solution avec 976 ml d'eau. Une fois que la solution a refroidi à RT, ajouter 1 mL de stock de phosphate, 1 ml de Na2CO3 stock et 10 mL de NaHCO3, et ajuster à pH 7,6-7,8 avec 1 M HCl.
  3. Plaques d'agar LB-BG11 (1,5 % [w/v])
    1. Mélanger 700 ml d'eau déionisée et 15 g d'agar dans un flacon de verre. Dans un deuxième flacon, ajouter 186 ml d'eau, 10 ml de 100 x BG11, 1 ml d'oligo-éléments et 1 ml de bouillon de fer. Autoclave les deux solutions.
    2. Une fois que les solutions ont refroidi jusqu'à environ 60 oC, les combiner et ajouter 1 ml de bouillon de phosphate, 1 ml de stock Na2CO3, 10 mL de nahCO3 stock et 50 mL de milieu stérile LB, ce qui devrait donner un volume final de 1 L. Cast Petri plats avec 25 mL de lb-BG11 agar medium.
  4. Plaques d'agar BG11-Kan50 (1,5% [w/v])
    1. Mélanger 700 ml d'eau déionisée et 15 g d'agar dans un flacon de verre. Dans un deuxième flacon, ajouter 3 g de thiosulfate de sodium (Na2S2O3), 226 ml d'eau, 10 ml de 100 x BG11, 1 ml d'oligo-éléments et 1 ml de bouillon de fer. Autoclave les deux solutions.
    2. Une fois que les solutions ont refroidi jusqu'à environ 60 oC, combinez-les et ajoutez 1 ml de stock de phosphate, 1 ml de stock de Na2CO3, 10 mL de stock tampon TES et 10 mL de stock NaHCO3, qui devrait donner un volume final de 1 L. Ajouter du sulfate de kanamycine à une concentration finale de 50 g/mL et les plats Petri moulés avec 35 ml de milieu.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Pour démontrer le flux de travail d'assemblage du Golden Gate, une cassette d'expression a été assemblée dans le vecteur d'acceptation de position 1 (pICH47732) contenant les parties suivantes de niveau 0 : le promoteur de l'operon Pcpc560 (pC0.005), la séquence de codage pour eYFP (pC0.008) et le double terminateur TrrnB (pC0.082)12. À la suite de la transformation de la réaction d'assemblage, des assemblages réussis ont été identifiés à l'aide d'un criblage bleu-blanc standard des colonies d'E. coli (figure 3). La cassette d'expression eYFP du vecteur de niveau 1 et du vecteur End-Link 1 (pICH50872) ont ensuite été assemblées en un vecteur d'accepteur de niveau T (pPMQAK1-T) pour donner au vecteur cpcBA-eYFP (figure 4A). Le vecteur cpcBA-eYFPassemblé a été vérifié par digestion de restriction (figure 4B).

Le transfert conjugal réussi de cpcBA-eYFPou du vecteur vide pPMQAK1-T (c.-à-d., un contrôle négatif manquant de la cassette d'expression eYFP) a eu comme conséquence la croissance de jusqu'à plusieurs centaines de colonies sur la membrane pour Synechocystis PCC 6803 et S. elongatus UTEX 2973 après 7 à 14 jours et 3 à 7 jours, respectivement (figure 5). Les colonies individuelles ont été cueillies et stries sur des plaques d'agar BG11-Kan50 fraîches; Des re-streaks de 2 à 3 ont été nécessaires pour générer des cultures haillonniques.

Comme prévu pour le fort Pcpc560 promoteur51, les valeurs de la fluorescence eYFP normalisée du lecteur de plaque et la fluorescence eYFP par cellule du cytomètre de débit étaient élevées par rapport au contrôle négatif (Figure 6 et Figure 7). Les valeurs de fluorescence étaient plus élevées dans S. elongatus UTEX 2973 que dans Synechocystis PCC 680312.

Figure 1
Figure 1 : Aperçu du processus d'assemblage du Golden Gate dans CyanoGate. L'assemblage d'une cassette d'expression génique est montré, à partir de l'amplification d'une séquence d'intérêt de l'ADN de modèle à l'assemblage dans un vecteur de niveau T (les parties ne sont pas dessinées à l'échelle). (A) Conception d'amorces avant et inverses pour l'amplification d'une partie CDS1 à partir de l'ADN du modèle (p. ex. ADN génomique ou plasmide). Les emplacements des sites de restriction BpiI et les surplombs requis pour l'insertion dans le vecteur de l'accepteur (c.-à-d. 5 et 3 degrés de la séquence de modèle) sont mis en évidence en rouge et bleu, respectivement. La lettre "n" indique que n'importe quel NT peut être utilisé à cette position. Les régions annealing des amorces avec le modèle d'ADN et leurs températures de fonte recommandées (Tm) sont indiquées. (B) Assemblage de niveau 0 du produit PCR dans le vecteur d'accepteur CDS1 de niveau 0 pICH41308. La séquence qui sera excisée par BpiI et ligatée dans le vecteur de l'accepteur est mise en évidence en bleu. (C) Assemblage de niveau 1 d'une cassette d'expression génique contenant trois parties de niveau 0 (Pro 5U, CDS1 et 3U et Ter) dans la position 1 (avant) vector e pICH47732 à l'aide de BsaI. (D) Assemblage de niveau T de l'assemblage de niveau 1 et du lien final 1 (pICH50872, appelé « Niveau M End-link 1 » dans Engler etal. 15) en un vecteur d'accepteur de niveau T (p.p., pPMQAK1-T) à l'aide de BpiI. (E) Le vecteur final assemblé de niveau T. Abréviations: AmpR, cassette de résistance à l'ampicilline; CarbR, cassette de résistance à la carbenicilline; CDS1, séquence de codage dans la syntaxe de niveau 015; EL1, End-Link 1 partie; KanR, cassette de résistance à la kanamycine; lacZMD, cassette d'expression de galactosidase ; SpecR, cassette de résistance à la spectinomycine. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 2
Figure 2 : Stratégie de domestication fondée sur le PCR pour l'élimination d'un site de restriction de type illégal IIS. (A) Diagramme schématique montrant deux paires d'amorces (en vert et orange, respectivement) pour modifier un site BpiI (GAAGAC) à GAGGAC dans une séquence d'ADN codant protéique destinée à l'assemblage dans le vecteur d'accepteur cDS1 de niveau 0 (pICH41308). Notez que la modification préserve le codon pour l'acide glutamique (Glu) (c.-à-d., GAA à GAG). Bien que le site BpiI soit montré dans le cadre avec le codon de départ, cette approche fonctionnera même si le site n'est pas dans le cadre (c.-à-d., tant que le site est perturbé, et la séquence de protéine préservée). Les emplacements des sites de restriction BpiI et les surplombs dans les amorces sont mis en évidence en rouge et bleu, respectivement. Le modèle d'ADN et la séquence de protéines traduites sont mis en évidence en jaune. Les régions annealing des amorces avec le modèle d'ADN et leurs températures de fonte recommandées (Tm) sont indiquées. La paire orange est utilisée pour amplifier la fin de la séquence à 5 degrés avec des surplombs AATG et TGAA (fragment 1), tandis que la paire verte est utilisée pour amplifier l'extrémité 3 avec des surplombs TGAA et GCTT (fragment 2). Avant de commander les amorces, la fidélité du surplomb de fusion TGAA pour les fragments 1 et 2 a été soigneusement vérifiée52. Les surplombs de fusion mal conçus peuvent entraîner une défaillance de l'assemblage (c.-à-d. pas de colonies après la transformation; Figure 5) ou de faux positifs (p. ex. des assemblages tronqués ou erronés). Ce dernier peut être résolu à filtrer un plus grand nombre de colonies blanches pour identifier une construction correctement assemblée. (B) Amplicons des fragments 1 et 2 après restriction avec BpiI lors de l'assemblage du Golden Gate. (C) La séquence domestiquée assemblée dans le vecteur d'accepteur CDS1 de niveau 0. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 3
Figure 3 : Dépistage des colonies bleu-blanc des transformateurs d'E. coli après l'assemblage du Golden Gate. Les plaques montrées contiennent de l'agar LB (1 % [w/v]) complété par x-Gal, IPTG et antibiotiques à des concentrations appropriées. (A) Pas de colonies, ce qui suggère une réaction d'assemblage ratée et/ou une transformation d'E. coli. (B) Colonies principalement bleues, indiquant un assemblage réussi, mais que l'efficacité de l'enzyme de restriction utilisée dans la réaction d'assemblage était faible. (C) Colonies majoritairement blanches, révélatrices d'une réaction d'assemblage typique et réussie. (D) Pas de colonies bleues, ce qui indique un assemblage très efficace. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 4
Figure 4 : Vérification d'un vecteur de niveau T assemblé par digestion de restriction. Les vecteurs ont été digérés avec HindIII et BamHI. (A) Carte de séquence du vecteur accepteur vide pPMQAK1-T (CT.0) et de niveau T d'assemblage(cpcBA-eYFP) montrant les composants de la cassette d'expression eYFP (Pcpc560-eYFP-TrrnB). Les positions des sites de restriction pour HindIII et BamHI sont indiquées. Après une double digestion, les tailles prévues des fragments d'ADN sont indiquées : (1) 5 847 bp, (2) 2 004 pb, (3) 30 bp, (4) 374 pb, (5) 1 820 pb, (6) 1 289 pb, et (7) 156 bp. (B) Un gel agarose (0,8 % [w/v]) courant à 125 V pendant 60 min chargés du niveau digéré T assemblage(cpcBA-eYFP) montrant les bandes 1, 5 et 6, le vide digéré pPMQAK1-T accepteur vecteur (CT.0) montrant les bandes 1 et 2 et une échelle d'ADN (Tableau des matériaux). Notez que les bandes 3, 4 et 7 étaient trop petites pour être visualisé sur le gel. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 5
Figure 5 : Croissance des colonies transgéniques de Synechocystis PCC 6803 après conjugaison réussie. Des exemples de membranes après l'incubation sur des plaques d'agar BG11-Kan50 sont présentés. (A) Surcroissance suite à une conjugaison très efficace - les colonies Synechocystis PCC 6803 se sont développées en une pelouse sans colonies individuelles. (B) Une bonne efficacité de conjugaison montrant plusieurs centaines de colonies individuelles après 12 jours. (C) Croissance d'une souche axenique après 14 jours après plusieurs tours de re-streaking sur une plaque d'agar BG11-Kan50 frais. L'absence de contamination bactérienne a indiqué que le transconjugant de Synechocystis PCC 6803 était axenic. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 6
Figure 6 : Données représentatives sur la croissance et valeurs de fluorescence eYFP normalisées à l'aide d'un lecteur de plaques. (A) Comparaison de croissance des souches portant cpcBA-eYFP ou le vecteur vide pPMQAK1-T (CT.0, contrôle négatif) dans Synechocystis PCC 6803 et S. elongatus UTEX 2973. Les valeurs sont les moyens - SE à partir de quatre répliques biologiques. Synéchocystis PCC 6803 et S. elongatus UTEX 2973 ont été cultivés pendant 72 h à 30 oC avec une lumière continue (100 photons m-2s-1) et 40 oC avec 300 photons m-2s-1, respectivement. (B) Valeurs normalisées de fluorescence eYFP pour Synechocystis PCC 6803 ou S. elongatus UTEX 2973 conjugué avec cpcBA-eYFP à 72 h. Les valeurs sont les moyens - SE de quatre répliques biologiques. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 7
Figure 7 : Valeurs représentatives de fluorescence eYFP à l'aide d'un cytomètre de débit. (A) Avant (FSC-H) et côté (SSC-H) éparpiller l'intrigue de la solution moyenne « vierge » (BG11 et PBS). (B) Scatter plot for a Synechocystis PCC 6803 sample (right). Le cercle indique la région sélectionnée qui éloigne la population de cyanobactéries du reste du signal de l'échantillon. (C) Histogramme de la région fermée pour une souche portant le vecteur vide pPMQAK1-T (CT.0, contrôle négatif). (D) Histogramme de la région fermée pour une souche portant cpcBA-eYFP. (E) valeurs de fluorescence eYFP par cellule dans Synechocystis PCC 6803 et S. elongatus UTEX 2973 à 72 h. La fluorescence du contrôle négatif a été soustraite. Les valeurs sont les moyens - SE à partir de quatre répliques biologiques. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

non. Vector ID nom description 5' surplomb 3' surplomb
1 pICH41233 pro organisateur GGAG GGAG tact
2 pICH41295 Pro 5U Promoteur et région non traduite à 5 ans et plus GGAG GGAG AATG (En)
3 pAGM1251 Pro 5U (f) Promoteur et séquence non traduite à 5 pour les fusions terminales N GGAG GGAG Ctac
4 pICH41246 5U (en) 5 région non traduite tact Ctac
5 pAGM1263 (en anglais) 5U (f) Séquence non traduite de 5 degrés pour les fusions terminales N tact Ctac
6 pICH41246 5U et NT1 Région non traduite et région de codage terminal N tact Ctac
7 pAGM1276 NT1 (en) Étiquette terminale N ou signal de localisation Ctac AATG (En)
8 pICH41258 Sp Peptide de signal AATG (En) AGGT (En)
9 pICH41258 NT2 (en) Étiquette terminale N ou signal de localisation AATG (En) AGGT (En)
10 pAGM1287 CDS1 ns Région de codage sans codon d'arrêt AATG (En) TTCG (en)
11 pICH41308 Arrêt CDS1 Région de codage avec codon d'arrêt AATG (En) GCTT (en)
12 pAGM1299 CDS2 ns Région de codage - sans démarrage et arrêt codon AGGT (En) TTCG (en)
13 pICH41264 Arrêt CDS2 Région de codage - sans démarrage et avec codon d'arrêt AGGT (En) GCTT (en)
14 pAGM1301 Ct Étiquette terminale C ou signal de localisation TTCG (en) GCTT (en)
15 pICH53388 3u Région non traduite de 3 GCTT (en) GGTA GGTA
16 pICH53399 Ter Terminator GGTA GGTA CGCT (en)
17 pICH41276 3U et Ter Région non traduite et terminaison non traduite GCTT (en) CGCT (en)
18 pICH41331 Cgm Accepteur pour cassettes génétiques complètes GGAG GGAG CGCT (en)
19 pCA0.002 Pro (faible copie) Promoteur, accepteur de numéro de copie faible (pSC101 ori) GGAG GGAG tact
20 pCA0.001 Pro TSS Promoteur tronqué sur le site de démarrage de la transcription GGAG GGAG LE TAGC
21 Directement au niveau 1 srRNA (en) Petit ARN réglementaire (pour le silençage translationnel) LE TAGC GTTT (GTTT)
22 Directement au niveau 1 sgRNA (en) ARN guide unique (pour CRISPRi) LE TAGC GTTT (GTTT)
23 pICH41295 LE FLANC VERS LE HAUT Séquence de flanc en amont du site de recombinaison homologue cible GGAG GGAG AATG (En)
24 pICH41276 FLANC EN BAS Séquence de flanc en aval du site de recombinaison homologue cible GCTT (en) CGCT (en)

Tableau 1 : Liste des vecteurs et surplombs disponibles des accepteurs de niveau 0. Les vecteurs 1 à 18 sont du kit Plant MoClo15. Les vecteurs 19-22 sont du kit CyanoGate12. Pour les parties srRNA et sgRNA, les séquences synthétisées ou les produits PCR sont assemblés directement dans les vecteurs d'accepteur de niveau 1. Les vecteurs 23-24 proviennent du kit Plant MoClo qui a été réutilisé pour la transformation par recombinaison homologue à l'aide du kit CyanoGate.

Composants d'assemblage BpiI (niveau 0, T) Composants d'assemblage BsaI (niveau 1)
50 à 100 ng de vecteur d'accepteur 50 à 100 ng de vecteur d'accepteur
Pour chaque vecteur/partie à insérer, utilisez un rapport de 2:1 d'insert : vecteur d'accepteur. Pour chaque vecteur/partie à insérer, utilisez un rapport de 2:1 d'insert : vecteur d'accepteur.
2 L 10 mM ATP (Tableau des matériaux) 2 L 10 mM ATP (Tableau des matériaux)
2 l tampon G (tampon pour BpiI/BsaI) 2 l tampon G (tampon pour BpiI/BsaI)
2 L BSA (10x) (Tableau des Matériaux) 2 L BSA (10x) (Tableau des Matériaux)
10 unités BpiI (1 L10 U/L BpiI, Table des Matériaux) 10 unités BsaI (1 l 10 U/L BsaI, Table des Matériaux)
Porter à 20 l avec dH2O. Porter à 20 l avec dH2O.
200 unités T4 DNA ligase (1 L 200 U/L, Table of Materials) 200 unités T4 DNA ligase (1 L 200 U/L, Table of Materials)
Protocole Thermocycler (Niveau 0, T) Protocole Thermocycler (niveau 1)
37 oC pendant 10 min cycle x 5 37 oC pendant 10 min cycle x 5
16 oC pendant 10 min 16 oC pendant 10 min
37 oC pour 20 min 37 oC pour 20 min
65 oC pendant 10 min 65 oC pendant 10 min
16 oC (maintenez) 16 oC (maintenez)

Tableau 2 : Protocoles pour les assemblées du Golden Gate aux niveaux 0, 1 et T. L'assemblage dans les vecteurs d'accepteur de niveau 0 et de niveau T utilise l'enzyme de restriction BpiI (à gauche). L'assemblage dans les vecteurs d'accepteurs de niveau 1 utilise l'enzyme de restriction BsaI (à droite). Cette table a été adaptée de Vasudevan et coll.12.

Primer No. Séquence (5'-3') Longueur (bp) description
L0T vers l'avant GTCTCATGAGCGGATACATACATA
TTTGAATG TTTGAATG TTTGAATG
28 Pour l'amplification à partir du niveau 0 et du niveau T
L1 inverse GAACCCTGTGGTGGCATGC
ACATAC (En)
26 Pour l'amplification à partir du niveau 1
L1 en avant CTGGTGGCAGGATATTTGT
GGTG GG
24 Pour l'amplification à partir du niveau 1
L0T inverse TTGAGTGAGCTGATACTACCGCT TTTGAGTGAGCTGATACTAC 20 Pour l'amplification à partir du niveau 0 et du niveau T

Tableau 3 : Liste des amorces pour la validation ou le séquençage des vecteurs de niveau 0, 1 et T.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

L'assemblage du Golden Gate présente plusieurs avantages par rapport à d'autres méthodes d'assemblage vectoriel, notamment en termes d'évolutivité20,21. Néanmoins, la mise en place du système Golden Gate dans un laboratoire nécessite du temps pour développer une familiarité avec les différentes parties et les bibliothèques vectorielles acceptor et les processus d'assemblage global. Une planification minutieuse est souvent nécessaire pour des assemblages plus complexes ou lors de l'exécution d'un grand nombre d'assemblages complexes en parallèle (p. ex., faire une suite de vecteurs de niveau T contenant plusieurs cassettes d'expression génique). Nous vous recommandons d'abord d'énumérer toutes les combinaisons de cassettes d'expression génique requises, puis de cartographier le flux de travail du niveau 0 au niveau T en silico. Au cours de ce processus, les utilisateurs doivent tenir compte des pièces « factices » de niveau 1 disponibles dans le kit Plant MoClo qui permettent l'assemblage de vecteurs de niveau 1 non séquentiels au niveau T (p. ex., les vecteurs de position 1 de niveau 1 et de position 3 peuvent être assemblés avec la partie « Factice » Position de niveau 1 2), qui peut réduire le nombre total de réactions d'assemblage et d'étapes de clonage requises15.

La synthèse de l'ADN est généralement la méthode la plus simple pour construire de nouvelles pièces de niveau 0. Toutefois, lorsque le clonage est nécessaire (p. ex., à partir de plasmides ou d'ADN génomique), il est important d'optimiser la conception des amorces utilisées pour l'amplification pour maximiser l'efficacité de l'assemblage vectoriel de niveau 0 subséquent. Les deux étapes les plus critiques de la conception des amorces sont : 1) vérifier que les surplombs corrects sont inclus et sont dans l'orientation appropriée pour les amorces avant et inversées(figure 1 et tableau 1), et 2) en veillant à ce que la longueur de l'amorce la séquence qui annexe au modèle est suffisamment longue (18 à 30 pb) et que la valeur Tm pour cette séquence (idéalement de 58 à 62 oC) est similaire pour la paire d'amorces (Figure 1A). Si une séquence nécessite une domestication, plusieurs stratégies sont disponibles. Pour les séquences courtes (p. ex., 200 pb), une paire d'amorces avant et inverses longues peuvent être conçues dans lesquelles les 3 extrémités annexes les unes aux autres (c.-à-d., un chevauchement de 20 pb) et forment une séquence à double brin après l'amplification. Pour des séquences plus longues, des fragments distincts de la séquence peuvent être amplifiés qui suppriment les sites de restriction illégaux, puis assemblés à l'aide d'une approche d'assemblage du Golden Gate (figure 2). Si l'efficacité de l'assemblage avec les produits PCR est faible, des fragments individuels d'une séquence de niveau 0 peuvent être clonés dans le vecteur d'accepteur universel de niveau 1 (pAGM1311), validés, puis assemblés ensemble dans le vecteur d'accepteur de niveau 0 approprié15. Un rapport molaire 2:1 insert:acceptor vector molar est recommandé pour l'assemblage efficace du Golden Gate. Toutefois, pour les assemblages de seulement 2-3 vecteurs (par exemple, deux parties de niveau 0 et un vecteur d'accepteur de niveau 1), la combinaison de 100 ngs de chacun e régulièrement donne généralement lieu à des assemblages réussis. L'efficacité des assemblages a tendance à diminuer à mesure que le nombre de vecteurs utilisés par réaction augmente, ce qui entraîne une réduction du nombre total de colonies blanches après la transformation (figure 3).

Avant la conjugaison, la validation des vecteurs de niveau T finalisés par la restriction digère et LE PCR est recommandé. Le transfert conjugal d'ADN est une technique bien stabilisée pour des souches cyanobactériennes, y compris celles qui ne sont pas naturellement transformables41,45. Les étapes importantes du protocole de conjugaison comprennent : 1) la manipulation soigneuse de la souche E. coli après la croissance du jour au lendemain (p. ex., éviter le vortex)35, 2) prendre soin d'enlever complètement les traces des antibiotiques utilisés pour cultiver l'aide et cargo E. coli souches, 3) une période d'incubation appropriée pour le mélange de souches de cargaison et d'aide et de cyanobactéries (p. ex., une période d'incubation plus longue était essentielle pour S. elongatus UTEX 2973), et 4) la période de transfert initiale de la cellule mélange sur les membranes dans les plaques d'agar LB-BG11 dépourvus d'antibiotiques pendant 24 h.

Les colonies cyanobactériennes isolées devraient se développer sur la membrane dans les deux semaines pour Synechocystis PCC 6803 et S. elongatus UTEX 2973, sinon il est probable que la conjugaison a échoué. Plusieurs modifications au protocole pourraient ensuite être testées, dont 1) en utilisant une culture cyanobactérienne avec une densité de départ plus élevée (p. ex., OD750 et 1,5-2); 2) augmenter la période d'incubation avant le transfert à la membrane; et 3) prolonger la période d'incubation initiale sur la membrane de 24 h à 48 h (c'est-à-dire pour laisser plus de temps pour l'expression du gène de résistance aux antibiotiques sur le vecteur transféré). Si la conjugaison échoue encore, d'autres méthodes telles que l'électroporation pourraient être essayées53. La confirmation d'une souche cyanobactérienne transgénique est axenic est important avant d'expérimenter davantage. Enfin, il est de bonne pratique de confirmer la taille du vecteur hétérologue de la souche cyanobactérienne transgénique. Cette dernière nécessite l'extraction de l'ADN (section 5), la transformation en E. coli et la sélection (section 2.1) et la validation vectorielle (section 2.4).

Le protocole de caractérisation des promoteurs décrit utilise de petits volumes de culture (c.-à-d. 2 mL) comme moyen d'atteindre une méthodologie de dépistage à haut débit. Des volumes plus importants pourraient être utilisés en fonction de l'espace photobioréacteur disponible, ce qui aiderait à atténuer les problèmes d'évaporation de la culture. Si un dépistage à haut débit avec de petits volumes de culture est nécessaire, il est essentiel d'avoir une humidité élevée dans la chambre de croissance pour inhiber l'évaporation. L'évaporation au cours d'une expérience de croissance peut nuire à l'exactitude et à la validité des mesures de l'échantillon. Vérifiez les volumes de culture pendant et après l'expérience pour confirmer la quantité d'évaporation.

Pour les mesures des lecteurs de plaques, il est important de mesurer les cultures à de faibles densités, idéalement OD750 lt; 1, pour assurer l'acquisition de données fiables et reproductibles de croissance et de fluorescence. Une relation linéaire entre le numéro de cellule et l'OD750 n'est observée que dans une plage spécifique54. Pour établir cette plage, nous recommandons d'effectuer une dilution en série (p. ex., à partir de750 OD et 0,1-1,0) à l'aide d'un transformateur connu où la fluorescence eYFP a été confirmée. Tracer la fluorescence absolue contre la fluorescence normalisée (fluorescence eYFP/OD750) aidera à identifier la gamme de travail linéaire des densités de culture. Plusieurs lecteurs de plaques comprennent une fonction de « gain » pour modifier la sensibilité du détecteur de fluorescence. Dans ce cas, la valeur de gain doit être fixée à un niveau approprié avant de commencer l'expérience et ne pas être modifiée entre différentes séries expérimentales ou les données ne seront pas directement comparables.

Bien que le fonctionnement de différents cytomètres de débit varie d'un fabricant à l'autre, il est important de prendre une lecture à blanc de la solution moyenne pour faciliter l'identification et le gating de la population cyanobactérienne cible à partir de n'importe quel signal de fond dans (figure7A,B). Par la suite, la soustraction de la valeur de fluorescence de l'échantillon témoin négatif (p. ex., une souche de type sauvage) aidera à éliminer l'autofluorescence indigène(figure 7C,D). Le paramètre de tension du tube photomultiplicateur (PMT) d'un cytomètre de débit a une fonction similaire au gain d'un lecteur de plaque, c'est-à-dire en augmentant ou en diminuant la sensibilité du détecteur à l'intensité du signal de fluorescence. Comme avec le lecteur de plaque, la tension PMT doit être réglé à un niveau approprié avant de commencer l'expérience55. Une fois réglé, la valeur de tension PMT doit être maintenue entre les différents runs expérimentaux ou les données ne seront pas directement comparables.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n'ont rien à révéler.

Acknowledgments

Les auteurs sont reconnaissants au Réseau de biotechnologie et de recherche en sciences biologiques (BBSRC) du PHYCONET Biotechnology and Biological Research Council (BBSRC) en biotechnologie industrielle et en bioénergie (NIBB) et au Centre d'innovation en biotechnologie industrielle (IBioIC) pour leur soutien financier. GARG, AASO et AP reconnaissent le soutien financier du programme de doctorat BBSRC EASTBIO CASE (numéro de subvention BB/M010996/1), du programme de doctorat Consejo Nacional de Ciencia y Tecnologa (CONACYT) et du programme de doctorat IBioIC-BBSRC Collaborative Training Partnership (CTP), respectivement. Nous remercions Conrad Mullineaux (Queen Mary University of London), et Poul Eric Jensen et Julie Annemarie Zita Zedler (Université de Copenhague) pour les contributions et les conseils du plasmique vectoriel et du protocole.

Materials

Name Company Catalog Number Comments
5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal) Thermo Fisher Scientific R0404 Used in 2.1.3.
Adenosine 5′-triphosphate (ATP) disodium salt Sigma-Aldrich A2383 Used in Table 2.
Agar (microbiology tested) Sigma-Aldrich A1296-500g Used in 8.3.
Agarose Bioline BIO-41026 Used in 6.
Attune NxT Flow Cytometer Thermo Fisher Scientific - Used in 4.3.1.
Bovine Serum Albumin (BSA) Sigma-Aldrich A2153 Used in Table 2.
BpiI (BbsI) Thermo Fisher Scientific ER1011 Used in Table 2.
BsaI (Eco31I) Thermo Fisher Scientific ER0291 Used in Table 2.
Carbenicillin disodium VWR International A1491.0005 Used in 2.1.3.
Corning Costar TC-Treated flat-bottom 24 well plates Sigma-Aldrich CLS3527 Used in 4.1.3.
Dimethyl Sulfoxide (DMSO) Thermo Fisher Scientific BP231-100 Used in 3.6.2.
DNeasy Plant Mini Kit Qiagen 69104 DNA extraction kit. Used in 5.
FLUOstar Omega Microplate reader BMG Labtech - Used in 4.2.2.
GeneJET Plasmid Miniprep Kit Thermo Fisher Scientific K0503 Plasmid purification kit. Used in step 2.3.2.
Glass beads (0.5 mm diameter) BioSpec Products 11079105 Used in 5.2.
Glycerol Thermo Fisher Scientific 10021083 Used in 2.3.1, 3.6.2.
Isopropyl-beta-D-thiogalactopyranoside (IPTG) Thermo Fisher Scientific 10356553 Used in 2.1.3.
Kanamycin sulphate (Gibco) Thermo Fisher Scientific 11815-024 Used in 2.1.3.
Membrane filters (0.45 μm) MF-Millipore HAWP02500 Used in 3.3.7
Microplates, 96-well, flat-bottom (Chimney Well) µCLEAR Greiner Bio-One 655096 Used in 4.2.1.
Monarch DNA Gel Extraction Kit New England Biolabs T1020S Used in 1.1.2.2.
Monarch PCR DNA Cleanup Kit New England Biolabs T1030 DNA purification kit. Used in 1.1.2.3.
Multitron Pro incubator with LEDs Infors HT - Shaking incubator with white LED lights. Used in 4.1.4.
MyTaq DNA Polymerase Bioline BIO-21108 Used in 7.1.
NanoDrop One Thermo Fisher Scientific ND-ONE-W Used in 2.3.3.
One Shot TOP10 chemically competent E. coli Thermo Fisher Scientific C404010 Used in 2.1.1.
Phosphate buffer saline (PBS) solution (10X concentrate) VWR International K813 Used in 4.3.2.
Q5High-Fidelity DNA Polymerase New England Biolabs M0491S Used in 1.1.2.1.
Quick-Load 1 kb DNA Ladder New England Biolabs N0468S Used in Figure 4.
Screw-cap tubes (1.5 ml) Starstedt 72.692.210 Used in 3.6.3
Spectinomycin dihydrochloride pentahydrate VWR International J61820.06 Used in 2.1.3.
Sterilin Clear Microtiter round-bottom 96-well plates Thermo Fisher Scientific 612U96 Used in 4.3.1.
T4 DNA ligase Thermo Fisher Scientific EL0011 Used in Table 2.
TissueLyser II Qiagen 85300 Bead mill. Used in 5.2.

DOWNLOAD MATERIALS LIST

References

  1. Luan, G., Lu, X. Tailoring cyanobacterial cell factory for improved industrial properties. Biotechnology Advances. 36, (2), 430-442 (2018).
  2. Madsen, M. A., Semerdzhiev, S., Amtmann, A., Tonon, T. Engineering mannitol biosynthesis in Escherichia coli and Synechococcus sp. PCC 7002 using a green algal fusion protein. ACS Synthetic Biology. 7, (12), 2833-2840 (2018).
  3. Menin, B., et al. Non-endogenous ketocarotenoid accumulation in engineered Synechocystis sp. PCC 6803. Physiologia Plantarum. 166, (1), 403-412 (2019).
  4. Varman, A. M., Yu, Y., You, L., Tang, Y. J. Photoautotrophic production of D-lactic acid in an engineered cyanobacterium. Microbial Cell Factories. 12, (1), 1-8 (2013).
  5. Vavitsas, K., et al. Responses of Synechocystis sp. PCC 6803 to heterologous biosynthetic pathways. Microbial Cell Factories. 16, 140 (2017).
  6. Yang, G., et al. Photosynthetic production of sunscreen shinorine using an engineered cyanobacterium. ACS Synthetic Biology. 7, (2), 664-671 (2018).
  7. Nielsen, A. Z., et al. Extending the biosynthetic repertoires of cyanobacteria and chloroplasts. Plant Journal. 87, (1), 87-102 (2016).
  8. Nielsen, J., Keasling, J. D. Engineering cellular metabolism. Cell. 164, (6), 1185-1197 (2016).
  9. Stensjö, K., Vavitsas, K., Tyystjärvi, T. Harnessing transcription for bioproduction in cyanobacteria. Physiologia Plantarum. 162, (2), 148-155 (2018).
  10. Santos-Merino, M., Singh, A. K., Ducat, D. C. New applications of synthetic biology tools for cyanobacterial metabolic engineering. Frontiers in Bioengineering and Biotechnology. 7, 1-24 (2019).
  11. Lea-Smith, D. J., Vasudevan, R., Howe, C. J. Generation of marked and markerless mutants in model cyanobacterial species. Journal of Visualized Experiments. 111, e54001 (2016).
  12. Vasudevan, R., et al. CyanoGate: A modular cloning suite for engineering cyanobacteria based on the plant MoClo syntax. Plant Physiology. 180, (1), 39-55 (2019).
  13. Andreou, A. I., Nakayama, N. Mobius assembly: A versatile golden-gate framework towards universal DNA assembly. PLoS ONE. 13, (1), 1-18 (2018).
  14. Crozet, P., et al. Birth of a Photosynthetic Chassis: A MoClo toolkit enabling synthetic biology in the microalga Chlamydomonas reinhardtii. ACS Synthetic Biology. 7, (9), 2074-2086 (2018).
  15. Engler, C., et al. A Golden Gate modular cloning toolbox for plants. ACS Synthetic Biology. 3, (11), 839-843 (2014).
  16. Moore, S. J., et al. EcoFlex: A multifunctional MoClo kit for E. coli synthetic biology. ACS Synthetic Biology. 5, (10), 1059-1069 (2016).
  17. Pollak, B., et al. Loop assembly: a simple and open system for recursive fabrication of DNA circuits. New Phytologist. 222, (1), 628-640 (2019).
  18. Werner, S., Engler, C., Weber, E., Gruetzner, R., Marillonnet, S. Fast track assembly of multigene constructs using golden gate cloning and the MoClo system. Bioengineered Bugs. 3, (1), 38-43 (2012).
  19. Patron, N. J., et al. Standards for plant synthetic biology: a common syntax for exchange of DNA parts. New Phytologist. 208, (1), 13-19 (2015).
  20. Chao, R., Mishra, S., Si, T., Zhao, H. Engineering biological systems using automated biofoundries. Metabolic Engineering. 42, 98-108 (2017).
  21. Chambers, S., Kitney, R., Freemont, P. The Foundry: the DNA synthesis and construction Foundry at Imperial College. Biochemical Society Transactions. 44, (3), 687-688 (2016).
  22. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  23. Rosano, G. L., Ceccarelli, E. A. Rare codon content affects the solubility of recombinant proteins in a codon bias-adjusted Escherichia coli strain. Microbial Cell Factories. 8, 1-9 (2009).
  24. Cambray, G., et al. Measurement and modeling of intrinsic transcription terminators. Nucleic Acids Research. 41, (9), 5139-5148 (2013).
  25. Chen, Y. J., et al. Characterization of 582 natural and synthetic terminators and quantification of their design constraints. Nature Methods. 10, (7), 659-664 (2013).
  26. Münch, R., et al. Virtual Footprint and PRODORIC: An integrative framework for regulon prediction in prokaryotes. Bioinformatics. 21, (22), 4187-4189 (2005).
  27. Salis, H. M., Mirsky, E. A., Voigt, C. A. Automated design of synthetic ribosome binding sites to control protein expression. Nature Biotechnology. 27, (10), 946-950 (2009).
  28. Englund, E., Liang, F., Lindberg, P. Evaluation of promoters and ribosome binding sites for biotechnological applications in the unicellular cyanobacterium Synechocystis sp. PCC 6803. Scientific Reports. 6, 36640 (2016).
  29. Heidorn, T., et al. Synthetic biology in cyanobacteria engineering and analyzing novel functions. Methods in Enzymology. 497, 539-579 (2011).
  30. Thiel, K., et al. Translation efficiency of heterologous proteins is significantly affected by the genetic context of RBS sequences in engineered cyanobacterium Synechocystis sp. PCC 6803. Microbial Cell Factories. 17, 34 (2018).
  31. Liu, Q., Schumacher, J., Wan, X., Lou, C., Wang, B. Orthogonality and burdens of heterologous and gate gene circuits in E. coli. ACS Synthetic Biology. 7, (2), 553-564 (2018).
  32. Ferreira, E. A., et al. Expanding the toolbox for Synechocystis sp. PCC 6803: Validation of replicative vectors and characterization of a novel set of promoters. Synthetic Biology. (August), 1-39 (2018).
  33. Liang, F., Lindblad, P. Synechocystis PCC 6803 overexpressing RuBisCO grow faster with increased photosynthesis. Metabolic Engineering Communications. 4, 29-36 (2017).
  34. Taton, A., et al. Broad-host-range vector system for synthetic biology and biotechnology in cyanobacteria. Nucleic Acids Research. 42, (17), e136 (2014).
  35. Elhai, J., Wolk, C. P. Conjugal transfer of DNA to cyanobacteria. Methods in Enzymology. 167, (1984), 747-754 (1988).
  36. Gormley, E. P., Davies, J. Transfer of plasmid RSF1010 by conjugation from Escherichia coli to Streptomyces lividans and Mycobacterium smegmatis. Journal of Bacteriology. 173, (21), 6705-6708 (1991).
  37. Huang, H. H., Camsund, D., Lindblad, P., Heidorn, T. Design and characterization of molecular tools for a synthetic biology approach towards developing cyanobacterial biotechnology. Nucleic Acids Research. 38, (8), 2577-2593 (2010).
  38. Huang, H. H., Lindblad, P. Wide-dynamic-range promoters engineered for cyanobacteria. Journal of Biological Engineering. 7, 10 (2013).
  39. Li, S., Sun, T., Xu, C., Chen, L., Zhang, W. Development and optimization of genetic toolboxes for a fast-growing cyanobacterium Synechococcus elongatus UTEX 2973. Metabolic Engineering. 48, 163-174 (2018).
  40. Pansegrau, W., Balzer, D., Kruft, V., Lurz, R., Lanka, E. In vitro assembly of relaxosomes at the transfer origin of plasmid RP4. Proceedings of the National Academy of Sciences, USA. 87, (17), 6555-6559 (1990).
  41. Song, K., Tan, X., Liang, Y., Lu, X. The potential of Synechococcus elongatus UTEX 2973 for sugar feedstock production. Applied Microbiology and Biotechnology. 100, (18), 7865-7875 (2016).
  42. Waters, V. L., Guiney, D. G. Processes at the nick region link conjugation, T-DNA transfer and rolling circle replication. Molecular Microbiology. 9, (6), 1123-1130 (1993).
  43. Elhai, J., Vepritskiy, A., Muro-Pastor, A. M., Flores, E., Wolk, C. P. Reduction of conjugal transfer efficiency by three restriction activities of Anabaena sp. strain PCC 7120. Journal of Bacteriology. 179, (6), 1998-2005 (1997).
  44. Silva-Rocha, R., et al. The Standard European Vector Architecture (SEVA): A coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research. 41, (D1), D666-D675 (2013).
  45. Mandakovic, D., et al. CyDiv, a conserved and novel filamentous cyanobacterial cell division protein involved in septum localization. Frontiers in Microbiology. 7, (FEB), 1-11 (2016).
  46. Masukawa, H., Inoue, K., Sakurai, H., Wolk, C. P., Hausinger, R. P. Site-directed mutagenesis of the Anabaena sp. strain PCC 7120 nitrogenase active site to increase photobiological hydrogen production. Applied and Environmental Microbiology. 76, (20), 6741-6750 (2010).
  47. Yu, J., et al. Synechococcus elongatus UTEX 2973, a fast growing cyanobacterial chassis for biosynthesis using light and CO2. Scientific Reports. 5, (1), 8132 (2015).
  48. Ungerer, J., Wendt, K. E., Hendry, J. I., Maranas, C. D., Pakrasi, H. B. Comparative genomics reveals the molecular determinants of rapid growth of the cyanobacterium Synechococcus elongatus UTEX 2973. Proceedings of the National Academy of Sciences, USA. 115, (50), E11761-E11770 (2018).
  49. Lepesteur, M., Martin, J. M., Fleury, A. A comparative study of different preservation methods for phytoplankton cell analysis by flow cytometry. Marine Ecology Progress Series. 93, (1-2), 55-63 (1993).
  50. Day, J. G. Cryopreservation of cyanobacteria. Cyanobacteria: An Economic perspective. Wiley Blackwell. New York. 319-327 (2014).
  51. Zhou, J., et al. Discovery of a super-strong promoter enables efficient production of heterologous proteins in cyanobacteria. Scientific Reports. 4, 4500 (2014).
  52. Potapov, V., et al. Comprehensive profiling of four base overhang ligation fidelity by T4 DNA ligase and application to DNA assembly. ACS Synthetic Biology. 7, (11), 2665-2674 (2018).
  53. Ravindran, C. R. M., Suguna, S., Shanmugasundaram, S. Electroporation as a tool to transfer the plasmid pRL489 in Oscillatoria MKU 277. Journal of Microbiological Methods. 66, 174-176 (2006).
  54. Stevenson, K., McVey, A. F., Clark, I. B. N., Swain, P. S., Pilizota, T. General calibration of microbial growth in microplate readers. Scientific Reports. 6, 38828 (2016).
  55. Maecker, H. T., Trotter, J. Flow cytometry controls, instrument setup, and the determination of positivity. Cytometry Part A. 69, (9), 1037-1042 (2006).
Modification génétique des cyanobactéries par conjugaison à l'aide de la boîte à outils de clonage modulaire CyanoGate
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Gale, G. A. R., Schiavon Osorio, A. A., Puzorjov, A., Wang, B., McCormick, A. J. Genetic Modification of Cyanobacteria by Conjugation Using the CyanoGate Modular Cloning Toolkit. J. Vis. Exp. (152), e60451, doi:10.3791/60451 (2019).More

Gale, G. A. R., Schiavon Osorio, A. A., Puzorjov, A., Wang, B., McCormick, A. J. Genetic Modification of Cyanobacteria by Conjugation Using the CyanoGate Modular Cloning Toolkit. J. Vis. Exp. (152), e60451, doi:10.3791/60451 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter