Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

साइनोगेट मॉड्यूलर क्लोनिंग टूलकिट का उपयोग करके साइनोबैक्टीरिया का आनुवंशिक संशोधन

doi: 10.3791/60451 Published: October 31, 2019
* These authors contributed equally

Summary

यहाँ, हम एक प्रोटोकॉल प्रस्तुत करने का वर्णन कैसे i) एक स्वयं प्रतिकृति वेक्टर को इकट्ठा CyanoGate मॉड्यूलर क्लोनिंग टूलकिट का उपयोग कर, ii) संयोजन द्वारा एक cyanobactrial मेजबान में वेक्टर परिचय, और iii) ट्रांसजेनिक cyanobacteria उपभेदों का उपयोग कर एक विशेषता प्लेट रीडर या प्रवाह साइटोमेट्री।

Abstract

सायनोबैक्टीरिया प्रोकैरियोटिक प्रकाश संश् लेषी जीवों का एक विविध समूह है जिसे उपयोगी औद्योगिक वस्तुओं के नवीकरणीय उत्पादन के लिए आनुवंशिक रूप से संशोधित किया जा सकता है। सिंथेटिक जीव विज्ञान में हाल ही में प्रगति ऐसे CyanoGate, बाद में परिवर्तन या सायनोबैक्टीरिया में भ्रमपूर्ण हस्तांतरण के लिए प्लाज्मिड वेक्टर के निर्माण के लिए एक मानकीकृत मॉड्यूलर क्लोनिंग प्रणाली के रूप में कई क्लोनिंग toolkits के विकास के लिए नेतृत्व किया है. यहाँ हम एक आत्म प्रतिकृति वेक्टर संयोजन के लिए एक विस्तृत विधि रूपरेखा (उदाहरण के लिए, एक फ्लोरोसेंट मार्कर अभिव्यक्ति कैसेट ले जाने) और साइनोबैक्टीरियल उपभेदों में वेक्टर के संयुग्मी हस्तांतरण Synechocystis सपा पीसीसी 6803 या Synechococcus लम्बी UTEX 2973. इसके अलावा, हम एक प्लेट रीडर या प्रवाह साइटोमेट्री का उपयोग कर के एक आनुवंशिक भाग (उदा., एक प्रमोटर) के प्रदर्शन की विशेषता के लिए कैसे रूपरेखा.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

सायनोबैक्टीरिया ऑटोट्रॉफिक बैक्टीरिया हैं जिनका उपयोग विभिन्न प्रकार के प्राकृतिक और विषम-वैतरणी उच्च मूल्य के चयापचय उत्पादों1,2,3,4,5के जैव संश्लेषण के लिए किया जा सकता है, 6. कई बाधाओं को अभी भी अपनी वाणिज्यिक व्यवहार्यता का विस्तार करने के लिए दूर करने की जरूरत है, सबसे विशेष रूप से, विषमपोषी जैव-प्लेटफ़ॉर्म (उदाहरण के लिए, Escherichia कोलाई और खमीर)7की तुलना में अपेक्षाकृत गरीब पैदावार. उपलब्ध आनुवंशिक इंजीनियरिंग उपकरणों के हाल के विस्तार और साइनोबैक्टीरियल अनुसंधान में सिंथेटिक जीव विज्ञान प्रतिमान के तेज ऐसी चुनौतियों पर काबू पाने और आगे कुशल biofactorys8के रूप में साइनोबैक्टीरिया विकसित करने में मदद कर रहा है, 9,10.

साइनोबैक्टीरिया में डीएनए को शुरू करने के लिए मुख्य दृष्टिकोण परिवर्तन, संयोजन और इलेक्ट्रोपोरेशन हैं। परिवर्तन या इलेक्ट्रोपोरेशन द्वारा सायनोबैक्टीरिया को स्थानांतरित किए गए वेक्टर "आत्महत्या" सदिश हैं (यानी, एकीकृत सदिश जो समजात पुनर्संयोजन की सुविधा प्रदान करते हैं), जबकि आत्म-प्रतिकृति सदिशों को सायनोबैक्टीरिया को स्थानांतरित किया जा सकता है रूपांतरण, संयोजन या विद्युत पोट्रेशन. पूर्व के लिए, एक प्रोटोकॉल इंजीनियरिंग मॉडल प्रजातियों के लिए उपलब्ध है प्राकृतिक परिवर्तन11के लिए अनुकूल है. हाल ही में, सायनोबैक्टीरिया के लिए एक मॉड्यूलर क्लोनिंग (MoClo) टूलकिट विकसित किया गया है जिसे सायनोगेट कहा जाता है, प्राकृतिक रूपांतरण, इलेक्ट्रोपोरेशन या कंजुगेशन12का उपयोग करके इंजीनियरिंग के लिए एक मानकीकृत गोल्डन गेट वेक्टर असेंबली विधि को रोजगार देता है।

गोल्डन गेट प्रकार विधानसभा तकनीक हाल के वर्षों में तेजी से लोकप्रिय हो गए हैं, और विधानसभा मानकों और भाग पुस्तकालयोंअब 13,14,15,16 जीवों की एक किस्म के लिए उपलब्ध हैं ,17. गोल्डन गेट प्रकार आईआईएस प्रतिबंध एंजाइमों का उपयोग करता है (उदा., BsaI, BpiI, BsmBI, Btg]I और AarI) और स्वीकारकर्ताओं और अद्वितीय overhangs के एक सूट के लिए एक "एक बर्तन" विधानसभा प्रतिक्रिया में कई दृश्यों के दिशात्मक पदानुक्रम विधानसभा की सुविधा. प्रकार IIS प्रतिबंध एंजाइमों एक अद्वितीय असममित अनुक्रम पहचान और उनकी मान्यता साइटों से एक परिभाषित दूरी में कटौती करने के लिए एक चौंका हुआ उत्पन्न करने के लिए, "स्टिकी अंत" कटौती (आमतौर पर एक 4 न्यूक्लिओटाइड [NT] overhang), जो बाद में आदेश दिया डीएनए ड्राइव करने के लिए शोषण किया जा सकता विधानसभा प्रतिक्रियाओं15,18. यह मॉड्यूलर स्तर 0 भागों के बड़े पुस्तकालयों के विकास में मदद की है (जैसे, प्रमोटरों, खुला पढ़ने फ्रेम और टर्मिनेटर) एक आम वाक्यविन्यास द्वारा परिभाषित, जैसे PhytoBricks मानक19. स्तर 0 भागों तो आसानी से स्तर 1 अभिव्यक्ति कैसेट में इकट्ठा किया जा सकता है, जिसके बाद और अधिक जटिल उच्च आदेश विधानसभाओं (उदा. multigene अभिव्यक्ति constructs) पसंद के एक acceptor वेक्टर में बनाया जा सकताहै 12,15. गोल्डन गेट प्रकार विधानसभा तकनीकों का एक प्रमुख लाभ इस तरह के डीएनए फाउंड्री20,21,जो जटिल प्रयोगात्मक डिजाइन के परीक्षण के लिए अनुमति दे सकते हैं के रूप में उच्च throughput सुविधाओंपरस्वचालन के लिए उनकी सुविधा है कि आसानी से शारीरिक श्रम द्वारा प्राप्त नहीं किया जा सकता है.

CyanoGate स्थापित संयंत्र MoClo प्रणाली12,15पर बनाता है . CyanoGate में एक नया हिस्सा शामिल करने के लिए, भाग अनुक्रम पहले पालतू होना चाहिए, यानी, BsAI और BpiI के लिए "अवैध" मान्यता साइटों को हटाया जाना चाहिए. एक खुला पढ़ने के फ्रेम के लिए एक भाग कोडिंग के मामले में (यानी, एक कोडिंग अनुक्रम, सीडीएस), मान्यता साइटों अनुक्रम में पर्याय उत्परिवर्तन पैदा करके बाधित किया जा सकता है (यानी, एक विकल्प है कि एक ही एमिनो एसिड अवशेषों के लिए encodes के लिए एक codon बदलने). यह दृष्टिकोण की एक किस्म के द्वारा प्राप्त किया जा सकता है, डीएनए संश्लेषण से लेकर polymerase श्रृंखला प्रतिक्रिया (पीसीआर) प्रवर्धन आधारित रणनीतियों जैसे गिब्सन विधानसभा22. अभिव्यक्ति मेजबान इस्तेमाल किया जा रहा है पर निर्भर करता है, देखभाल दुर्लभ codons कि अनुवाद23की दक्षता को बाधित कर सकता है की शुरूआत से बचने के लिए लिया जाना चाहिए. प्रमोटर और टर्मिनेटर दृश्यों में मान्यता साइटों को हटाना आम तौर पर एक जोखिम भरा प्रयास है, के रूप में संशोधन ों समारोह को प्रभावित कर सकते हैं और हिस्सा उम्मीद के रूप में प्रदर्शन नहीं हो सकता है. उदाहरण के लिए, एक प्रमोटर के भीतर putative प्रतिलेखन कारक बाध्यकारी साइटों या राइबोसोम बाइंडिंग साइट में परिवर्तन को शामिल करने के लिए शक्ति और प्रतिक्रिया को बदल सकता है / इसी तरह, प्रमुख टर्मिनेटर संरचनात्मक सुविधाओं में संशोधन (जैसे, जीसी अमीर स्टेम, पाश और पाली-यू पूंछ) समाप्ति दक्षता और प्रभाव जीन अभिव्यक्ति24,25बदल सकते हैं। हालांकि कई ऑनलाइन संसाधनों प्रमोटर और टर्मिनेटर दृश्यों की गतिविधि की भविष्यवाणी करने के लिए उपलब्ध हैं, और सूचित करें कि क्या एक प्रस्तावित उत्परिवर्तन प्रदर्शन को प्रभावित करेगा26,27, इन उपकरणों अक्सर गरीब भविष्यवक्ताओं के हैं सायनोबैक्टीरिया28,29,30 मेंप्रदर्शन . . . इस प्रकार, संशोधित भागों के विवो अभिलक्षण न होने से अभी भी गतिविधि की पुष्टि करने की सिफारिश की जाती है। पुनर्गणना अनुक्रमों की क्लोनिंग में सहायता करने के लिए, सायनोगेट में बायोब्रिक वेक्टर pSB4K512,16,31पर आधारित कम कॉपी क्लोनिंग ग्राही वेक्टर शामिल है। इसके अलावा, एक "डिजाइन और निर्माण" पोर्टल एडिनबर्ग जीनोम फाउंड्री के माध्यम से उपलब्ध है वेक्टर डिजाइन (dab.genomefoundry.org) के साथ मदद करने के लिए. अंत में, और सबसे महत्वपूर्ण बात, CyanoGate दो स्तर टी acceptor वेक्टर डिजाइन (स्तर 2 स्वीकारकर्ता सदिश ोंक के बराबर)15 आत्महत्या सदिशों का उपयोग कर cyanobacteria में डीएनए शुरू करने के लिए, या व्यापक मेजबान रेंज वेक्टर स्व प्रतिकृति में सक्षम शामिल हैं कई सायनोबैक्टीरियल प्रजातियों में32,33,34.

यहाँ हम स्तर टी स्वयं प्रतिकृति वैक्टर और Synechocystis पीसीसी 6803 और Synechococcus longatus UTEXT 2973(Synechocystis पीसीसी 6803 और एस लम्बी के आनुवंशिक संशोधन के लिए एक प्रोटोकॉल का वर्णन करने पर ध्यान दिया जाएगा UTEXT 2973 इसके बाद) द्वारा संयोजन (भी त्रि-माता पिता संभोग के रूप में जाना जाता है). जीवाणु कोशिकाओं के बीच डीएनए के वैंकेदार हस्तांतरण एक अच्छी तरह से वर्णित प्रक्रिया है और पहले इंजीनियरिंग साइनोबैक्टीरियल प्रजातियों के लिए इस्तेमाल किया गया है, विशेष रूप से उन है कि स्वाभाविक रूप से सक्षम नहीं हैं, जैसे एस longatus UTEXT 297335, 36,37,38,39,40,41. संक्षेप में, सायनोबैक्टीरियल संस्कृतियों को एक ई. कोलाई तनाव के साथ इनक्यूबेट किया जाता है जो वेक्टर को स्थानांतरित किया जा सकता है ("कार्गो" वेक्टर) और वेक्टर (या तो उसी ई. कोलाई तनाव में या अतिरिक्त उपभेदों में) को संयोजन सक्षम करने के लिए ("मोबिलेयर" और "सहायक" सदिश). चार प्रमुख शर्तों को होने के लिए जुगल स्थानांतरण के लिए आवश्यक हैं: 1) डीएनए हस्तांतरण में शामिल कोशिकाओं के बीच सीधा संपर्क, 2) कार्गो वेक्टर संयोजन प्रणाली के साथ संगत होना चाहिए (यानी, यह हस्तांतरण का एक उपयुक्त मूल होना चाहिए (oriT), यह भी एक बोम (मोबिलिटी के आधार) साइट के रूप में जाना जाता है, 3) एक डीएनए निकिंग प्रोटीन (जैसे, भीड़ जीन द्वारा इनकोडिंग) कि oriT पर डीएनए nicks के लिए साइन इन करने के लिए साइनोबैक्टीरियम में डीएनए के एकल फैला हस्तांतरण आरंभ करने के लिए उपस्थित होना चाहिए और व्यक्त या तो कार्गो या सहायक सदिशों से, और 4) स्थानांतरित डीएनए प्राप्तकर्ता साइनोबैक्टीरियम में नष्ट नहीं किया जाना चाहिए (यानी, द्वारा गिरावट के लिए प्रतिरोधी होना चाहिए, उदाहरण के लिए, प्रतिबंध endonuclease गतिविधि)35,42. कार्गो वेक्टर को बनाए रखने के लिए, प्रतिकृति का मूल प्राप्तकर्ता cyanobacterium के साथ संगत होना चाहिए ताकि बेटी कोशिकाओं में आत्म-प्रतिकृति और प्रसार के लिए अनुमति दी जा सके। शर्तों के साथ सहायता करने के लिए 3 और 4, कई सहायक सदिश Addgene और अन्य वाणिज्यिक स्रोतों के माध्यम से उपलब्ध हैं कि भीड़ के लिए सांकेतिक संबंध के रूप में के रूप में अच्छी तरह से कई methylases मेजबान cyanobacterium43में देशी endonucleases से बचाने के लिए . इस प्रोटोकॉल में, एक MC1061 ई. कोलाई तनाव द्वारा क्रमशः कार्यकर्ता और सहायक वैक्टर pRK24 (www.addgeneorg/51950) और pRL528 (www.addgene.org/58495) द्वारा संयोजन की सुविधा प्रदान की गई थी। जब कैक्टर को संयुग्मी स्थानांतरण के लिए उपयोग किया जाना है तो सावधानी बरती जानी चाहिए। उदाहरण के लिए, CyanoGate किट में स्वयं प्रतिकृति कार्गो वेक्टर pPMQAK1-टी एक भीड़ प्रोटीन12के लिए encodes . हालांकि, pSEVA421-T44नहीं करता है, और इस तरह के रूप में, भीड़ एक उपयुक्त सहायक वेक्टर से व्यक्त किया जाना चाहिए। इस्तेमाल किया वेक्टर भी लक्ष्य जीव के लिए उपयुक्त होना चाहिए. उदाहरण के लिए, Anabaena sp. PCC 7120 में कुशल वैंग्यूगल स्थानांतरण एक सहायक वेक्टर की आवश्यकता है जो पाचन के विरुद्ध कार्यकर्ता वेक्टर की रक्षा करता है (उदाहरण के लिए, pRL623, जो तीन मिथाइलेस AvaiM, Eco47iiM और Ecot22iM के लिए encodes)45, 46.

इस प्रोटोकॉल में हम आगे रूपरेखा कैसे भागों के प्रदर्शन की विशेषता के लिए (यानी, प्रमोटरों) एक फ्लोरोसेंट मार्कर के साथ एक प्लेट रीडर या एक प्रवाह cytometer का उपयोग कर. प्रवाह cytometers एक बड़ी आबादी के लिए एक एकल सेल के आधार पर फ्लोरोसेंट को मापने में सक्षम हैं. इसके अलावा, प्रवाह cytometers उपयोगकर्ताओं को "गेट" प्राप्त डेटा और पृष्ठभूमि शोर को दूर करने के लिए अनुमति देते हैं (जैसे, संस्कृति या संदूषण में कण पदार्थ से). इसके विपरीत, प्लेट पाठकों संस्कृति के एक दिए गए मात्रा का एक समग्र फ्लोरोसेंट माप प्राप्त, आम तौर पर कई दोहराने कुओं में. cytometers पर प्लेट पाठकों के प्रमुख लाभ कम लागत, उच्च उपलब्धता और आम तौर पर डाउनस्ट्रीम डेटा विश्लेषण के लिए विशेषज्ञ सॉफ्टवेयर के लिए कोई आवश्यकता शामिल हैं. प्लेट पाठकों की मुख्य कमियां cytometers और मापा संस्कृतियों के ऑप्टिकल घनत्व के साथ संभावित मुद्दों की तुलना में अपेक्षाकृत कम संवेदनशीलता हैं. तुलनात्मक विश्लेषण के लिए, प्लेट रीडर नमूने प्रत्येक अच्छी तरह से के लिए सामान्यीकृत किया जाना चाहिए (उदाहरण के लिए, संस्कृति घनत्व की एक माप के लिए, आम तौर पर 750 एनएम [OD750] पर ऑप्टिकल घनत्व पर अवशोषण के रूप में लिया, जो नमूने के लिए inaccuracies के लिए नेतृत्व कर सकते हैं कि भी कर रहे हैं घने और/या अच्छी तरह से मिश्रित नहीं (उदा., जब एकत्रीकरण या flocculation के लिए प्रवण).

एक सिंहावलोकन के रूप में, यहाँ हम विस्तार से स्तर 0 भागों पैदा करने के सिद्धांतों, CyanoGate किट और एक कंज्यूगल हस्तांतरण के लिए उपयुक्त एक वेक्टर में क्लोनिंग का उपयोग कर पदानुक्रमित विधानसभा के बाद प्रदर्शित करते हैं. हम तो एक फ्लोरोसेंट मार्कर व्यक्त कुल्हाड़ी transconzuant उपभेदों का चयन, और एक प्रवाह साइटोमीटर या एक प्लेट रीडर का उपयोग कर फ्लोरोसेंट डेटा के बाद अधिग्रहण का प्रदर्शन संघटना हस्तांतरण प्रक्रिया.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. संयंत्र MoClo और CyanoGate Toolkits का उपयोग कर वेक्टर विधानसभा

नोट: वेक्टर विधानसभा के साथ आगे बढ़ने से पहले, यह दृढ़ता से सिफारिश की है कि उपयोगकर्ताओं को खुद को संयंत्र और CyanoGate MoClo सिस्टम12,15के वेक्टर स्तर संरचनाओं के साथ परिचित .

  1. स्तर 0 भागों का निर्माण
    नोट: स्तर 0 भागों पूर्ण सदिश ों के रूप में संश्लेषित किया जा सकता है या स्तर 0 स्वीकारकर्ताओं (जैसे, gBlocks, IDT) के साथ विधानसभा के लिए रैखिक दृश्यों के रूप में। वैकल्पिक रूप से, दृश्यों एक स्रोत टेम्पलेट से परिलक्षित किया जा सकता है (उदाहरण के लिए, एक वेक्टर या शुद्ध जीनोमिक डीएनए). यहाँ, कैसे एक प्रवर्धित उत्पाद से एक नया स्तर 0 भाग जनरेट करने के लिए वर्णन किया गया है। स्तर 0 से स्तर टी के लिए गोल्डन गेट विधानसभा प्रक्रिया का अवलोकन में दिखाया गया हैचित्र 1.
    1. प्राइमर डिजाइन.
      1. निर्णय लेते हैं कि उपयुक्त 5 "और 3] ओवरहैंग्स (तालिका 1)12 , 15को इकट्ठा करने और पहचानने के लिए कौन से स्तर 0 मॉड्यूल का पता लगाया जाए . BPII या BsaI प्रतिबंध साइटों की उपस्थिति के लिए क्लोन करने के लिए डीएनए अनुक्रम की जाँच करें.
        नोट: इन साइटों में से एक वाले अनुक्रम प्रतिबंध साइट अनुक्रम में एक या अधिक NTs को संशोधित करके पालतू होना चाहिए। गोल्डन गेट एसेम्बली का उपयोग करने के लिए एक रणनीति चित्र 2में रेखांकित की गई है ।
      2. एक डीएनए अनुक्रम बढ़ाना, एक उपयुक्त आगे और रिवर्स प्राइमर जोड़ी डिजाइन. आगे प्राइमर के लिए, डीएनए टेम्पलेट अनुक्रम के 5 "अंत के पूरक 18"30 बीपी का चयन करें। रिवर्स प्राइमर के लिए, डीएनए टेम्पलेट अनुक्रम के 3 डिग्री अंत के पूरक को 18"30 बीपी रिवर्स करें का चयन करें।
        नोट: पिघलते तापमान (टी) के साथ प्राइमर 58 डिग्री 62 डिग्री सेल्सियस के साथ प्राइमर आमतौर पर सबसे सुसंगत प्रवर्धन परिणाम देते हैं (चित्र 1)।
      3. आगे प्राइमर के 5 "अंत करने के लिए निम्नलिखित जोड़ें: 1) BpiI साइट के 5 "अंत में 4 "6 NTs की एक यादृच्छिक स्ट्रिंग, 2) BpiI प्रतिबंध साइट (GAAGAC), 3) दो यादृच्छिक NTs, और 4) 5 "ओवरहैंग चरण 1.1.1.1 में चयनित. रिवर्स प्राइमर के 5 "अंत करने के लिए निम्नलिखित जोड़ें: 1) BpiI साइट के 5 "अंत में 4 "6 NTs की एक यादृच्छिक स्ट्रिंग, 2) BpiI प्रतिबंध साइट (GAAGAC), 3) दो यादृच्छिक NTs, और 4) 3 "ओवरहैंग चरण 1.1.1.1 में चयनित. जब अंतिम रूप दिया, प्राइमर जोड़े आदेश.
        नोट: आगे और रिवर्स प्राइमर जोड़ी के उदाहरण के लिए चित्र 1A देखें।
    2. जीनोमिक डीएनए से एक डीएनए अनुक्रम बढ़ाना.
      1. अनुभाग 5 में वर्णित के रूप में जीनोमिक डीएनए निकालें. पीसीआर द्वारा उत्पादों को एक उच्च निष्ठा डीएनए पॉलिमरेज(सामग्री की तालिका) काउपयोग करके बढ़ाना।
        नोट: एक उदाहरण के रूप में, निर्माता के निर्देशों के अनुसार PCR प्रतिक्रियाओं (20 डिग्री 50 $L) की स्थापना की। प्रति प्रतिक्रिया जीनोमिक डीएनए के $100 एनजी का प्रयोग करें। 30 s के लिए 98 डिग्री सेल्सियस के एक प्रारंभिक विकृतीकरण कदम से मिलकर एक थर्मल साइकिल कार्यक्रम का उपयोग करें, 10 s के लिए 98 डिग्री सेल्सियस पर विकृतीकरण के 25 से अधिक चक्र के बाद, प्राइमर 15 s के लिए 58 डिग्री सेल्सियस पर annealing और 30 s के लिए 72 डिग्री सेल्सियस पर उत्पाद विस्तार (बाद में संशोधन के आधार पर उत्पाद का आकार / डीएनए polymerase के प्रकार का इस्तेमाल किया), 2 मिनट के लिए 72 डिग्री सेल्सियस के एक अंतिम विस्तार कदम के बाद.
      2. पीसीआर उत्पाद जेल शुद्ध किया जा करने के लिए है, तो खंड 6 में वर्णित के रूप में एक agarose जेल पर पूरे पीसीआर प्रतिक्रिया चलाएँ। agarose जेल से बाहर ब्याज के बैंड में कटौती और यह एक जेल निष्कर्षण किट का उपयोग कर शुद्ध (सामग्री की तालिका) .
      3. कदम के लिए वैकल्पिक 1.1.2.2, पीसीआर उत्पाद जेल शोधन के बिना इस्तेमाल किया जा करने के लिए है, एक agarose जेल पर पीसीआर प्रतिक्रिया नमूना ($ 5 $L) के एक aliquot चलाने के द्वारा बैंड आकार की पुष्टि करें। यदि जेल केवल उपयुक्त बैंड और प्राइमर dimers का कोई सबूत नहीं दिखाता है, पीसीआर उत्पाद शुद्ध एक डीएनए शुद्धि किट का उपयोग कर (सामग्री की तालिका).
      4. एक उच्च डीएनए एकाग्रता प्राप्त करने के लिए deionized पानी की एक छोटी मात्रा में Elute शुद्ध डीएनए (उदाहरण के लिए, 10 डिग्री सेल्सियस) एक उच्च डीएनए एकाग्रता प्राप्त करने के लिए (और 20 एनजी /
    3. स्तर 0 में प्रवर्धित डीएनए उत्पाद (या उत्पाद, चित्र 2देखें) को एकत्रित करें. BpiI के साथ 20 डिग्री सेल्सियस अभिक्रिया मिश्रण तैयार करें (चित्र 1ख) और सारणी 2में वर्णित तापीय चक्रक प्रोग्राम की स्थापना करें . इकट्ठे स्तर 0 प्रतिक्रिया मिश्रण के 5 डिग्री एल का उपयोग करई ई कोलाई रूपांतरण के लिए आगे बढ़ें (जैसा कि अनुभाग 2 में वर्णित है)।
  2. स्तर 1 विधानसभाओं का निर्माण
    1. तय करें कि कौन से स्तर 0 भागों को इकट्ठा करना है (चित्र 1 और तालिका 1)। कोई उपयुक्त स्तर 1 स्वीकारकर्ता सदिश15चुनें.
      नोट: इस स्तर पर यह जानना महत्वपूर्ण है कि अंतिम वेक्टर डिजाइन लेवल टी में क्या होगा, क्योंकि यह स्तर 1 स्वीकारकर्ता वेक्टर के विकल्प को प्रभावित करेगा। स्तर 1 स्थिति 1 (आगे) स्वीकारकर्ता वेक्टर (pICH47732) एक डिफ़ॉल्ट के रूप में इस्तेमाल किया जा सकता है अगर लक्ष्य के लिए एक एकल स्तर 1 विधानसभा है (जैसे, एक जीन अभिव्यक्ति कैसेट) स्तर टी में. दो या अधिक स्तर 1 असेंबली स्तर T में अलग किया जा करने के लिए कर तेहैं, तो हालांकि, स्थिति और प्रत्येक स्तर 1 असेंबली की दिशा पर विचार किया जाना चाहिए। स्तर 1 असेंबली तक को लेवल 1 ग्राही सदिशों का उपयोग करके लेवल 1 ग्राही सदिशों में उपयुक्त पदों12के साथ संयोजित किया जा सकता है.
    2. स्तर 1 में स्तर 0 भागों को इकट्ठा। BsAI के साथ 20 डिग्री सेल्सियस अभिक्रिया मिश्रण तैयार कीजिये और सारणी 2में यथा तत्सम ताप चक्रक क्रमादेश की स्थापना कीजिये. इकट्ठे स्तर 1 प्रतिक्रिया मिश्रण के 5 डिग्री सेल्सियस का उपयोग करके ई कोलाई रूपांतरण के लिए आगे बढ़ें (जैसा कि अनुभाग 2 में वर्णित है)।
  3. स्तर टी विधानसभाओं का निर्माण
    1. तय करें कि कौन-सी स्तर 1 असेंबली को इकट्ठा करना है (चित्र 1D). कोई उपयुक्त स्तर T स्वीकारकर्ता वेक्टर चुनें.
      नोट: pUC19A-टी (एम्पिसिलिन प्रतिरोध) और pUC19S-टी (स्पेक्टिनोमाइसिन प्रतिरोध) उच्च प्रतिलिपि संख्या एकीकृत वेक्टर है कि cyanobacteria में दोहराने में सक्षम नहीं हैं और मुख्य रूप से जीनोमिक एकीकरण के लिए उपयोग किया जाता है (यानी, दस्तक में या जीन के बाहर) के माध्यम से समजात पुनर्संयोजन12| एकीकृत सदिशों की डिलीवरी प्राकृतिक परिवर्तन से अनुकूल सायनोबैक्टीरियल प्रजाति11में आगे बढ़ सकती है। pPMQAK1-T एक व्यापक होस्ट श्रेणी है, प्रतिकृति वेक्टर जो वैच्छिक स्थानांतरण (अनुभाग 3) द्वारा वितरित की जाती है.
    2. स्तर टी रीढ़15करने के लिए अंतिम स्तर 1 विधानसभा के 3 "अंत ligate करने के लिए एक उपयुक्त एंड-लिंक चुनें।
      नोट: अंतिम भाग की स्थिति के रूप में आवश्यक अंतिम-लिंक एक ही संख्या है। उदाहरण के लिए, केवल एक स्तर 1 स्थिति 1 (आगे या रिवर्स) भाग के साथ एक स्तर टी वेक्टर को स्तर टी रीढ़ की हड्डी में लिगेशन के लिए एंड-लिंक 1 (pICH50872) की आवश्यकता होगी।
    3. स्तर T में एक या अधिक स्तर 1 असेंबली को इकट्ठा करें BpiI और आवश्यक एंड-लिंक वेक्टर के साथ एक प्रतिक्रिया मिश्रण तैयार करें और सारणी 2में वर्णित थर्मल साइकिलर प्रोग्राम की स्थापना करें। इकट्ठे स्तर टी प्रतिक्रिया मिश्रण के 5 डिग्री सेल्सियस का उपयोग करई ई कोलाई रूपांतरण के लिए आगे बढ़ें (जैसा कि अनुभाग 2 में वर्णित है)।

2. ई. कोलाई रूपांतरण और वेक्टर शुद्धि

  1. ई. कोलाई रूपांतरण (दिन 1)
    1. रासायनिक रूप से सक्षम ई. कोलाई कोशिकाओं ( सामग्री कीसारणी) के एक एलिकोट ($25 डिग्री एल) को और धीरे-धीरे पिपेट को बर्फ पर 1.5 एमएल ट्यूब में डुबाएं। विधानसभा मिश्रण (स्तर 0, 1 या टी) के 5 डिग्री एल जोड़ें और एक और 30 डिग्री 60 मिनट के लिए बर्फ पर ट्यूब इनक्यूबेट।
    2. 30 s के लिए 42 डिग्री सेल्सियस पर एक पानी के स्नान में ट्यूब incubating द्वारा गर्मी के झटके कोशिकाओं, तो 2 मिनट के लिए बर्फ पर वापस ट्यूब जगह. जोड़ें कमरे का तापमान (आरटी) catabolite दमन के साथ सुपर इष्टतम शोरबा (S.O.C.) मध्यम (250 डिग्री सेल्सियस) ट्यूब के लिए। एक मिलाते हुए इनक्यूबेटर में 225 आरपीएम पर 1 एच के लिए 37 डिग्री सेल्सियस पर ट्यूब को इनक्यूबेट करें।
    3. एक LB agar प्लेट पर संस्कृति की प्लेट 40 [L एंटीबायोटिक दवाओं की उचित अंतिम एकाग्रता युक्त (100 g/mL specinomycin dihydrochloride pentahydrate के लिए [स्तर 0], 100g/mL carbenicillin disodium [स्तर 1], या 50 डिग्री / लेवल टीजेड), 1 एम एम आइसोप्रोपिल-बीटा-डी-थायोगालैक्टोपाइरानोसाइड (IPTG) और 5-ब्रोमो-4-क्लोरो-3-इनडोलिल-जेड-डी-गैलाक्टोपाइरानोसाइड (एक्स-गल) के लिए 40 डिग्री/ थाली को रात भर 37 डिग्री सेल्सियस पर इनक्यूबेट करें।
      नोट: प्लेट की संस्कृति की मात्रा ई. कोलाई सक्षम कोशिकाओं और लिगेशन प्रतिक्रिया की दक्षता के आधार पर अलग किया जा सकता है. एक बड़ी मात्रा में प्लेट अगर और 10 कालोनियों रात भर ऊष्मायन के बाद मनाया जाता है.
  2. सफेद कालोनियों का चयन और तरल संस्कृतियों की तैयारी (दिन 2)
    नोट: विधानसभा प्रतिक्रिया और बाद में परिवर्तन की क्षमता पर निर्भर करता है, LB agar प्लेटें कोई उपनिवेश, नीले कालोनियों या सफेद कालोनियों हो सकता है (चित्र 3) . ब्लू कालोनियों स्वीकारकर्ता वेक्टर है कि प्रतिबंध नहीं आया है का संकेत कर रहे हैं (यानी, लाख की एक कार्यात्मक प्रतिलिपि अभी भी मौजूद है). सफेद कालोनियों से संकेत मिलता है कि लाख अभिव्यक्ति कैसेट खो दिया गया है और एक भाग /
    1. वैकल्पिक रूप से, सत्यापित करें कि सफेद कालोनियों में अनुभाग 7 में वर्णित पीसीआर करके अपेक्षित वेक्टर होते हैं।
    2. एक सफेद कालोनियों उठाओ (या पीसीआर सत्यापित कालोनियों) एक 10 जेडएल टिप के साथ और एक 15 एमएल अपकेंद्रित्र ट्यूब एलबी मध्यम (5 एमएल) और उपयुक्त एंटीबायोटिक सांद्रता (कदम 2.1.3) युक्त करने के लिए स्थानांतरण। एक मिलाते हुए इनक्यूबेटर में 225 आरपीएम पर रात में 37 डिग्री सेल्सियस पर ट्यूबों को इनक्यूबेट करें।
  3. प्लास्मिड वेक्टर शुद्धि (दिन 3)
    1. वैकल्पिक रूप से, वेक्टर के दीर्घकालिक क्रायोस्टोरेज के लिए रात भर ई. कोलाई संस्कृति का ग्लिसरोल स्टॉक तैयार करें। -80 डिग्री सेल्सियस पर क्रायोस्टोरेज के लिए एक उपयुक्त 1.5 डिग्री 2.0 एमएल ट्यूब में 500 डिग्री सेल्सियस के 500 डिग्री एल (v/v) ग्लिसरॉल जोड़ें। 5 "10x उलटा द्वारा धीरे से मिलाएं. तरल नाइट्रोजन और एक -80 डिग्री सेल्सियस फ्रीजर में दुकान में फ्लैश फ्रीज नमूने.
    2. 5 डिग्री 10 मिनट के लिए 3,000 x ग्राम पर 15 एमएल सेंट्रीफ्यूज ट्यूबों में संस्कृतियों को स्पिन करें। सेल गोली को परेशान किए बिना सुपरनेंट को छोड़ दें। प्लाज्मिड शोधन किट(सामग्री की तालिका) का उपयोग करके सदिश को शुद्ध करें । 35 डिग्री सेल्सियस deionized पानी में Elute शुद्ध सदिश.
      नोट: आगे वेक्टर एकाग्रता बढ़ाने के लिए कम elution मात्रा का उपयोग करें। एक ही eluent वृद्धि की पैदावार के लिए दो बार एक शुद्धि स्तंभ के माध्यम से रखा जा सकता है.
    3. स्पेक्ट्रोफोटोमीटर (सामग्री कीसारणी)का उपयोग करके एलुएंट में सदिश की सांद्रता को मापें।
      नोट: ई. कोलाईमें उच्च प्रतिलिपि संख्या सदिश, जैसे pUC19, आमतौर पर 50$300 एनजी/$L. कम प्रतिलिपि संख्या सदिशों, जैसे pPMQAK1-T, आमतौर पर 15 डिग्री 60 एनजी/जेडएल की पैदावार देते हैं।
  4. वेक्टर सत्यापन
    नोट: वैक्टर प्रतिबंध पाचन द्वारा सत्यापित किया जा सकता (चरण 2.4.1) और /
    1. एक उपयुक्त प्रतिबंध एंजाइम (ओं) के साथ सदिश के 0.5 डिग्री 1 ग्राम को प्रतिबंधित करें और अनुभाग 6 (चित्र 4 )में वर्णित अपेक्षित बैंड आकारों की पुष्टि करें।
      नोट: गलत बैंड आकार आम तौर पर गलत असेंबली इंगित करते हैं, जिस स्थिति में अधिक सफेद कालोनियों स्क्रीन किया जा सकता है या विधानसभा दोहराया जा सकता है। BsAI और BpiI स्तर 0 और स्तर 1 असेंबली, क्रमशः के लिए सम्मिलित करें का सही आकार को मान्य करने के लिए उपयोग किया जा सकता है। BsaI या BpiI एक अतिरिक्त, संगत प्रतिबंध एंजाइम है कि डालने के भीतर कटौती और / या वेक्टर रीढ़ की हड्डी पाचन के बाद अच्छी तरह से अलग बैंड का एक अलग सेट का उत्पादन करने के साथ संयोजन के रूप में इस्तेमाल किया जा सकता है.
    2. वाणिज्यिक अनुक्रमण सुविधा(सारणी 3)का उपयोग करके इकट्ठे क्षेत्र के ऊपर एक उपयुक्त प्राइमर का उपयोग करके संगर अनुक्रमण द्वारा सदिश को अनुक्रमित करें।
      नोट: सभी नए स्तर 0 भागों अपेक्षित अनुक्रम पहचान की पुष्टि करने के लिए अनुक्रम किया जाना चाहिए। स्तर 1 और T सदिशों के अनुक्रम मान्यता आमतौर पर आवश्यक नहीं है अगर पहले अनुक्रम स्तर 0 भागों से इकट्ठे.

3. संयोजन द्वारा उत्परिवर्ती की पीढ़ी

नोट: यहाँ, Synechocystis पीसीसी 6803 या एस एलोंगाटस UTEXT 297311,47 में एक स्वयं-प्रतिकृति कार्गो वेक्टर के संयोजक हस्तांतरण के लिए एक प्रोटोकॉल का वर्णन किया गया है। यह प्रोटोकॉल अन्य मॉडल प्रजातियों (उदा., एस लम्बी पीसीसी 7942 और Synechococcus sp. PCC 7002) पर लागू होता है। सायनोबैक्टीरिया (और संबद्ध बफर तैयारी) के साथ सभी काम एक लेमिनर प्रवाह हुड में बाँझ शर्तों के तहत किया जाना चाहिए।

  1. सायनोबैक्टीरियल संस्कृति का विकास (दिन 1)
    1. LB-BG11 और BG11+Kan50 (अनुभाग 8) के साथ LEA-Smith et al.11के अनुसार BG11 माध्यम तैयार करें और agar प्लेटें.
    2. एक कुल्हाड़ी BG11 agar प्लेट से sourced कोशिकाओं के साथ ताजा BG11 मध्यम (50 एमएल) के एक 100 एमएल शंकु फ्लास्क टीका द्वारा Synechocystis पीसीसी 6803 या एस एलोंगटस UTEXT 2973 की एक ताजा संस्कृति की स्थापना की। 30 डिग्री सेल्सियस पर Synechocystis PCC 6803 संस्कृतियों, 100 $mol फोटॉनों m-2s-1 पर 100 आरपीएम पर और एस एलोंगटस UTEXT 2973 40 डिग्री सेल्सियस पर, 3000mol फोटॉनों m-2s-1 पर 100 आरपीएम पर वृद्धि। OD750 तक संस्कृतियों को बढ़ाएँ [ 0.5]1.5 (आमतौर पर 1 $2 दिन).
      नोट: एस एलोंगटस UTEXT 2973 संस्कृतियों उच्च प्रकाश तीव्रता में 40 डिग्री सेल्सियस पर उगाया जा सकता है (जैसे, 2000 [मोल फोटॉनों m-2s-1)48.
  2. सहायक और कार्गो ई. कोलाई उपभेदों की वृद्धि (दिन 2)
    1. एम्पिसिलिन युक्त LB माध्यम (अंतिम सांद्रता 100 डिग्री ग्राम/एमएल) और क्लोरैएम्फेनिकॉल (अंतिम सांद्रता 25 ग्राम/एमएल) के साथ एक MC1061 ई. कोलाई तनाव युक्त वैक्टर pRK24 और pRL528 (यानी, सहायक तनाव) और 225 बजे रात भर में बढ़ने के साथ एक मिलाते हुए इनक्यूबेटर में। सहायक तनाव संस्कृति की एक पर्याप्त मात्रा में बड़े हो जाओ, संस्कृति के 1 एमएल मानते हुए संयोजन की आवश्यकता है.
    2. ई. कोलाई संस्कृति के साथ उपयुक्त एंटीबायोटिक दवाओं युक्त एलबी मध्यम (5 एमएल) कार्गो वेक्टर ले जाने (यानी, एक स्तर टी वेक्टर)। एक मिलाते इनक्यूबेटर में 225 आरपीएम पर रात भर 37 डिग्री सेल्सियस पर संस्कृति विकसित करें।
  3. कंजूज स्थानांतरण (त्रि-माता-पिता का संगम) (दिन 3)
    1. ई. कोलाई सहायक और कार्गो उपभेदों तैयार करें। सेंट्रीफ्यूज सहायक और कार्गो ई. कोलाई रात भर संस्कृतियों पर 3,000 x ग्राम कमरे के तापमान पर 10 मिनट के लिए। सेल गोली परेशान किए बिना सुपरनेंट को छोड़ दें।
    2. एंटीबायोटिक दवाओं के बिना ताजा एलबी माध्यम जोड़कर गोली धो लें। प्रारंभिक संस्कृति के रूप में एक ही मात्रा का उपयोग करें. गोली को धीरे से ऊपर और नीचे पाइप लेट करके पुन: निलंबित करें। संस्कृति को भ्रमित मत करो। रात भर संस्कृति से अवशिष्ट एंटीबायोटिक दवाओं को दूर करने के लिए इस कदम 3x दोहराएँ.
    3. पुन: निलंबित संस्कृति को केंद्रित करना (चरण 3.3.1 में), सुपरनेंट को त्यागें और प्रारंभिक संस्कृति मात्रा के एलबी माध्यम की आधी मात्रा में पुन: निलंबित करें (जैसे, 2.5 एमएल यदि रात भर की संस्कृति 5 एमएल थी)। एक 2 एमएल ट्यूब में कार्गो तनाव के 450 $L के साथ सहायक तनाव के 450 $L का मिश्रण है और एक तरफ सेट (आरटी पर छोड़) चरण 3.3.6 तक.
    4. सायनोबैक्टीरियल संस्कृति तैयार करें। प्रत्येक संयोजन प्रतिक्रिया के लिए, 1 एमएल सायनोबैक्टीरियल संस्कृति का उपयोग करें (ओ.डी.750 [ 0.5]1.5)।
    5. सेंट्रीफ्यूज आरटी में 10 मिनट के लिए 1,500 x ग्राम पर सायनोबैक्टीरियल संस्कृति की आवश्यक कुल मात्रा, फिर सेल गोली परेशान किए बिना सुपरनेंट को सावधानी से छोड़ दें। एक ही प्रारंभिक मात्रा के ताजा BG11 माध्यम जोड़कर गोली धो लें. धीरे ऊपर और नीचे pipeting द्वारा गोली resuspend, संस्कृति भंवर नहीं है. इस कदम 3x दोहराएँ और धोया संस्कृति एक तरफ सेट.
    6. एक 2 एमएल ट्यूब में संयुक्त ई. कोलाई उपभेदों (सहायक और कार्गो) (900 जेडएल) के लिए धोया साइनोबैक्टीरियल संस्कृति (900 जेडएल) की एक alicot जोड़ें। धीरे ऊपर और नीचे pipeting द्वारा संस्कृतियों मिक्स. भंवर मत करो. S. longatus UTEXT 2973 के लिए 30 मिनट के लिए आरटी पर मिश्रण इनक्यूबेट करें।
    7. आर टी पर 10 मिनट के लिए 1,500 x ग्राम पर मिश्रण सेंट्रीफ्यूज. supernatant के 1.6 एमएल निकालें. सुपरनेंट के शेष $200 डिग्री एल में गोली को पुन: निलंबित करें। एक LB-BG11 agar प्लेट एंटीबायोटिक दवाओं की कमी पर एक 0.45 डिग्री झिल्ली फिल्टर प्लेस (धारा 8). ध्यान से ई. कोलाई/ साइनोबैक्टीरियल संस्कृति मिश्रण के 200 डिग्री एल एक बाँझ स्प्रेडर या एक बाँझ झुका टिप के साथ झिल्ली पर फैला है और पैराफिन फिल्म के साथ थाली सील।
    8. 24 ज के लिए झिल्ली के साथ LB-BG11 प्लेट को इनक्यूबेट करें, 30 डिग्री सेल्सियस, 100 ख्0क्ब्पर Synechocystis PCC 6803 संस्कृतियों के साथ झिल्ली बनाए रखें। एस एलोंगाटस UTEXT 2973 संस्कृतियों के साथ झिल्ली को बनाए रखें 40 डिग्री सेल्सियस में 150 $mol फोटॉनों m-2s-1.
  4. झिल्ली स्थानांतरण
    1. 24 ज के बाद, कार्गो वेक्टर के लिए चयन करने के लिए उपयुक्त एंटीबायोटिक दवाओं (अनुभाग 8) युक्त एक ताजा BG11 गार प्लेट में लौ-स्टरलाइज़्ड बलप्स का उपयोग करके झिल्ली को सावधानी से स्थानांतरित करें। पैराफिन फिल्म के साथ थाली सील.
    2. उपयुक्त विकास की स्थिति के तहत BG11 agar प्लेट इनक्यूबेट करें, जैसा कि सिनेकोसिस्टिस पीसीसी 6803 या एस एलोंगाटस यूटेक्स 2973 के लिए ऊपर वर्णित है, जब तक कि कॉलोनियां दिखाई नहीं देतीं।
      नोट: कालोनियों आम तौर पर Synechocystis पीसीसी 6803 और एस longatus UTEX 2973 के लिए 3 "7 दिनों के लिए 7 डिग्री 14 दिनों के बाद दिखाई देते हैं।
  5. कंजनेंट्स का चयन
    नोट: केवल साइनोबैक्टीरियल कालोनियों कार्गो वेक्टर ले जाने के लिए झिल्ली पर विकसित करने में सक्षम हो जाएगा (चित्र 5)।
    1. एक गर्मी बाँझ पाश का उपयोग करना, झिल्ली से कम से कम दो अलग-अलग कालोनियों का चयन करें और एक नई BG11 आगर प्लेट पर लकीर उपयुक्त एंटीबायोटिक दवाओं युक्त (चित्र 5ब्)।
      नोट: ताजा धारीदार कालोनियों अभी भी ई. कोलाई के साथ दूषित हो सकता है संयोजन से अधिक किया (यानी, अगर छोटे सफेद कालोनियों थाली पर स्पष्ट कर रहे हैं), तो ताजा BG11 आगर प्लेटों पर फिर से खींच के दो या तीन अतिरिक्त दौर आम तौर पर कर रहे हैं एक कुल्हाड़ी cyanobactrial संस्कृति प्राप्त करने की जरूरत है.
    2. एक मिलाते इनक्यूबेटर में एक 15 एमएल सेंट्रीफ्यूज ट्यूब जिसमें 5 एमएल एलबी मध्यम और 37 डिग्री सेल्सियस पर रात भर में इनक्यूबेटिंग युक्त साइनोबैक्टीरियल कल्चर की एक लकीर को टीका लगाकर ई. कोलाई संदूषण की अनुपस्थिति की पुष्टि करें। एक पर्याप्त विकास अवधि ($ 7 दिन) के बाद, लंबी अवधि के cryostorage या बाद में प्रयोग के लिए तरल संस्कृतियों की स्थापना के लिए व्यक्तिगत axnic कालोनियों लेने.
  6. सायनोबैक्टीरियल उपभेदों का क्रायोस्टोरेज
    1. BG11 में एक सायनोबैक्टीरियल तरल संस्कृति बढ़ाएँ (जैसा कि अनुभाग 3.1 में वर्णित है) जब तक OD750 [ 1.5]3.0. 1,500 x ग्रामपर 10 मिनट के लिए संस्कृति के 10 एमएल सेंट्रीफ्यूज, supernatant को हटाने और ताजा BG11 मध्यम के 5 एमएल में कोशिकाओं को फिर से निलंबित।
    2. $ 20% (v/v)49के अंतिम ग्लिसरॉल सांद्रता के लिए 3.5 एमएल ऑटोक्लेव स्टरलाइज़्ड 50% (v/v) ग्लिसरॉल जोड़ें। इस दृष्टिकोण Synechocystis पीसीसी 6803 के लिए अच्छी तरह से काम करता है. वैकल्पिक रूप से, $ 8% (v/v)50के अंतिम DMSO सांद्रता के लिए 16% (v/v) dimethyl sulfoxide (DMSO) युक्त फिल्टर बाँझ BG11 के 5 एमएल जोड़ें. इस दृष्टिकोण एस longatus UTEXT 2973 सहित सबसे उपभेदों के लिए सिफारिश की है.
      चेतावनी: DMSO विषाक्त है और उचित सुरक्षा के साथ संभाला जाना चाहिए.
    3. 5 "10x उलटा द्वारा धीरे से मिलाएं. सुबलीकोट ]1 एमएल संस्कृति को अलग क्रायोभंडारण संगत 1.5 एमएल पेंच-कैप ट्यूब(सामग्री की तालिका)में । क्रायोस्टोरेज के लिए एक -80 डिग्री सेल्सियस फ्रीजर में ट्यूब रखें। तरल नाइट्रोजन में फ्लैश फ्रीज न करें।
      नोट: तनाव प्रति कम से कम तीन शेयरों की सिफारिश कर रहे हैं.
    4. वसूली के लिए, -80 डिग्री सेल्सियस फ्रीजर से एक ट्यूब को हटा दें और धीरे मिश्रण करते हुए 35 डिग्री सेल्सियस पानी के स्नान में संस्कृति को thaw। ताजा BG11 मध्यम के 50 एमएल करने के लिए thawed संस्कृति जोड़ें और एक तरल संस्कृति के रूप में विकसित (के रूप में अनुभाग 3.1 में वर्णित).
      नोट: वैकल्पिक रूप से, संस्कृति लकीर और एक ताजा BG11 agar प्लेट पर उगाया जा सकता है. चयन मार्करों ले जाने ट्रांसजेनिक संस्कृतियों एंटीबायोटिक दवाओं के बिना BG11 agar प्लेटों पर शुरू में पुनर्जीवित किया जाना चाहिए और फिर उपयुक्त एंटीबायोटिक दवाओं के साथ BG11 agar प्लेटों पर restreaked.

4. प्रमोटर विशेषता

नोट: यहाँ एक मानक दृष्टिकोण एक फ्लोरोसेंट मार्कर (eYFP) की अभिव्यक्ति के स्तर को मापने के द्वारा एक प्रमोटर भाग की ताकत का विश्लेषण करने के लिए वर्णित है एक 72 एच वृद्धि की अवधि के बाद या तो एक प्लेट रीडर या एक प्रवाह cytometer12.

  1. संस्कृति विकास
    1. फ्लोरोसेंट मार्कर अभिव्यक्ति कैसेट ले जाने ट्रांसजेनिक साइनोबैक्टीरियल तनाव की एक कॉलोनी के साथ उपयुक्त एंटीबायोटिक दवाओं युक्त BG11 माध्यम के 10 एमएल inoculating द्वारा बीज संस्कृतियों की स्थापना की। इसके अलावा उचित नकारात्मक नियंत्रण उपभेदों के लिए बीज संस्कृतियों तैयार (उदाहरण के लिए, एक जंगली प्रकार तनाव और / या एक ट्रांसजेनिक तनाव एक ही वेक्टर रीढ़ ले जाने लेकिन फ्लोरोसेंट मार्कर अभिव्यक्ति कैसेट की कमी).
      नोट: कम से कम चार जैविक प्रतिकृतियां की सिफारिश कर रहे हैं.
    2. 48 ज के लिए बीज संस्कृतियों को बढ़ाएँ या प्रजातियों के तनाव के लिए उपयुक्त विकास की स्थिति के तहत OD750 तक 1 $1.5.
    3. समय के साथ प्रमोटर अभिव्यक्ति को ट्रैक करने के लिए, पहले प्रत्येक बीज संस्कृति के OD750 उपाय. प्रत्येक संस्कृति को प्रारंभ करने वाले OD750 $ 0.2 पर लाने के लिए तनुतता आवश्यकताओं की गणना करें. पतला प्रयोगात्मक संस्कृति नमूने सेट (2 एमएल कुल मात्रा) एक फ्लैट नीचे 24 अच्छी तरह से प्लेट में (सामग्री की मेज).
    4. उचित विकास परिस्थितियों में सफेद एलईडी रोशनी (सामग्री की तालिका) के साथ एक मिलाते हुए इनक्यूबेटर में प्लेट को इनक्यूबेट करें। उपाय संस्कृति विकास घनत्व (ओडी750) और बढ़ाया पीले फ्लोरोसेंट प्रोटीन (eYFP) फ्लोरोसेंट या तो एक प्लेट रीडर का उपयोग कर (अनुभाग 4.2) या एक प्रवाह साइटोमीटर (अनुभाग 4.3).
      नोट: Synechocystis पीसीसी 6803 और एस longatus UTEXT 2973 संस्कृतियों चरण 3.1.2 में के रूप में विकसित किया जा सकता है. यह अत्यधिक की सिफारिश की है कि थाली एक उच्च आर्द्रता के तहत बनाए रखा जा (95%) संस्कृति के नमूनों के वाष्पीकरण से बचने के लिए.
  2. प्लेट रीडर
    1. 24-वेल प्लेट (चरण 4.1.4) में संस्कृतियों को कोमल पाइपिंग के साथ संक्षेप में मिलाएं। प्रत्येक संस्कृति का एक उप-प्रतिदर्श एक काले फ्लैट-नीचे 96-वेल प्लेट(सामग्री की तालिका)में स्थानांतरित करें। यदि आवश्यक हो तो पतला (100 $L अंतिम मात्रा). बुलबुले के गठन से बचें क्योंकि यह माप सटीकता के साथ हस्तक्षेप कर सकता है।
      नोट: यह अनुशंसा की जाती है कि सभी माप नमूने पर एक OD750 श्रेणी में किया जा 0.2$1.0. के रूप में 24-वेल में संस्कृतियों के घनत्व समय के साथ वृद्धि होगी, निम्नलिखित कमजोर पड़ने मानक विकास की स्थिति में अपेक्षित वृद्धि के आधार पर सिफारिश कर रहे हैं: 0 एच पर कोई कमजोर पड़ने, 1:4 पर 24 एच, 1:10 पर 48 एच और 1:10 पर 72 एच. तो उदाहरण के लिए, 24 ज फसल पर 25 डिग्री एल संस्कृति के और BG11 माध्यम के 75 डिग्री एल के साथ मिश्रण.
    2. 96-वेल प्लेट में दो रिक्त कुएँ (अर्थात BG11 माध्यम के 100 डिग्री सेल्सियस) को सम्मिलित करें। 96-वेल प्लेट को प्लेट रीडर(सामग्री की सारणी)में रखें। प्लेट रीडर में कक्षीय शेकर का उपयोग करके 500 आरपीएम पर 60 एस के लिए प्लेट हिलाएं ताकि कुओं को मिलाएं।
      नोट: Cyanobactrial संस्कृतियों कुल कर सकते हैं और /
    3. 485 एनएम/520 एनएम पर उत्तेजना/उत्सर्जन तरंगदैर्ध्य के साथ ओडी750 और ईवाईएफपी फ्लोरोसेंट को मापें।
    4. CYanobacteria संस्कृति युक्त प्रत्येक नमूना अच्छी तरह से OD750 माप से दो खाली कुओं के OD750 माप के औसत घटाना.
    5. संस्कृति के समायोजित OD750 द्वारा eYFP फ्लोरोसेंट माप (चरण 4.2.3) विभाजित करके प्रत्येक संस्कृति नमूने के फ्लोरोसेंट मानों को सामान्य करें (चरण 4.2.4)। फिर, ईवाईएफपी अभिव्यक्ति कैसेट ले जाने वाले ट्रांसजेनिक उपभेदों से एक उचित नकारात्मक नियंत्रण तनाव की जैविक प्रतिकृति की औसत सामान्यीकृत ईवाईएफपी फ्लोरोसेंट मान (ईवाईएफपी फ्लोरोसेंट/
      नोट: साइनोबैक्टीरिया स्वाभाविक रूप से फ्लोरेसेस के कारण पिगमेंट की उपस्थिति होती है, जैसे क्लोरोफिल और फाइकोबिलप्रोटीन।
    6. समय के साथ प्लॉट संस्कृति वृद्धि (चित्र 6क) और प्रत्येक प्रयोगात्मक संस्कृति के औसत सामान्यीकृत ईवाईएफपी फ्लोरोसेंट मान वांछित समय बिंदुओं पर (उदा., 72 ज; चित्र 6)
  3. फ्लो साइटोमीटर
    1. प्रवाह साइटोमीटर तरल हैंडलिंग सिस्टम के लिए एक संगत प्लेट चुनें। उदाहरण के लिए, इस प्रोटोकॉल में प्रयुक्त प्रवाह साइटोमीटर ( सामग्रीकी सारणी) के साथ एक गोल-तल 96-वेल प्लेट(सामग्री की सारणी)का उपयोग करें।
    2. 24-वेल प्लेट (चरण 4.1.4) में संस्कृतियों को कोमल पाइपिंग के साथ संक्षेप में मिलाएं। तरल हैंडलिंग प्रणाली में नोजल रुकावटों से बचने के लिए ओडी750 के लिए संस्कृतियों को समाप्त करें। 96-वेल प्लेट में संस्कृति के नमूने की एक उपयुक्त मात्रा जोड़ें और फ़िल्टर-स्टरलाइज़्ड 1x फॉस्फेट-बफर्ड नमकीन (पीबीएस) के साथ 250 डिग्री सेल्सियस की अंतिम मात्रा में लाएं। प्लेट पर मध्यम समाधान के लिए एक रिक्त वेल शामिल करें जिसमें BG11 का 60 $L और 1x PBS का 190 $L है।
      नोट: इस खंड के मामले में नमूने को फिर से चलाने के लिए कोई आवश्यकता है अनुशंसित है। 250 डिग्री सेल्सियस से अधिक वॉल्यूम की सिफारिश नहीं की जाती है क्योंकि प्रत्येक कुएं की अधिकतम मात्रा 300 डिग्री सेल्सियस है।
    3. एक बार प्रवाह cytometer उपयोग के लिए तैयार है, तरल हैंडलिंग स्टेशन में संस्कृति के नमूने के साथ 96 अच्छी तरह से थाली जगह है. 10,000 व्यक्तिगत घटनाओं (उदाहरण के लिए, कोशिकाओं) की माप इकट्ठा करने के लिए प्रवाह cytometer के लिए सॉफ्टवेयर प्रोटोकॉल सेट करें। 488 एनएम/515 डिग्री 545 एनएम की उत्तेजना/उत्सर्जन तरंगदैर्ध्य के साथ ईवाईएफपी फ्लोरोसेंट को मापें। पहले उपाय और खाली अच्छी तरह से पढ़ने की जाँच करें (चित्र 7ए),तो नमूने चलाते हैं.
    4. कोरा पठन के साथ सामान्य क्षेत्रों को छोड़कर आगे और पार्श्व तितर-बितर डेटा सेटों के भीतर सायनोबैक्टीरिया कोशिकाओं की जनसंख्या को गेट करें (चित्र 7)। ईवाईएफपी अभिव्यक्ति कैसेट ले जाने वाले ट्रांसजेनिक उपभेदों से एक उचित नकारात्मक नियंत्रण तनाव की जैविक प्रतिकृतिके के औसत ईवाईएफपी फ्लोरोसेंट मूल्यों को घटाएं (चित्र 7ब्, डी)। वांछित समय बिंदुओं पर प्रत्येक प्रयोगात्मक संस्कृति के लिए प्रति सेल औसत औसत प्लॉट (उदाहरण के लिए, 72 ज; चित्र 7)

5. सायनोबैक्टीरिया से जीनोमिक डीएनए निष्कर्षण

नोट: नीचे प्रोटोकॉल एक वाणिज्यिक डीएनए निष्कर्षण किट(सामग्री की तालिका) काउपयोग करता है.

  1. BG11 में एक सायनोबैक्टीरियल तरल संस्कृति बढ़ाएँ (जैसा कि अनुभाग 3.1 में वर्णित है) जब तक OD750 [ 1.5]3.0. 10 मिनट के लिए 3,000 x ग्राम पर संस्कृति के 10 एमएल नीचे स्पिन और supernatant त्यागें. 30 मिनट के लिए -20 डिग्री सेल्सियस पर ट्यूबों incubating द्वारा गोली फ्रीज.
  2. 400 $L lysis बफर (बफर AP1) और 400 $L ribonuclease समाधान (RNase ए) के और 50% (w/v) कांच मोती (0.5 मिमी व्यास) जोड़ें. एक मनका मिल का उपयोग कर नमूने भंग (सामग्री की तालिका) पर 30 हर्ट्ज (यानी, 1,800 दोलनों के बराबर /
  3. 5 मिनट के लिए 17,000 x ग्राम पर नमूना स्पिन और ध्यान से एक नई ट्यूब में supernatant हस्तांतरण और गोली त्यागें. निर्माता के निर्देशों के अनुसार आगे बढ़ें(सामग्री तालिका)।

6. अगारोस जेल इलेक्ट्रोफोरोसिस

  1. एक 1% कास्ट (w/v) agarose जेल जिसमें 0.02% (v/v) ethidium ब्रोमाइड. लोड नमूने और एक उपयुक्त डीएनए सीढ़ी संदर्भ.
  2. एक पराबैंगनी (यूवी) transilluminator पर बैंड जुदाई के लिए जाँच करें 125 वी पर 50 मिनट के लिए नमूने चलाते हैं।
    नोट: चल रहे समय और agarose जेल प्रतिशत अपेक्षित बैंड आकार के अनुरूप करने के लिए संशोधित किया जा सकता है. उदाहरण के लिए, एक उच्च प्रतिशत agarose जेल और लंबे समय तक चलने के समय बैंड संकल्प और डीएनए उत्पादों की जुदाई में सुधार हो सकता है और 500 बीपी.

7. कॉलोनी पीसीआर

  1. एक मानक किट ( सामग्री कीतालिका) और प्राइमर का एक उपयुक्त संयोजन (उदा., प्राइमर जो विधानसभा क्षेत्र की ओर जाते हैं या विधानसभा क्षेत्र के भीतर अनुक्रमों के लिए विशिष्ट होते हैं)का उपयोग करके पीसीआर प्रतिक्रिया मिश्रण सेट करें। एक पीसीआर ट्यूब में पिपेट 10 डिग्री सेल्सियस।
  2. धीरे से एक बाँझ टूथपिक या 10 डिग्री एल पिपेट टिप के साथ एक एकल सफेद कॉलोनी के शीर्ष को छूने और पीसीआर प्रतिक्रिया मिश्रण युक्त एक पीसीआर ट्यूब टीका। कॉलोनी को चिह्नित करने और विशिष्ट पीसीआर ट्यूब के साथ मैच करने के लिए ध्यान रखें। ई. कोलाई कोशिकाओं को समाधान में बहा रहे हैं यह सुनिश्चित करने के लिए प्रतिक्रिया मिश्रण धीरे हलचल.
  3. पीसीआर द्वारा उत्पादों को बढ़ाना। 60 s के लिए 95 डिग्री सेल्सियस के प्रारंभिक विकृतीकरण चरण से मिलकर एक प्रोग्राम का उपयोग करें, 15 s के लिए 95 डिग्री सेल्सियस के 30 राउंड, 15 s के लिए 58 डिग्री सेल्सियस (प्राइमर्स के टीएम मूल्यों से नीचे कुछ डिग्री) , 30 s के लिए 72 डिग्री (30 s/ , 5 मिनट के लिए 72 डिग्री सेल्सियस के एक अंतिम विस्तार कदम के बाद।

8. BG11 मध्यम और प्लेटों की तैयारी

  1. 100x BG11 मध्यम, लोहा (अमोनियम फेरिक साइट्रेट), ट्रेस तत्वों, फॉस्फेट (K2HPO4), ना2सीओ3 और TES बफर के शेयर समाधान तैयार Lea-Smith एट अल11के अनुसार . ऑटोक्लेव फॉस्फेट और ना2सीओ3 स्टॉक। TES बफ़र (pH 8.2) और NaHCO3 स्टॉक समाधान को स्टरलाइज़ करने के लिए 0.2 डिग्री फ़िल्टर का उपयोग करें।
  2. BG11 माध्यम के 1 L तैयार करें। 100x BG11 के 10 एमएल, ट्रेस तत्वों के 1 एमएल और लोहे के स्टॉक के 1 एमएल मिश्रण और 976 एमएल पानी के साथ समाधान autoclave. एक बार समाधान आरटी के लिए ठंडा हो गया है, फास्फेट स्टॉक के 1 एमएल, ना2सीओ3 स्टॉक के 1 एमएल और NaHCO3के 10 एमएल जोड़ें, और 1 MHCl के साथ pH 7.6 $7.8 को समायोजित करें।
  3. LB-BG11 agar प्लेटें (1.5% [w/
    1. 700 एमएल डिओनीकृत पानी और 15 ग्राम आगर को एक गिलास फ्लास्क में मिलाएं। दूसरे फ्लास्क में 186 एमएल जल, 100x BG11 का 10 एमएल, ट्रेस तत्वों का 1 एमएल तथा 1 एमएल लौह भंडार मिलाएं। ऑटोक्लेव दोनों समाधान.
    2. एक बार समाधान लगभग 60 डिग्री सेल्सियस के लिए ठंडा हो गया है, उन्हें गठबंधन और फॉस्फेट स्टॉक के 1 एमएल, ना2सीओ3 स्टॉक के 1एमएल, NaHCO3 स्टॉक के 10 एमएल और LB बाँझ मध्यम के 50 एमएल, जो 25 के साथ 1 एल कास्ट पेट्री व्यंजनों की एक अंतिम मात्रा देना चाहिए जोड़ें LB-BG11 agar माध्यम के एमएल.
  4. BG11+ Kan50 agar प्लेटें (1.5% [w/
    1. 700 एमएल डिओनीकृत पानी और 15 ग्राम आगर को एक गिलास फ्लास्क में मिलाएं। दूसरे फ्लास्क में 3 ग्राम सोडियम थायोसल्फेट (ना223), 226 एमएल जल, 100x BG11 स्टॉक का 10 एमएल, ट्रेस तत्वों का 1 एमएल तथा लोहे के स्टॉक का 1 एमएल मिलाएं। ऑटोक्लेव दोनों समाधान.
    2. एक बार समाधान लगभग 60 डिग्री सेल्सियस के लिए ठंडा हो गया है, उन्हें गठबंधन और फॉस्फेट स्टॉक के 1 एमएल, ना2सीओ3 स्टॉक के 1 एमएल, टीईएस बफर स्टॉक के 10 एमएल, और NaHCO3 स्टॉक के 10 एमएल, जो 1 एल के एक अंतिम मात्रा देना चाहिए जोड़ें 1 एल kanamycin सल्फेट जोड़ें मध्यम के 35 एमएल के साथ 50 g/mL और डाली पेट्री व्यंजन के एक अंतिम एकाग्रता के लिए।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

गोल्डन गेट विधानसभा कार्यप्रवाह प्रदर्शित करने के लिए, एक अभिव्यक्ति कैसेट स्तर 1 स्थिति 1 (आगे) स्वीकारकर्ता वेक्टर (pICH47732) निम्न स्तर 0 भागों युक्त में इकट्ठा किया गया था: सी-phycocyanin operon Pcpc560 (pC0.005) के प्रमोटर, eYFP (pC0.008) और डबल टर्मिनेटर टीrrnB (pC0.082)12के लिए कोडिंग अनुक्रम . विधानसभा प्रतिक्रिया के परिवर्तन के बाद, ई. कोलाई कालोनियों के मानक नीले सफेद स्क्रीनिंग का उपयोग करके सफल विधानसभाओं की पहचान की गई(चित्र 3)। स्तर 1 वेक्टर और एंड-लिंक 1 वेक्टर (pICH50872) में eYFP अभिव्यक्ति कैसेट तो एक स्तर टी स्वीकारकर्ता वेक्टर (PPMQAK1-T) में इकट्ठा करने के लिए वेक्टर cpcBA-eYFP (चित्र 4) में इकट्ठा किए गए थे. इकट्ठे हुए सीपीबीए-ईवाईएफपी वेक्टर को प्रतिबंध पाचन द्वारा सत्यापित किया गया था (चित्र 4बी) ।

सीपीबीए-eYFP या खाली pPMQAK1-टी वेक्टर के सफल युग्मनज हस्तांतरण (यानी, एक नकारात्मक नियंत्रण eYFP अभिव्यक्ति कैसेट की कमी) Synechocystis पीसीसी 6803 के लिए झिल्ली पर कई सौ कालोनियों के विकास में हुई और S. दीर्घक UTEXT 2973 के बाद 7 "14 दिन और 3 "7 दिन, क्रमशः (चित्र 5) . अलग-अलग कालोनियों उठाया और ताजा BG11 + Kan50 agar प्लेटों पर लकीरें थे; 2]3 फिर से streaks axenic संस्कृतियों उत्पन्न करने के लिए आवश्यक थे.

मजबूत पी पी560 प्रमोटर51के लिए उम्मीद के रूप में , प्लेट रीडर से सामान्यीकृत eYFP फ्लोरोसेंट के लिए मान और प्रवाह cytometer से प्रति सेल eYFP फ्लोरोसेंट नकारात्मक नियंत्रण की तुलना में उच्च थे (चित्र 6 और चित्र 6 और चित्र 7) . S. Longatus UTEXT 2973 की तुलना में Synechocystis PCC 680312में फ्लोरोसेंट मान अधिक थे.

Figure 1
चित्रा 1: CyanoGate में गोल्डन गेट विधानसभा प्रक्रिया का अवलोकन. जीन अभिव्यक्ति कैसेट की असेंबली दिखाया गया है, एक स्तर टी वेक्टर में टेम्पलेट डीएनए से विधानसभा के लिए ब्याज के एक दृश्य के प्रवर्धन से शुरू (भाग पैमाने पर तैयार नहीं कर रहे हैं). (ए) टेम्पलेट डीएनए (उदाहरण के लिए, जीनोमिक या प्लाज़्मिड डीएनए) से सीडीएस1 भाग के प्रवर्धन के लिए आगे और रिवर्स प्राइमर का डिजाइन। स्वीकारकर्ता वेक्टर (अर्थात, 5" और टेम्पलेट अनुक्रम के 3 ") में सम्मिलित करने के लिए आवश्यक BpiI प्रतिबंध साइटों और overhangs के स्थानों को क्रमशः लाल और नीले रंग में हाइलाइट किया जाता है। अक्षर "n" यह दर्शाता है कि इस स्थिति में किसी भी NT का उपयोग किया जा सकता है. डीएनए टेम्पलेट के साथ प्राइमर के अनीलन क्षेत्र और उनके अनुशंसित पिघलने के तापमान (टी) को दर्शाया गया है। (B) स्तर 0 असेंबली ऑफ़ पीसीआर उत्पाद का स्तर 0 CDS1 ग्राहीकर्ता वेक्टर pICH41308. BpiI द्वारा excised और स्वीकारकर्ता वेक्टर में ligated किया जाएगा जो अनुक्रम नीले रंग में प्रकाश डाला है. (ग) स्तर 1 एक जीन अभिव्यक्ति कैसेट के स्तर 1 विधानसभा तीन स्तर 0 भागों युक्त (प्रो + 5U, CDS1 और 3U + टेर) स्तर 1 स्थिति 1 (आगे) स्वीकारकर्ता वेक्टर pICH47732 BsaI का उपयोग कर. (D)स्तर 1 असेंबली और एंड-लिंक 1 (pICH50872) के स्तर टी असेंबली, जिसे"लेवल एम एंड-लिंक 1" कहा जाता है, एक लेवल टी स्वीकारकर्ता वेक्टर (उदा., पीपीएमक्यूए1-टी) बीपीआईआई का उपयोग करते हुए। () अंतिम इकट्ठा स्तर टी वेक्टर। संक्षिप्त नाम: AmpR, एम्सिलिलिन प्रतिरोध कैसेट; CarbR, carbenicillin प्रतिरोध कैसेट; CDS1, स्तर 0 वाक्यविन्यास15में अनुक्रम कोडिंग; EL1, अंत लिंक 1 हिस्सा; कानर, कानामाइसिन प्रतिरोध कैसेट; ललए, [-galactosidase अभिव्यक्ति कैसेट; स्पेक्टर, स्पेक्टिनोमाइसिन प्रतिरोध कैसेट. कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

Figure 2
चित्र 2: एक अवैध प्रकार IIS प्रतिबंध साइट को निकालने के लिए एक PCR-आधारित domestication रणनीति। (ए) सीडीएस1 स्तर 0 स्वीकारकर्ता वेक्टर (pICH41308) में असेंबली के लिए अभिप्रेत प्रोटीन कोडिंग डीएनए अनुक्रम में एक BpiI साइट (GAAGAC) को GAGGAC को संशोधित करने के लिए दो प्राइमर युग्मों (क्रमशः हरे और नारंगी में) दर्शाने वाला स्कीमेटिक आरेख। ध्यान दें कि संशोधन glutamic एसिड के लिए codon बरकरार रखता है (ग्लू) (यानी, GAA GAG करने के लिए). हालांकि BpiI साइट शुरू codon के साथ फ्रेम में दिखाया गया है, इस दृष्टिकोण भी अगर साइट फ्रेम में नहीं है काम करेंगे (यानी, जब तक साइट बाधित है, और प्रोटीन अनुक्रम संरक्षित). BpiI प्रतिबंध साइटों और प्राइमर में overhangs के स्थानों लाल और नीले रंग में प्रकाश डाला, क्रमशः कर रहे हैं. डीएनए टेम्पलेट और अनुवादित प्रोटीन अनुक्रम पीले रंग में प्रकाश डाला है. डीएनए टेम्पलेट के साथ प्राइमर के अनीलन क्षेत्र और उनके अनुशंसित पिघलने के तापमान (टी) को दर्शाया गया है। नारंगी जोड़ी overhangs AATG और TGAA (खंड 1) के साथ अनुक्रम के 5 "अंत बढ़ाना करने के लिए प्रयोग किया जाता है, जबकि हरी जोड़ी overhangs TGAA और GCTT (खंड 2) के साथ 3 "अंत बढ़ाना करने के लिए प्रयोग किया जाता है। प्राइमर आदेश देने से पहले, खंड 1 और 2 के लिए TGAA संलयन overhang की निष्ठा ध्यान से52की जाँच की गई थी. खराब डिजाइन संलयन overhangs विधानसभा विफलता के लिए नेतृत्व कर सकते हैं (यानी, कोई कालोनियों परिवर्तन के बाद; चित्र 5) या गलत सकारात्मक (उदा., छोटा या गलत विधानसभाओं). बाद का समाधान सफेद कालोनियों की एक बड़ी संख्या में स्क्रीनिंग के लिए एक सही ढंग से इकट्ठे निर्माण की पहचान किया जा सकता है. (बी) गोल्डन गेट विधानसभा के दौरान BpiI के साथ प्रतिबंध के बाद टुकड़े 1 और 2 के amplicons. () पालतू अनुक्रम स्तर 0 सीडीएस1 ग्राही वेक्टर में इकट्ठे हुए। कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

Figure 3
चित्र 3: गोल्डन गेट विधानसभा के बाद ई. कोलाई रूपांतरकों की ब्लू-व्हाइट कॉलोनी स्क्रीनिंग। दिखाए गए प्लेटों में एलबी एगर (1% [w/v]) होते हैं जो उचित सांद्रता में एक्स-गल, IPTG और एंटीबायोटिक दवाओं के साथ पूरक होते हैं। (ए) कोई कालोनियों, एक असफल विधानसभा प्रतिक्रिया का सुझाव और / (ख)अधिकांश नीली कालोनियों, जो एक सफल असेंबली का संकेत देते हैं, लेकिन असेंबली अभिक्रिया में प्रयुक्त प्रतिबंध एंजाइम की दक्षता कम थी। (ग)अधिकांश सफेद कालोनियों, एक विशिष्ट, सफल विधानसभा प्रतिक्रिया का संकेत. (डी)कोई नीली कालोनियों, बहुत कुशल विधानसभा का संकेत. कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

Figure 4
चित्र 4: प्रतिबंध पाचन द्वारा एक इकट्ठे स्तर टी वेक्टर का सत्यापन। वेक्टर हिंडन III और BamHI के साथ पचा रहे थे। (A) खाली pPMQAK1-टी स्वीकारकर्ता वेक्टर (CT.0) और स्तर टी विधानसभा(cpcBA-eYFP) के अनुक्रम नक्शा eYFP अभिव्यक्ति कैसेट के घटकदिखा (Pcpc560-eYFP-TrrnB)। हिंडन III और बाम्ही के लिए प्रतिबंध स्थलों की स्थिति दर्शाई गई है। डबल पाचन के बाद, डीएनए टुकड़े की भविष्यवाणी आकार संकेत कर रहे हैं: (1) 5,847 बीपी, (2) 2,004 बीपी, (3) 30 बीपी, (4) 374 बीपी, (5) 1,820 बीपी, (6) 1,289 बीपी, और (7) 156 बीपी (बी) एक अगारोस जेल (0.8% [w/v]) डाइजेस्ट लेवल के साथ भरी हुई 60 मिनट के लिए 125 वी पर चला टी विधानसभा(cpcBA-eYFP) बैंड दिखा 1, 5 और 6, पचा खाली pPMQAK1-टी स्वीकारकर्ता वेक्टर (CT.0) बैंड 1 और 2 दिखा रहा है और एक डीएनए सीढ़ी (सामग्री की तालिका) . ध्यान दें कि बैंड 3, 4 और 7 जेल पर कल्पना करने के लिए बहुत छोटे थे. कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

Figure 5
चित्र 5: सफल संयोजन के बाद ट्रांसजेनिक साइकोकोसिस्टिस पीसीसी 6803 कालोनियों का विकास। BG11+Kan50 agar प्लेटों पर ऊष्मायन निम्नलिखित झिल्ली के उदाहरण दिखाए गए हैं। ((क)बहुत ही कुशल संयोजन के बाद अतिवृद्धि- सिनेकोसिस्टिस पीसीसी 6803 कालोनियों को एक लॉन में विकसित किया गया है जिसमें कोई व्यक्तिगत उपनिवेश नहीं है। (ख)12 दिनों के बाद कई सौ अलग-अलग कालोनियों को दर्शाने वाली एक अच्छी संयोजन दक्षता। (ग)ताजा BG11+Kan50 agar प्लेट पर फिर से लकीर के कई दौर के बाद 14 दिनों के बाद एक कुल्हाड़ी तनाव की वृद्धि. जीवाणु संदूषण की अनुपस्थिति से संकेत मिलता है कि Synechocystis पीसीसी 6803 ट्रांसकॉन्जुगेंट कुल्हाड़ी था. कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

Figure 6
चित्र 6: प्रतिनिधि वृद्धि डेटा और एक प्लेट रीडर का उपयोग कर के eYFP फ्लोरोसेंट मान सामान्यीकृत. (क) सीपीसीबीए-ईवाईएफपी या खाली पीपीएमक्यूए1-टी वेक्टर (सीटी0, नकारात्मक नियंत्रण) को ले जाने वाले उपभेदों की वृद्धि तुलना , सिनेकोसिस्टिस पीसीसी 6803 और एस लम्बाटस यूटेक्स 2973 में। मान चार जैविक प्रतिकृति से एसई - साधन हैं। साइनेकोसिस्टिस पीसीसी 6803 और एस एलोंगटस यूटेक्स 2973 को 30 डिग्री सेल्सियस पर 72 एच के लिए सतत प्रकाश (100 डिग्री मोल फोटॉनों m-2s-1) और 300 ]मोल फोटोन m-2एस-1के साथ 40 डिग्री सेल्सियस के साथ सुसंस्कृत किया गया था। (B) Synechocystis PCC 6803 या S. longatus UTEX 2973 के लिए सामान्य ईवाईएफपी फ्लोरोसेंट मान 72 ज पर सीपीसीबीए-ईवाईएफपी के साथ संयुक्त रूप से मान चार जैविक प्रतिकृतियों से एसई हैं। कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

Figure 7
चित्र ााालः प्ररूपं प्रवाह ंकारं काप्रयोग करके eYFP फ्लोरोसेंट मान. (ए) फॉरवर्ड (FSC-H) और पक्ष (SSC-H) "रिक्त" मध्यम समाधान (BG11 और PBS) से स्कैटर प्लॉट। (बी) एक Synechocystis पीसीसी 6803 नमूना (दाएं) के लिए तितर बितर साजिश. वृत्त चयनित क्षेत्र को इंगित करता है जो नमूना संकेत के शेष भाग से सायनोबैक्टीरिया जनसंख्या को दर्शाता है। (ग) गेट क्षेत्र के हिस्टोग्राम खाली पीपीएमक्यूए1-टी वेक्टर (सीटी.0, ऋणनियंत्रण) को ले जाने के लिए तनाव के लिए। (डी)गेट क्षेत्र के हिस्टोग्राम को सीपीसीबीए-ईवाईएफपीले जाने के लिए तनाव के लिए। () ईवाईएफपी फ्लोरोसेंट मान सिनेकोसिस्टिस पीसीसी 6803 और एस लम्बी यूटेक्स 2973 में 72 ज पर ईवाईएफपी फ्लोरोसेंट मान को नकारात्मक नियंत्रण से घटाया गया है। मान चार जैविक प्रतिकृति से एसई - साधन हैं। कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

नहीं. वेक्टर आईडी नाम विवरण 5' ओवरहैंग 3' ओवरहैंग
1 चच41233 प्रो प्रमोटर जीजीएजी कुशलता
2 चच41295 प्रो + 5U प्रोमोटर और 5] untranslated क्षेत्र जीजीएजी AATG
3 pAGM1251 प्रो + 5U (च) एन टर्मिनल संलयन के लिए प्रमोटर और 5] untranslated अनुक्रम जीजीएजी सीसीएटी
4 चच41246 5यू 5] अअनुवादित क्षेत्र कुशलता सीसीएटी
5 pAGM1263 5U (च) 5] एन टर्मिनल संलयन के लिए अअनुवादित अनुक्रम कुशलता सीसीएटी
6 चच41246 5U + NT1 5] अअनुवादित क्षेत्र और एन टर्मिनल कोडन क्षेत्र कुशलता सीसीएटी
7 pAGM1276 एनटी1 N टर्मिनल टैग या स्थानीयकरण संकेत सीसीएटी AATG
8 pICH41258 Sp सिग्नल पेप्टाइड AATG एजीटी
9 pICH41258 एनटी2 N टर्मिनल टैग या स्थानीयकरण संकेत AATG एजीटी
10 pAGM1287 सीडीएस1 एन एस कोडोन को रोकने के बिना कोडिंग क्षेत्र AATG टी.सी.जी.
11 pICH41308 CDS1 स्टॉप स्टॉप कोडोन के साथ क्षेत्र कोडिंग AATG जीसीटी
12 pAGM1299 सीडीएस2 एन एस कोडिंग क्षेत्र - बिना शुरू और कोडन बंद एजीटी टी.सी.जी.
13 चच41264 CDS2 रोक कोडिंग क्षेत्र - बिना शुरू और रोक codon के साथ एजीटी जीसीटी
14 pAGM1301 सीटी C टर्मिनल टैग या स्थानीयकरण संकेत टी.सी.जी. जीसीटी
15 pICH53388 3U 3] अअनुवादित क्षेत्र जीसीटी जीजीटीए
16 pICH53399 Ter टर्मिनेटर जीजीटीए सीजीसीटी
17 चच41276 3U + टेर 3] अअनुवादित क्षेत्र और टर्मिनेटर जीसीटी सीजीसीटी
18 चच41331 Cgm पूर्ण जीन कैसेट के लिए स्वीकारकर्ता जीजीएजी सीजीसीटी
19 पी.सी.ए0.002 प्रो (कम प्रतिलिपि) प्रमोटर, कम प्रतिलिपि संख्या स्वीकारकर्ता (pSC101 ori) जीजीएजी कुशलता
20 पी.सी.ए0.001 प्रो टीएसएस प्रतिलेखन प्रारंभ साइट के लिए छोटा प्रमोटर जीजीएजी टैगसी
21 स्तर 1 के लिए प्रत्यक्ष एसआरएनए लघु नियामक आरएनए (अनुवादी silencing के लिए) टैगसी जी.टी.टी.
22 स्तर 1 के लिए प्रत्यक्ष एस.जी.आर.ए.एन.ए एकल गाइड आरएनए (CRISPRi के लिए) टैगसी जी.टी.टी.
23 चच41295 उत्तर प्रदेश FLNK लक्ष्य समजात पुनर्संयोजन स्थल के ऊपर flanking अनुक्रम जीजीएजी AATG
24 चच41276 DOWN FLANK लक्ष्य समजात पुनर्संयोजन स्थल के नीचे flanking अनुक्रम जीसीटी सीजीसीटी

तालिका 1: उपलब्ध स्तर 0 स्वीकारकर्ता सदिशों और overhangs की एक सूची। वेक्टर्स 1]18 संयंत्र MoClo किट15से कर रहे हैं. वेक्टर्स 19 डिग्री 22 CyanoGate किट12से हैं. SrRNA और sgRNA भागों के लिए, संश्लेषित दृश्यों या PCR उत्पादों स्तर 1 स्वीकारकर्ता सदिश में सीधे इकट्ठे होते हैं. वैक्टर 23 डिग्री 24 संयंत्र MoClo किट है कि CyanoGate किट का उपयोग कर homologous पुनर्संयोजन द्वारा परिवर्तन के लिए फिर से उद्देश्य किया गया है से कर रहे हैं.

BpiI विधानसभा घटक (स्तर 0, टी) BsaI विधानसभा घटक (स्तर 1)
50 डिग्री 100 एनजी स्वीकारकर्ता सदिश 50 डिग्री 100 एनजी स्वीकारकर्ता सदिश
सम्मिलित करने के लिए प्रत्येक सदिश/भाग के लिए, सम्मिलित करने के 2:1 अनुपात: ग्राही सदिश का उपयोग करें. सम्मिलित करने के लिए प्रत्येक सदिश/भाग के लिए, सम्मिलित करने के 2:1 अनुपात: ग्राही सदिश का उपयोग करें.
2 $L 10 M ATP (सामग्री की तालिका) 2 $L 10 M ATP (सामग्री की तालिका)
2 $L बफर जी (BpiI/BsaI के लिए बफर) 2 $L बफर जी (BpiI/BsaI के लिए बफर)
2 $L बीएसए (10x) (सामग्री की तालिका) 2 $L बीएसए (10x) (सामग्री की तालिका)
10 इकाइयों BpiI (1 $L10 यू / 10 इकाइयों BsAI (1 $L 10 U/$L BsAI, सामग्री की तालिका)
dH 2 O केसाथ 20 $L करने के लिए लाओ। dH 2 O केसाथ 20 $L करने के लिए लाओ।
200 यूनिट टी 4 डीएनए लिगेज (1 डिग्री एल 200 यू/ 200 यूनिट टी 4 डीएनए लिगेज (1 डिग्री एल 200 यू/
थर्मोसाइकिलर प्रोटोकॉल (स्तर 0, टी) थर्मोसाइकिलर प्रोटोकॉल (स्तर 1)
10 मिनट के लिए 37 डिग्री सेल्सियस चक्र x 5 10 मिनट के लिए 37 डिग्री सेल्सियस चक्र x 5
10 मिनट के लिए 16 डिग्री सेल्सियस 10 मिनट के लिए 16 डिग्री सेल्सियस
20 मिनट के लिए 37 डिग्री सेल्सियस 20 मिनट के लिए 37 डिग्री सेल्सियस
10 मिनट के लिए 65 डिग्री सेल्सियस 10 मिनट के लिए 65 डिग्री सेल्सियस
16 डिग्री सेल्सियस (होल्ड) 16 डिग्री सेल्सियस (होल्ड)

तालिका 2: स्तर 0, 1 और टी में गोल्डन गेट असेंबली के लिए प्रोटोकॉल स्तर 0 और स्तर टी स्वीकारकर्ता वेक्टर में असेंबली प्रतिबंध एंजाइम BpiI (बाएं) का उपयोग करता है। स्तर 1 स्वीकारकर्ता वेक्टर में असेंबली प्रतिबंध एंजाइम BsAI (दाएं) का उपयोग करता है। इस सारणी को वासुदेवन एट अल से अनुकूलित किया गयाहै।

प्राइमर नं. अनुक्रम (5'-3') लंबाई (बीपी) विवरण
L0T आगे जी.टी.सी.टी.सी.टी.जी.सी.टी.जी.टी.टी.
टीटीजीएटीजी
28 स्तर 0 और स्तर टी से प्रवर्धन के लिए
L1 रिवर्स GAACCCTGTGGTTGGCATGC
एसीएटीएसी
26 स्तर 1 से प्रवर्धन के लिए
L1 आगे CTGGTGGCAGGATATGT
जीजीटीजी
24 स्तर 1 से प्रवर्धन के लिए
L0T रिवर्स TTGAGTGATGATACCGCT 20 स्तर 0 और स्तर टी से प्रवर्धन के लिए

तालिका 3: पीसीआर सत्यापन या स्तर 0, 1 और टी वेक्टर के अनुक्रमण के लिए प्राइमर की सूची।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

गोल्डन गेट विधानसभा के कई फायदे हैं अन्य वेक्टर विधानसभा विधियों की तुलना में, विशेष रूप से scalability के संदर्भ में20,21. फिर भी, एक प्रयोगशाला में गोल्डन गेट प्रणाली की स्थापना के लिए समय की आवश्यकता के लिए विभिन्न भागों और स्वीकारकर्ता वेक्टर पुस्तकालयों और समग्र विधानसभा प्रक्रियाओं के साथ एक परिचित विकसित. सावधान योजना अक्सर अधिक जटिल विधानसभाओं के लिए आवश्यक है या जब समानांतर में जटिल विधानसभाओं की एक बड़ी संख्या में प्रदर्शन (उदाहरण के लिए, स्तर टी कैक्टर कई जीन अभिव्यक्ति कैसेट युक्त का एक सूट बनाने). हम पहले आवश्यक सभी जीन अभिव्यक्ति कैसेट संयोजनों लिस्टिंग और फिर सिलीको में स्तर 0 से स्तर टी के लिए कार्यप्रवाह मानचित्रण सलाह देते हैं। इस प्रक्रिया के दौरान, उपयोगकर्ताओं को प्लांट MoClo किट में उपलब्ध स्तर 1 "डम्मी" भागों पर विचार करना चाहिए जो स्तर T में गैर-क्रमिक स्तर 1 सदिशों की असेंबली के लिए अनुमति देते हैं (उदाहरण के लिए, स्तर 1 स्थिति 1 और स्थिति 3 सदिशों को "डमी" भाग के साथ एक साथ इकट्ठा किया जा सकता है स्तर 1 स्थिति 2), जो विधानसभा प्रतिक्रियाओं और क्लोनिंग कदम की कुल संख्या को कम कर सकते हैं15की आवश्यकता है.

डीएनए संश्लेषण आम तौर पर नए स्तर 0 भागों के निर्माण के लिए सबसे आसान तरीका है. हालांकि, जब क्लोनिंग की आवश्यकता है (उदाहरण के लिए, प्लाज्मिड या जीनोमिक डीएनए से), प्रवर्धन के लिए इस्तेमाल किया प्राइमर के डिजाइन का अनुकूलन बाद के स्तर 0 वेक्टर विधानसभा की दक्षता को अधिकतम करने के लिए महत्वपूर्ण है। प्राइमर डिजाइन में दो सबसे महत्वपूर्ण कदम हैं: 1) जाँच है कि सही overhangs शामिल हैं और आगे और रिवर्स प्राइमर के लिए उपयुक्त अभिविन्यास में हैं (चित्र 1 और तालिका 1), और 2) यह सुनिश्चित करना है कि प्राइमर की लंबाई टेम्पलेट के लिए anneals पर्याप्त रूप से लंबा है कि अनुक्रम (18 डिग्री 30 bp) और है कि इस अनुक्रम के लिए टीमीटर मान (आदर्श रूप से 58 डिग्री 62 डिग्री सेल्सियस) प्राइमर जोड़ी के लिए समान है (चित्र 1). यदि एक दृश्य domestication की आवश्यकता है, कई रणनीतियों उपलब्ध हैं. लघु दृश्यों के लिए (उदाहरण के लिए, और lt;200 bp), लंबे समय से आगे और रिवर्स प्राइमर की एक जोड़ी डिजाइन किया जा सकता है जिसमें 3 " एक दूसरे के लिए anneal समाप्त होता है (यानी, का एक ओवरलैप और gt;20 बीपी) और प्रवर्धन के बाद एक डबल फंसे अनुक्रम के रूप में. लंबे दृश्यों के लिए, अनुक्रम के अलग-अलग टुकड़े को बढ़ाया जा सकता है जो अवैध प्रतिबंध स्थलों को हटा देता है और फिर गोल्डन गेट असेंबली एप्रोच (चित्र 2)का उपयोग करके इकट्ठा किया जाता है। पीसीआर उत्पादों के साथ असेंबली दक्षता खराब है, तो स्तर 0 अनुक्रम के अलग-अलग टुकड़े स्तर 1 यूनिवर्सल स्वीकारकर्ता वेक्टर (pAGM1311) में क्लोन किया जा सकता है, मान्य है, और उसके बाद उपयुक्त स्तर 0 स्वीकारकर्ता वेक्टर15में एक साथ इकट्ठे। एक 2:1 डालने: ग्राही वेक्टर मोलर अनुपात कुशल गोल्डन गेट विधानसभा के लिए सिफारिश की है। हालांकि, केवल 2-3 सदिशों (उदाहरण के लिए, दो स्तर 0 भागों और एक स्तर 1 स्वीकारकर्ता वेक्टर) की असेंबली के लिए, प्रत्येक नियमित रूप से $ 100 एनजी के संयोजन के परिणाम स्वरूप सफल असेंबली में होते हैं। असेम्बली की दक्षता में कमी आती है क्योंकि प्रति अभिक्रिया में प्रयुक्त सदिशों की संख्या में वृद्धि होती है, जिसके परिणामस्वरूप परिवर्तन के बाद सफेद कालोनियों की कुल संख्या में कमी आती है (चित्र 3)।

संयोजन से पहले, प्रतिबंध डाइजेस्ट द्वारा अंतिम स्तर टी सदिशों की मान्यता और पीसीआर की सिफारिश की जाती है। वैजुगल डीएनए स्थानांतरण सायनोबैक्टीरियल उपभेदों के लिए एक अच्छी तरह से स्थिर तकनीक है , जिसमें वे भी शामिल हैं जो स्वाभाविक रूप से परिवर्तनीय41,45नहीं हैं . संयोजन प्रोटोकॉल में महत्वपूर्ण कदम में शामिल हैं: 1) रात भर के विकास के बाद सहायक ई. कोलाई तनाव की सावधानी से निपटने (उदा., भ्रम से बचने)35, 2) देखभाल करने के लिए पूरी तरह से सहायक विकसित करने के लिए इस्तेमाल एंटीबायोटिक दवाओं के निशान को दूर करने और कार्गो ई. कोलाई उपभेदों, 3) कार्गो और सहायक उपभेदों और cyanobacteria के मिश्रण के लिए एक उपयुक्त ऊष्मायन अवधि (उदाहरण के लिए, एक लंबे समय तक ऊष्मायन अवधि एस एलम्ब्डटस UTEXT 2973 के लिए महत्वपूर्ण था), और 4) सेल के प्रारंभिक हस्तांतरण अवधि LB-BG11 agar प्लेटों में झिल्ली पर मिश्रण 24 एच के लिए एंटीबायोटिक दवाओं की कमी है.

पृथक सायनोबैक्टीरियल कालोनियों को दो सप्ताह के भीतर झिल्ली पर Synechocystis PCC 6803 और एस लम्बी UTEXT 2973 के लिए विकसित करना चाहिए, अन्यथा यह संभावना है कि संयोजन विफल हो गया है। प्रोटोकॉल में कई संशोधनों का परीक्षण किया जा सकता है, जिसमें 1) एक उच्च प्रारंभिक घनत्व के साथ एक साइनोबैक्टीरियल संस्कृति का उपयोग कर के साथ (उदा., OD750 [ 1.5]2); 2) झिल्ली को स्थानांतरित करने से पहले ऊष्मायन अवधि में वृद्धि; और 3) झिल्ली पर प्रारंभिक ऊष्मायन अवधि को 24 ज से 48 एच तक बढ़ाना (यानी, स्थानांतरित वेक्टर पर एंटीबायोटिक प्रतिरोध जीन की अभिव्यक्ति के लिए अधिक समय देने के लिए)। यदि संयोग अभी भी विफल रहता है, तो इलेक्ट्रोपोरेशन जैसे वैकल्पिक तरीकों का प्रयास किया जा सकताहै। एक ट्रांसजेनिक साइनोबैक्टीरियल तनाव की पुष्टि axenic आगे प्रयोग करने से पहले महत्वपूर्ण है. अंत में, ट्रांसजेनिक साइनोबैक्टीरियल स्ट्रेन में हेटेरोलॉगस वेक्टर के आकार की पुष्टि करना अच्छा अभ्यास है। बाद डीएनए निष्कर्षण (अनुभाग 5), ई. कोलाई और चयन (अनुभाग 2.1) में परिवर्तन, और वेक्टर सत्यापन (अनुभाग 2.4) की आवश्यकता है।

रेखांकित प्रमोटर विशेषता प्रोटोकॉल एक उच्च प्रवाह स्क्रीनिंग पद्धति को प्राप्त करने के एक साधन के रूप में छोटे संस्कृति संस्करणों (यानी, 2 एमएल) का उपयोग करता है। उपलब्ध फोटोबायोरिएक्टर स्थान के आधार पर बड़े संस्करणों का उपयोग किया जा सकता है, जो संस्कृति वाष्पीकरण के मुद्दों को कम करने में मदद करेगा। यदि छोटी संस्कृति की मात्रा के साथ उच्च थ्रूपुट स्क्रीनिंग की आवश्यकता है, तो वाष्पीकरण को बाधित करने के लिए विकास कक्ष के भीतर उच्च आर्द्रता होना आवश्यक है। एक विकास प्रयोग के दौरान वाष्पीकरण सटीकता और नमूना माप की वैधता के लिए हानिकारक हो सकता है. प्रयोग के दौरान और बाद में संस्कृति की मात्रा की जांच करें ताकि यह पुष्टि की जा सके कि कितना वाष्पीकरण हुआ है।

प्लेट रीडर माप के लिए, यह कम घनत्व पर संस्कृतियों को मापने के लिए महत्वपूर्ण है, आदर्श OD750 और lt; 1, विश्वसनीय और reproduible विकास और फ्लोरोसेंट डेटा के अधिग्रहण सुनिश्चित करने के लिए. कक्ष संख्या और ओड750 के बीच एक रेखीय संबंध केवल एक विशिष्ट श्रेणी54के भीतर देखा जाता है। इस श्रेणी को स्थापित करने के लिए, हम एक ज्ञात रूपांतरक का उपयोग करते हुए एक सीरियल कमजोर पड़ने (उदा., OD750 से 0.1$1.0) प्रदर्शन करने की सलाह देते हैं, जिसमें एक ज्ञात रूपांतरक का उपयोग किया गया है, जहां eYFP फ्लोरोसेंट की पुष्टि की गई है. सामान्यीकृत फ्लोरोसेंट (ईईएफपी फ्लोरोसेंट/ओडी750)के खिलाफ पूर्ण फ्लोरोसेंट की साजिश रचने से संस्कृति घनत्व की रैखिक कार्य सीमा की पहचान करने में मदद मिलेगी। कई प्लेट पाठकों फ्लोरोसेंट डिटेक्टर की संवेदनशीलता को संशोधित करने के लिए एक "लाभ" सुविधा शामिल हैं. इस स्थिति में, लाभ मान को प्रयोग शुरू करने से पहले एक उचित स्तर पर सेट किया जाना चाहिए और विभिन्न प्रयोगात्मक रनों के बीच नहीं बदला जाना चाहिए या डेटा की तुलना सीधे नहीं की जाएगी.

हालांकि विभिन्न प्रवाह cytometers के संचालन निर्माताओं के बीच अलग अलग होंगे, यह मध्यम समाधान के एक खाली पढ़ने लेने के लिए पहचान और किसी भी पृष्ठभूमि संकेत से लक्ष्य cyanobactrial आबादी की gating की सुविधा के लिए महत्वपूर्ण है माध्यम (चित्र 7A,B) इसके बाद, नकारात्मक नियंत्रण नमूने के फ्लोरोसेंट मूल्य के घटाव (उदा., एक जंगली प्रकार का तनाव) देशी स्व-प्रवाह को दूर करने में मदद करेगा (चित्र 7ब्, डी)। एक प्रवाह cytometer में photoमल्टीप्लायर ट्यूब (पीएमटी) वोल्टेज पैरामीटर एक प्लेट रीडर में लाभ के लिए एक समान समारोह है, यानी, वृद्धि या फ्लोरोसेंट संकेत की तीव्रता के लिए डिटेक्टर की संवेदनशीलता को कम. प्लेट रीडर के साथ के रूप में, पीएमटी वोल्टेज प्रयोग55शुरू करने से पहले एक उचित स्तर पर सेट किया जाना चाहिए. एक बार सेट, PMT वोल्टेज मान विभिन्न प्रयोगात्मक रन के बीच बनाए रखा जाना चाहिए या डेटा सीधे तुलनीय नहीं होगा.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों को खुलासा करने के लिए कुछ भी नहीं है.

Acknowledgments

लेखक वित्तीय जैव प्रौद्योगिकी और जैव ऊर्जा (एनआईबीबी) और वित्तीय सहायता के लिए औद्योगिक जैव प्रौद्योगिकी नवाचार केंद्र (IBioIC) में PHYCONET जैव प्रौद्योगिकी और जैविक विज्ञान अनुसंधान परिषद (BBSRC) नेटवर्क के आभारी हैं. GARG, AASO और एपी BBSRC EASTBIO केस पीएचडी कार्यक्रम से धन सहायता स्वीकार करते हैं (अनुदान संख्या BB/M010996/1), Consezo Nacional de Ciencia y Tecnologa (CONACYT) पीएचडी कार्यक्रम, और IBioIC-BBSRC सहयोगी प्रशिक्षण भागीदारी (CTP) पीएचडी कार्यक्रम, क्रमशः. हम कॉनराड Mullineaux (लंदन की रानी मैरी विश्वविद्यालय), और पॉल एरिक जेन्सेन और जूली Annemerie ज़ीता ज़ेडलर (कोपेनहेगन के विश्वविद्यालय) प्लाज्मिड वेक्टर और प्रोटोकॉल योगदान और सलाह के लिए धन्यवाद.

Materials

Name Company Catalog Number Comments
5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal) Thermo Fisher Scientific R0404 Used in 2.1.3.
Adenosine 5′-triphosphate (ATP) disodium salt Sigma-Aldrich A2383 Used in Table 2.
Agar (microbiology tested) Sigma-Aldrich A1296-500g Used in 8.3.
Agarose Bioline BIO-41026 Used in 6.
Attune NxT Flow Cytometer Thermo Fisher Scientific - Used in 4.3.1.
Bovine Serum Albumin (BSA) Sigma-Aldrich A2153 Used in Table 2.
BpiI (BbsI) Thermo Fisher Scientific ER1011 Used in Table 2.
BsaI (Eco31I) Thermo Fisher Scientific ER0291 Used in Table 2.
Carbenicillin disodium VWR International A1491.0005 Used in 2.1.3.
Corning Costar TC-Treated flat-bottom 24 well plates Sigma-Aldrich CLS3527 Used in 4.1.3.
Dimethyl Sulfoxide (DMSO) Thermo Fisher Scientific BP231-100 Used in 3.6.2.
DNeasy Plant Mini Kit Qiagen 69104 DNA extraction kit. Used in 5.
FLUOstar Omega Microplate reader BMG Labtech - Used in 4.2.2.
GeneJET Plasmid Miniprep Kit Thermo Fisher Scientific K0503 Plasmid purification kit. Used in step 2.3.2.
Glass beads (0.5 mm diameter) BioSpec Products 11079105 Used in 5.2.
Glycerol Thermo Fisher Scientific 10021083 Used in 2.3.1, 3.6.2.
Isopropyl-beta-D-thiogalactopyranoside (IPTG) Thermo Fisher Scientific 10356553 Used in 2.1.3.
Kanamycin sulphate (Gibco) Thermo Fisher Scientific 11815-024 Used in 2.1.3.
Membrane filters (0.45 μm) MF-Millipore HAWP02500 Used in 3.3.7
Microplates, 96-well, flat-bottom (Chimney Well) µCLEAR Greiner Bio-One 655096 Used in 4.2.1.
Monarch DNA Gel Extraction Kit New England Biolabs T1020S Used in 1.1.2.2.
Monarch PCR DNA Cleanup Kit New England Biolabs T1030 DNA purification kit. Used in 1.1.2.3.
Multitron Pro incubator with LEDs Infors HT - Shaking incubator with white LED lights. Used in 4.1.4.
MyTaq DNA Polymerase Bioline BIO-21108 Used in 7.1.
NanoDrop One Thermo Fisher Scientific ND-ONE-W Used in 2.3.3.
One Shot TOP10 chemically competent E. coli Thermo Fisher Scientific C404010 Used in 2.1.1.
Phosphate buffer saline (PBS) solution (10X concentrate) VWR International K813 Used in 4.3.2.
Q5High-Fidelity DNA Polymerase New England Biolabs M0491S Used in 1.1.2.1.
Quick-Load 1 kb DNA Ladder New England Biolabs N0468S Used in Figure 4.
Screw-cap tubes (1.5 ml) Starstedt 72.692.210 Used in 3.6.3
Spectinomycin dihydrochloride pentahydrate VWR International J61820.06 Used in 2.1.3.
Sterilin Clear Microtiter round-bottom 96-well plates Thermo Fisher Scientific 612U96 Used in 4.3.1.
T4 DNA ligase Thermo Fisher Scientific EL0011 Used in Table 2.
TissueLyser II Qiagen 85300 Bead mill. Used in 5.2.

DOWNLOAD MATERIALS LIST

References

  1. Luan, G., Lu, X. Tailoring cyanobacterial cell factory for improved industrial properties. Biotechnology Advances. 36, (2), 430-442 (2018).
  2. Madsen, M. A., Semerdzhiev, S., Amtmann, A., Tonon, T. Engineering mannitol biosynthesis in Escherichia coli and Synechococcus sp. PCC 7002 using a green algal fusion protein. ACS Synthetic Biology. 7, (12), 2833-2840 (2018).
  3. Menin, B., et al. Non-endogenous ketocarotenoid accumulation in engineered Synechocystis sp. PCC 6803. Physiologia Plantarum. 166, (1), 403-412 (2019).
  4. Varman, A. M., Yu, Y., You, L., Tang, Y. J. Photoautotrophic production of D-lactic acid in an engineered cyanobacterium. Microbial Cell Factories. 12, (1), 1-8 (2013).
  5. Vavitsas, K., et al. Responses of Synechocystis sp. PCC 6803 to heterologous biosynthetic pathways. Microbial Cell Factories. 16, 140 (2017).
  6. Yang, G., et al. Photosynthetic production of sunscreen shinorine using an engineered cyanobacterium. ACS Synthetic Biology. 7, (2), 664-671 (2018).
  7. Nielsen, A. Z., et al. Extending the biosynthetic repertoires of cyanobacteria and chloroplasts. Plant Journal. 87, (1), 87-102 (2016).
  8. Nielsen, J., Keasling, J. D. Engineering cellular metabolism. Cell. 164, (6), 1185-1197 (2016).
  9. Stensjö, K., Vavitsas, K., Tyystjärvi, T. Harnessing transcription for bioproduction in cyanobacteria. Physiologia Plantarum. 162, (2), 148-155 (2018).
  10. Santos-Merino, M., Singh, A. K., Ducat, D. C. New applications of synthetic biology tools for cyanobacterial metabolic engineering. Frontiers in Bioengineering and Biotechnology. 7, 1-24 (2019).
  11. Lea-Smith, D. J., Vasudevan, R., Howe, C. J. Generation of marked and markerless mutants in model cyanobacterial species. Journal of Visualized Experiments. 111, e54001 (2016).
  12. Vasudevan, R., et al. CyanoGate: A modular cloning suite for engineering cyanobacteria based on the plant MoClo syntax. Plant Physiology. 180, (1), 39-55 (2019).
  13. Andreou, A. I., Nakayama, N. Mobius assembly: A versatile golden-gate framework towards universal DNA assembly. PLoS ONE. 13, (1), 1-18 (2018).
  14. Crozet, P., et al. Birth of a Photosynthetic Chassis: A MoClo toolkit enabling synthetic biology in the microalga Chlamydomonas reinhardtii. ACS Synthetic Biology. 7, (9), 2074-2086 (2018).
  15. Engler, C., et al. A Golden Gate modular cloning toolbox for plants. ACS Synthetic Biology. 3, (11), 839-843 (2014).
  16. Moore, S. J., et al. EcoFlex: A multifunctional MoClo kit for E. coli synthetic biology. ACS Synthetic Biology. 5, (10), 1059-1069 (2016).
  17. Pollak, B., et al. Loop assembly: a simple and open system for recursive fabrication of DNA circuits. New Phytologist. 222, (1), 628-640 (2019).
  18. Werner, S., Engler, C., Weber, E., Gruetzner, R., Marillonnet, S. Fast track assembly of multigene constructs using golden gate cloning and the MoClo system. Bioengineered Bugs. 3, (1), 38-43 (2012).
  19. Patron, N. J., et al. Standards for plant synthetic biology: a common syntax for exchange of DNA parts. New Phytologist. 208, (1), 13-19 (2015).
  20. Chao, R., Mishra, S., Si, T., Zhao, H. Engineering biological systems using automated biofoundries. Metabolic Engineering. 42, 98-108 (2017).
  21. Chambers, S., Kitney, R., Freemont, P. The Foundry: the DNA synthesis and construction Foundry at Imperial College. Biochemical Society Transactions. 44, (3), 687-688 (2016).
  22. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  23. Rosano, G. L., Ceccarelli, E. A. Rare codon content affects the solubility of recombinant proteins in a codon bias-adjusted Escherichia coli strain. Microbial Cell Factories. 8, 1-9 (2009).
  24. Cambray, G., et al. Measurement and modeling of intrinsic transcription terminators. Nucleic Acids Research. 41, (9), 5139-5148 (2013).
  25. Chen, Y. J., et al. Characterization of 582 natural and synthetic terminators and quantification of their design constraints. Nature Methods. 10, (7), 659-664 (2013).
  26. Münch, R., et al. Virtual Footprint and PRODORIC: An integrative framework for regulon prediction in prokaryotes. Bioinformatics. 21, (22), 4187-4189 (2005).
  27. Salis, H. M., Mirsky, E. A., Voigt, C. A. Automated design of synthetic ribosome binding sites to control protein expression. Nature Biotechnology. 27, (10), 946-950 (2009).
  28. Englund, E., Liang, F., Lindberg, P. Evaluation of promoters and ribosome binding sites for biotechnological applications in the unicellular cyanobacterium Synechocystis sp. PCC 6803. Scientific Reports. 6, 36640 (2016).
  29. Heidorn, T., et al. Synthetic biology in cyanobacteria engineering and analyzing novel functions. Methods in Enzymology. 497, 539-579 (2011).
  30. Thiel, K., et al. Translation efficiency of heterologous proteins is significantly affected by the genetic context of RBS sequences in engineered cyanobacterium Synechocystis sp. PCC 6803. Microbial Cell Factories. 17, 34 (2018).
  31. Liu, Q., Schumacher, J., Wan, X., Lou, C., Wang, B. Orthogonality and burdens of heterologous and gate gene circuits in E. coli. ACS Synthetic Biology. 7, (2), 553-564 (2018).
  32. Ferreira, E. A., et al. Expanding the toolbox for Synechocystis sp. PCC 6803: Validation of replicative vectors and characterization of a novel set of promoters. Synthetic Biology. (August), 1-39 (2018).
  33. Liang, F., Lindblad, P. Synechocystis PCC 6803 overexpressing RuBisCO grow faster with increased photosynthesis. Metabolic Engineering Communications. 4, 29-36 (2017).
  34. Taton, A., et al. Broad-host-range vector system for synthetic biology and biotechnology in cyanobacteria. Nucleic Acids Research. 42, (17), e136 (2014).
  35. Elhai, J., Wolk, C. P. Conjugal transfer of DNA to cyanobacteria. Methods in Enzymology. 167, (1984), 747-754 (1988).
  36. Gormley, E. P., Davies, J. Transfer of plasmid RSF1010 by conjugation from Escherichia coli to Streptomyces lividans and Mycobacterium smegmatis. Journal of Bacteriology. 173, (21), 6705-6708 (1991).
  37. Huang, H. H., Camsund, D., Lindblad, P., Heidorn, T. Design and characterization of molecular tools for a synthetic biology approach towards developing cyanobacterial biotechnology. Nucleic Acids Research. 38, (8), 2577-2593 (2010).
  38. Huang, H. H., Lindblad, P. Wide-dynamic-range promoters engineered for cyanobacteria. Journal of Biological Engineering. 7, 10 (2013).
  39. Li, S., Sun, T., Xu, C., Chen, L., Zhang, W. Development and optimization of genetic toolboxes for a fast-growing cyanobacterium Synechococcus elongatus UTEX 2973. Metabolic Engineering. 48, 163-174 (2018).
  40. Pansegrau, W., Balzer, D., Kruft, V., Lurz, R., Lanka, E. In vitro assembly of relaxosomes at the transfer origin of plasmid RP4. Proceedings of the National Academy of Sciences, USA. 87, (17), 6555-6559 (1990).
  41. Song, K., Tan, X., Liang, Y., Lu, X. The potential of Synechococcus elongatus UTEX 2973 for sugar feedstock production. Applied Microbiology and Biotechnology. 100, (18), 7865-7875 (2016).
  42. Waters, V. L., Guiney, D. G. Processes at the nick region link conjugation, T-DNA transfer and rolling circle replication. Molecular Microbiology. 9, (6), 1123-1130 (1993).
  43. Elhai, J., Vepritskiy, A., Muro-Pastor, A. M., Flores, E., Wolk, C. P. Reduction of conjugal transfer efficiency by three restriction activities of Anabaena sp. strain PCC 7120. Journal of Bacteriology. 179, (6), 1998-2005 (1997).
  44. Silva-Rocha, R., et al. The Standard European Vector Architecture (SEVA): A coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research. 41, (D1), D666-D675 (2013).
  45. Mandakovic, D., et al. CyDiv, a conserved and novel filamentous cyanobacterial cell division protein involved in septum localization. Frontiers in Microbiology. 7, (FEB), 1-11 (2016).
  46. Masukawa, H., Inoue, K., Sakurai, H., Wolk, C. P., Hausinger, R. P. Site-directed mutagenesis of the Anabaena sp. strain PCC 7120 nitrogenase active site to increase photobiological hydrogen production. Applied and Environmental Microbiology. 76, (20), 6741-6750 (2010).
  47. Yu, J., et al. Synechococcus elongatus UTEX 2973, a fast growing cyanobacterial chassis for biosynthesis using light and CO2. Scientific Reports. 5, (1), 8132 (2015).
  48. Ungerer, J., Wendt, K. E., Hendry, J. I., Maranas, C. D., Pakrasi, H. B. Comparative genomics reveals the molecular determinants of rapid growth of the cyanobacterium Synechococcus elongatus UTEX 2973. Proceedings of the National Academy of Sciences, USA. 115, (50), E11761-E11770 (2018).
  49. Lepesteur, M., Martin, J. M., Fleury, A. A comparative study of different preservation methods for phytoplankton cell analysis by flow cytometry. Marine Ecology Progress Series. 93, (1-2), 55-63 (1993).
  50. Day, J. G. Cryopreservation of cyanobacteria. Cyanobacteria: An Economic perspective. Wiley Blackwell. New York. 319-327 (2014).
  51. Zhou, J., et al. Discovery of a super-strong promoter enables efficient production of heterologous proteins in cyanobacteria. Scientific Reports. 4, 4500 (2014).
  52. Potapov, V., et al. Comprehensive profiling of four base overhang ligation fidelity by T4 DNA ligase and application to DNA assembly. ACS Synthetic Biology. 7, (11), 2665-2674 (2018).
  53. Ravindran, C. R. M., Suguna, S., Shanmugasundaram, S. Electroporation as a tool to transfer the plasmid pRL489 in Oscillatoria MKU 277. Journal of Microbiological Methods. 66, 174-176 (2006).
  54. Stevenson, K., McVey, A. F., Clark, I. B. N., Swain, P. S., Pilizota, T. General calibration of microbial growth in microplate readers. Scientific Reports. 6, 38828 (2016).
  55. Maecker, H. T., Trotter, J. Flow cytometry controls, instrument setup, and the determination of positivity. Cytometry Part A. 69, (9), 1037-1042 (2006).
साइनोगेट मॉड्यूलर क्लोनिंग टूलकिट का उपयोग करके साइनोबैक्टीरिया का आनुवंशिक संशोधन
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Gale, G. A. R., Schiavon Osorio, A. A., Puzorjov, A., Wang, B., McCormick, A. J. Genetic Modification of Cyanobacteria by Conjugation Using the CyanoGate Modular Cloning Toolkit. J. Vis. Exp. (152), e60451, doi:10.3791/60451 (2019).More

Gale, G. A. R., Schiavon Osorio, A. A., Puzorjov, A., Wang, B., McCormick, A. J. Genetic Modification of Cyanobacteria by Conjugation Using the CyanoGate Modular Cloning Toolkit. J. Vis. Exp. (152), e60451, doi:10.3791/60451 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter