Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Genetisk modifisering av cyanobakterier av Bøyning bruke CyanoGate Modular kloning Toolkit

doi: 10.3791/60451 Published: October 31, 2019
* These authors contributed equally

Summary

Her presenterer vi en protokoll som beskriver hvordan jeg) monterer en selv-replikere vektor bruker CyanoGate modulære kloning Toolkit, II) innføre vektoren i en cyanobacterial vert ved Bøyning, og III) karakterisere transgene cyanobakterier stammer ved hjelp av en plate leser eller strømnings flowcytometri.

Abstract

Cyanobakterier er en mangfoldig gruppe av prokaryote fotosyntetiske organismer som kan være genetisk modifisert for fornybar produksjon av nyttige industrielle varer. Nylige fremskritt i syntetisk biologi har ført til utvikling av flere kloning verktøysett som CyanoGate, et standardisert modulært kloning system for å bygge plasmider vektorer for påfølgende transformasjon eller ekteskapelige overføring til cyanobakterier. Her skisserer vi en detaljert metode for montering av en selv-replikere vektor (f. eks, bærer en fluorescerende markør uttrykk kassett) og ekteskapelige overføring av vektoren inn i cyanobacterial stammer Synechocystis Sp. PCC 6803 eller Synechococcus elongatus UTEX 2973. I tillegg skisserer vi hvordan å karakterisere ytelsen til en genetisk del (for eksempel en promoter) ved hjelp av en plate leser eller flow flowcytometri.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Cyanobakterier er autotrofe bakterier som kan brukes for biosyntesen av et bredt utvalg av naturlige og heterologous høy verdi metabolske produkter1,2,3,4,5, 6i den. Flere hekk må fortsatt overvinnes for å utvide sin kommersielle levedyktighet, spesielt, den relativt dårlige rentene sammenlignet med heterotrofe bio-plattformer (f. eks, Escherichia coli og gjær)7. Den nylige utvidelse av tilgjengelige genetisk engineering verktøy og opptak av syntetisk biologi paradigmet i cyanobacterial forskning bidrar til å overvinne slike utfordringer og videreutvikle cyanobakterier som effektiv biofactories8, 9,10.

De viktigste tilnærmingene for å innføre DNA i cyanobakterier er transformasjon, bøyning og electroporation. Vektorer overføres til cyanobakterier ved transformasjon eller electroporation er "selvmord" vektorer (dvs. integrerende vektorer som letter homologe rekombinasjon), mens selv replikere vektorer kan overføres til cyanobakterier av transformasjon, Bøyning eller electroporation. For det første er en protokoll tilgjengelig for Engineering modell arter mottagelig for naturlig transformasjon11. Flere i den seneste tid, en Modular Klon (MoClo) verktøyet for cyanobakterier alarmert CyanoGate er blitt bebygget det ansette en standardisert gylden gate vektor montering metoden for ingeniørvitenskap benytter naturlig transformasjon, electroporation eller Bøyning12.

Golden Gate-type montering teknikker har blitt stadig mer populært de siste årene, og montering standarder og del bibliotekene er nå tilgjengelig for en rekke organismer13,14,15,16 ,17. Golden Gate bruker type IIS begrensning enzymer (f. eks BsaI, BpiI, BsmBI, BtgZI og AarI) og en drakt av aksept Orer og unike overheng å lette retningsbestemt hierarkisk montering av flere sekvenser i en "One pot" montering reaksjon. Type IIS restriksjon enzymer gjenkjenne en unik asymmetrisk sekvens og kutte en definert avstand fra deres anerkjennelse nettsteder for å generere en forskjøvet, "klebrig ende" cut (vanligvis en 4 nukleotid [NT] overheng), som senere kan utnyttes til å kjøre bestilte DNA monterings reaksjoner15,18. Dette har muliggjort utviklingen av store biblioteker av modulære nivå 0 deler (for eksempel arrangører, åpne lese RAM mer og terminatorer) definert av en felles syntaks, for eksempel PhytoBricks standard19. Nivå 0 deler kan deretter lett monteres i nivå 1 uttrykks kassetter, som følger mer komplekse høyere rekkefølge samlinger (f. eks multigene uttrykk konstruksjoner) kan bygges i en Acceptor vektor av valget12,15. En viktig fordel med Golden Gate-type montering teknikker er deres amenability til automatisering ved høy gjennomstrømming fasiliteter, slik som DNA støperier20,21, som kan tillate for testing av komplekse eksperimentelle design som kan ikke lett oppnås ved manuell arbeidskraft.

CyanoGate bygger på det etablerte anlegget MoClo system12,15. Å innlemme en ny del i CyanoGate, delen sekvensen må først være tamme, dvs., "ulovlig" anerkjennelse nettsteder for BsaI og BpiI må fjernes. I tilfelle av en del koding for en åpen lesning ramme (dvs. en koding sekvens, CDS), kan anerkjennelse nettsteder bli forstyrret ved å generere synonymt mutasjoner i sekvensen (dvs. endre en Codon til et alternativ som koder for samme aminosyre rester). Dette kan oppnås ved en rekke tilnærminger, alt fra DNA-syntese til polymerase kjedere reaksjon (PCR) forsterkning-baserte strategier som Gibson forsamlingen22. Avhengig av uttrykket vert som brukes, bør det utvises forsiktighet for å unngå innføringen av sjeldne kodon som kan hemme effektiviteten av oversettelsen23. Fjerne anerkjennelse nettsteder i promoter og Terminator sekvenser er vanligvis en risikofylt forsøke, som modifikasjoner kan påvirke funksjon og delen kan ikke utføre som forventet. For eksempel kan endringer i antatte transkripsjon faktor bindende nettsteder eller ribosom bindende nettsted innen en promoter endre styrke og respons til induksjon/undertrykkelse. Likeledes modifikasjoner til viktige Terminator strukturelle funksjoner (f. eks GC rike stammen, loop og Poly-U Tail) kan endre oppsigelse effektivitet og virkning gen Expression24,25. Selv om flere elektroniske ressurser er tilgjengelige for å forutsi aktiviteten til promoter og Terminator sekvenser, og informere om en foreslått mutasjon vil påvirke ytelsen26,27, disse verktøyene er ofte dårlig prediktorer av ytelse i cyanobakterier28,29,30.. Som sådan, in vivo karakterisering av modifiserte deler er fortsatt anbefalt å bekrefte aktivitet. Å bistå med kloning av gjenstridige sekvenser, CyanoGate inneholder en lav kopi kloning Acceptor vektor basert på BioBrick vektor pSB4K512,16,31. Videre, en "design og bygge" Portal er tilgjengelig gjennom Edinburgh Genova Foundry å hjelpe til med vektor design (dab.genomefoundry.org). Til slutt, og viktigst, inkluderer CyanoGate to Level T Acceptor vektor design (tilsvarende Level 2 Acceptor vektorer)15 for innføring av DNA i cyanobakterier bruker selvmords vektorer, eller bred Host-Range vektorer i stand til selv-replikering i flere cyanobacterial arter32,33,34.

Her vil vi fokusere på å beskrive en protokoll for å generere Level T selv replikering vektorer og genetisk modifisering av Synechocystis PCC 6803 og Synechococcus elongatus UTEX 2973 (Synechocystis PCC 6803 og S. elongatus UTEX 2973 heretter) av Bøyning (også kjent som Tri-Parental paring). Ekteskapelige overføring av DNA mellom bakterielle celler er en godt beskrevet prosess og har vært tidligere brukt for Engineering cyanobacterial arter, spesielt de som ikke er naturlig kompetente, slik som S. elongatus UTEX 297335, 36,37,38,39,40,41. I korte trekk, cyanobacterial kulturer er inkubert med en E. coli stamme bærer vektoren skal overføres (den "lasten" vektor) og vektorer (enten i samme E. coli belastning eller i flere stammer) for å aktivere Bøyning ("mobiliserer" og "Helper" vektorer). Det er nødvendig med fire nøkkel vilkår for ekteskapelige overføring: 1) direkte kontakt mellom cellene som er involvert i DNA-overføring, 2) laste vektoren må være kompatibelt med Bøyning (dvs. den må inneholde en passende opprinnelse for overføring (oriT), også kjent som en bom (grunnlaget for mobilitet) nettsted), 3) et DNA skår protein (f. eks, kodet av Mob GENET) som Nicks DNA ved oriT å INITIERE enkelt-strandet overføring av DNA i cyanobacterium må være til stede og uttrykt fra enten lasten eller Helper vektorer, og 4) den overførte DNA må ikke ødelegges i mottaker cyanobacterium (dvs. må være motstandsdyktig mot degradering av for eksempel restriksjon endonuclease aktivitet)35,42. For lasten vektoren å vedvare, opprinnelsen til replikering må være kompatibel med mottakeren cyanobacterium å tillate for selv-replikering og spredning i datter celler innlegg divisjon. Å hjelpe med vilkårene 3 og 4, adskillige hjalp vektorer er anvendelig igjennom Addgene og annet reklamen kilder det omsette til kode for Mob likeledes idet adskillige methylases å beskytte fra innfødt endonucleases inne det vert cyanobacterium43. I denne protokollen, ble Bøyning tilrettelagt av en MC1061 E. coli stamme bærer mobiliserer og hjelper vektorer pRK24 (www. addgeneorg/51950) og pRL528 (www.addgene.org/58495), henholdsvis. Forsiktighet må utvises ved valg av vektorer som skal brukes til ekteskapelige overføring. For eksempel, i CyanoGate Kit den selv-replikere lasten vektor pPMQAK1-T koder for en Mob protein12. Men pSEVA421-T ikke44, og som sådan, må Mob uttrykkes fra en passende hjelper vektor. De vektorer som brukes bør også være hensiktsmessig å målet organisme. For eksempel, effektiv ekteskapelige overføring i Anabaena Sp. PCC 7120 krever en hjelper vektor som beskytter mobiliserer vektor mot fordøyelsen (f. eks pRL623, som koder for de tre methylases AvaiM, Eco47iiM og Ecot22iM)45, i 46.

I denne protokollen vi ytterligere skissere hvordan å karakterisere utførelsen av deler (dvs. arrangører) med et fluorescerende markør ved hjelp av en plate leser eller en flyt flowcytometer. Flow cytometers er i stand til å måle fluorescens på en enkelt celle basis for en stor befolkning. Videre Flow cytometers tillate brukere å "gate" de ervervet data og fjerne bakgrunnsstøy (f. eks, fra partikler i kultur eller forurensning). I kontrast, plate lesere erverve en samlet fluorescens måling av et gitt volum av kultur, vanligvis i flere replikere brønner. Viktige fordeler av plate lesere over cytometers inkluderer lavere kostnader, høyere tilgjengelighet og vanligvis ingen krav til spesialist programvare for nedstrøms dataanalyser. De viktigste ulempene med plate lesere er relativt lavere følsomhet i forhold til cytometers og potensielle problemer med den optiske tettheten av målte kulturer. For sammenlignende analyser, plate leser prøver må være normalisert for hver brønn (for eksempel til en måling av kultur tetthet, vanligvis tatt som absorbansen ved optisk tetthet ved 750 NM [OD750]), som kan føre til unøyaktigheter for prøver som er for tett og/eller ikke godt blandet (f. eks, når utsatt for aggregering eller flokk ule Rings).

Som en oversikt, her viser vi i detalj prinsippene for å generere nivå 0 deler, etterfulgt av hierarkisk montering ved hjelp av CyanoGate Kit og kloning til en vektor egnet for ekteskapelige overføring. Vi viser deretter ekteskapelige overføringsprosessen, utvalg av axenic transconjugant stammer uttrykker en fluorescerende markør, og påfølgende oppkjøp av fluorescens data ved hjelp av en flyt flowcytometer eller en plate leser.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Vector montering ved hjelp av Plant MoClo og CyanoGate verktøysett

Merk: før du fortsetter med vektor montering, anbefales det sterkt at brukerne gjør seg kjent med vektoren nivå strukturer av anlegget og CyanoGate MoClo systemer12,15.

  1. Bygging av nivå 0 deler
    Merk: nivå 0-deler kan bli syntetisert som komplette vektorer eller som lineære sekvenser for montering med nivå 0-aksept Orer (for eksempel gBlocks, IDT). Alternativt kan sekvenser forsterkes fra en kilde mal (for eksempel en vektor eller renset genomisk DNA). Her er en beskrivelse av hvordan du genererer en ny del av nivå 0 fra et forsterket produkt. En oversikt over samle prosessen Golden Gate fra nivå 0 til nivå T vises iFigur 1.
    1. Design grunning.
      1. Bestem hva nivå 0 modul for å montere og identifisere de aktuelle 5 ' og 3 ' overheng (tabell 1)12,15. Sjekk DNA sekvensen å klone for tilstedeværelsen av BpiI eller BsaI begrensning nettsteder.
        Merk: en sekvens som inneholder ett av disse områdene må være tamme ved å endre en eller flere NTs i begrensningen området sekvensen. En strategi for å gjøre dette ved hjelp av Golden Gate forsamlingen er skissert i figur 2.
      2. For å forsterke en DNA-sekvens, designe en passende fremover og omvendt primer pair. For fremover primer, Velg 18 − 30 BP komplementære til 5 ' slutten av DNA mal sekvensen. For omvendt primer, Velg 18 − 30 BP reversere komplementære til 3 ' slutten av DNA mal sekvensen.
        Merk: grunning med smelte temperaturer (Tm) på 58 − 62 ° c gir vanligvis de mest konsekvente forsterknings resultatene (figur 1A).
      3. Legg til følgende til 5 ' slutten av fremover primer: 1) en tilfeldig streng på 4 − 6 NTs på 5 ' slutten av BpiI området, 2) den BpiI begrensning nettsted (GAAGAC), 3) to tilfeldige NTs, og 4) den 5 ' overheng valgt i trinn 1.1.1.1. Legg til følgende til 5 ' slutten av omvendt primer: 1) en tilfeldig streng på 4 − 6 NTs på 5 ' slutten av BpiI området, 2) den BpiI begrensning nettsted (GAAGAC), 3) to tilfeldige NTs, og 4) den 3 ' overheng valgt i trinn 1.1.1.1. Når ferdigstilt, bestille primer parene.
        Merk: se figur 1A for et eksempel på en forover og omvendt primer par.
    2. Forsterke en DNA-sekvens fra genomisk DNA.
      1. Trekk ut genomisk DNA som beskrevet i avsnitt 5. Forsterk produkter fra PCR ved hjelp av en høyverdig DNA-polymerase (tabell med materialer).
        Merk: som et eksempel kan du sette opp PCR-reaksjoner (20 − 50 μL) i henhold til produsentens anvisninger. Bruk ~ 100 ng av genomisk DNA per reaksjon. Bruk et termisk sykkel program som består av et innledende denaturering trinn på 98 ° c i 30 s, etterfulgt av mer enn 25 sykluser med denaturering ved 98 ° c i 10 s, primer annealing ved 58 ° c for 15 s og produkt utvidelse ved 72 ° c for 30 s (endre sistnevnte avhengig av størrelsen på produktet/typen av DNA-polymerase som brukes), etterfulgt av et siste forlengelses trinn på 72 ° c i 2 minutter.
      2. Hvis PCR-produktet skal renses for gel, må du kjøre hele PCR-reaksjonen på en agarose gel som beskrevet i avsnitt 6. Skjær interessen ut av agarose gel og rens den ved hjelp av en gel Extraction Kit (tabell av materialer).
      3. Alternativ til trinn 1.1.2.2, hvis PCR-produktet skal brukes uten gel rensing, kontroller bånd størrelsen ved å kjøre en alikvot av PCR reaksjons prøven (~ 5 μL) på en agarose gel. Hvis gelen bare viser riktig bånd og ingen tegn på primer dimers, renser PCR produktet ved hjelp av en DNA rensing Kit (tabell av materialer).
      4. Eluere renset DNA i et lite volum av deionisert vann (f.eks. 10 μL) for å oppnå en høy DNA-konsentrasjon (> 20 ng/μL er vanligvis tilstrekkelig).
    3. Monter det forsterkede DNA-produktet (eller produktene, se figur 2) i nivå 0. Forbered en 20 μL reaksjons miks med BpiI (figur 1B) og sett opp det termiske cycler programmet som beskrevet i tabell 2. Fortsett til E. coli transformasjon ved hjelp av 5 μL av den sammensatte nivå 0 reaksjonsblandingen (som beskrevet i avsnitt 2).
  2. Bygging av nivå 1-samlinger
    1. Bestem hvilke nivå 0-deler som skal monteres (figur 1C og tabell 1). Velg en passende nivå 1 Acceptor vektor15.
      Merk: på dette stadiet er det viktig å vite hva den endelige vektoren design vil være i Level T, da dette vil påvirke valget av nivå 1 Acceptor vektor. Nivå 1 posisjon 1 (Forward) Acceptor vektor (pICH47732) kan brukes som standard hvis målet er å ha en enkelt nivå 1-enhet (f.eks. et gen uttrykks kassett) på nivå T. Hvis to eller flere enheter på nivå 1 skal settes sammen i nivå T, må imidlertid plasseringen og retningen for hver nivå 1-samling vurderes. Opptil sju nivå 1-samlinger kan monteres i en vektor for nivå T-Acceptor ved hjelp av nivå 1 Acceptor vektorer med riktige posisjoner12.
    2. Monter nivå 0-delene på nivå 1. Forbered en 20 μL reaksjons miks med BsaI og sett opp det termiske cycler programmet som beskrevet i tabell 2. Fortsett til E. coli -transformasjon med 5 μL av den sammensatte reaksjonsblandingen på nivå 1 (som beskrevet i avsnitt 2).
  3. Bygging av Level T-forsamlinger
    1. Bestem deg for hva nivå 1-samlinger skal montere (figur 1D). Velg en hensiktsmessig nivå T Acceptor vektor.
      Merk: pUC19A-T (Ampicillin motstand) og pUC19S-T (spectinomycin motstand) er høy-kopi nummer integrerende vektorer som ikke er i stand til å gjenskape i cyanobakterier og er primært brukes til genomisk integrering (dvs. knock-in eller knock-out av gener) via homologe rekombinasjon12. Levering av integrerende vektorer kan fortsette med naturlig transformasjon i mottagelig cyanobacterial arter11. pPMQAK1-T er en bred vert rekkevidde, replicative vektor som er levert av ekteskapelige overføring (del 3).
    2. Velg en passende end-link for å ombinde 3 ' slutten av den siste nivå 1 forsamlingen til nivå T ryggraden15.
      Merk: end-link kreves er det samme nummeret som plasseringen av den endelige delen. En vektor på nivå T med bare én plassering på nivå 1 (fremover eller bakover) krever for eksempel end-link 1 (pICH50872) for ligation i nivå T-basisnettverket.
    3. Sett sammen ett eller flere nivå 1-samlinger på nivå T. Forbered en reaksjons miks med BpiI og den påkrevde end-link-vektoren og Still inn det termiske cycler programmet som beskrevet i tabell 2. Fortsett til E. coli transformasjon ved hjelp av 5 μL av den sammensatte nivå T reaksjonsblandingen (som beskrevet i avsnitt 2).

2. E. coli transformasjon og vektor rensing

  1. E. coli transformasjon (dag 1)
    1. Tine en alikvot (~ 25 μL) av kjemisk kompetente E. coli -celler (tabell over materialer) og Pipetter forsiktig inn i et 1,5 ml rør på isen. Tilsett 5 μL av monterings blandingen (nivå 0, 1 eller T) og ruge røret på isen i ytterligere 30 − 60 min.
    2. Heat-sjokk celler ved incubating røret i et vannbad ved 42 ° c for 30 s, deretter plassere røret tilbake på isen i 2 min. Tilsett romtemperatur (RT) Super optimal buljong med catabolite undertrykkelse (S.O.C.) medium (250 μL) til røret. Ruge røret ved 37 ° c i 1 time ved 225 RPM i en skjelvende inkubator.
    3. Plate 40 μL av kulturen på en LB agar plate som inneholder den aktuelle endelige konsentrasjonen av antibiotika (100 μg/mL for spectinomycin dihydrochloride pentahydrate [nivå 0], 100 μg/mL carbenicillin Disodium [nivå 1], eller 50 μg/mL av kanamycin sulfat [ Nivå T]), 1 mM isopropylalkohol-beta-D-thiogalactopyranoside (IPTH) og 40 μg/mL av 5-bromo-4-klor-3-indolyl-β-D-galaktopyranosid (X-gal) for blå-hvit screening. Ruge platen over natten ved 37 ° c.
      Merk: mengden av kultur belagt kan varieres avhengig av effektiviteten av E. coli kompetente celler og ligation reaksjon. Plate et større volum hvis < 10 kolonier er observert etter over natten inkubasjons.
  2. Utvalg av hvite kolonier og utarbeidelse av flytende kulturer (dag 2)
    Merk: avhengig av effektiviteten av forsamlingen reaksjon og påfølgende transformasjon, LB agar plater kan inneholde ingen kolonier, blå kolonier eller hvite kolonier (Figur 3). Blå kolonier er tegn på Acceptor vektorer som ikke har gjennomgått restriksjoner (dvs. en funksjonell kopi av lacZ er fortsatt til stede). Hvite kolonier indikerer at lacZ Expression kassetten har gått tapt og erstattet av en del/montering.
    1. Du kan eventuelt validere at hvite kolonier inneholder den forventede vektoren ved å utføre PCR som beskrevet i punkt 7.
    2. Velg enkelt hvite kolonier (eller PCR verifiserte kolonier) med 10 μL spiss og Overfør til et 15 mL sentrifugerør som inneholder LB medium (5 mL) og egnede antibiotika konsentrasjoner (trinn 2.1.3). Ruge rørene ved 37 ° c over natten ved 225 RPM i en skjelvende inkubator.
  3. Plasmider vektor rensing (dag 3)
    1. Alternativt, utarbeide en glyserol lager av overnight E. coli kultur for langsiktige cryostorage av vektorer. Tilsett 500 μL av bakteriell kultur til 500 μL av 50% (v/v) glyserol i et passende 1.5 − 2,0 mL rør for cryostorage ved-80 ° c. Bland forsiktig med invertere 5 − 10x. Flash-fryse prøver i flytende nitrogen og oppbevares i en-80 ° c fryser.
    2. Snurr ned kulturer i 15 mL sentrifugerør ved 3 000 x g i 5 − 10 min. kast supernatanten uten å forstyrre celle pellet. Rens vektoren ved hjelp av en plasmider rensing Kit (tabell av materialer). Eluere renset vektor i 35 μL av deionisert vann.
      Merk: Bruk lavere eluering volumer å ytterligere øke vektoren konsentrasjon. Det samme eluent kan settes gjennom en rensing kolonne to ganger for økt avkastning.
    3. Mål konsentrasjonen av vektoren i eluent ved hjelp av en spektrofotometer (tabell av materialer).
      Merk: høy kopi-tall vektorer i E. coli, som pUC19, vanligvis gir avkastning på 50 − 300 ng/μL. lav kopi-tall vektorer, slik som PPMQAK1-T, vanligvis gir avkastning på 15 − 60 ng/μL.
  4. Vector validering
    Merk: vektorer kan verifiseres ved begrensning fordøyelsen (trinn 2.4.1) og/eller sekvensering (trinn 2.4.2).
    1. Begrens 0,5 − 1 mikrogram vektor med riktig Begrensnings enzym (er) og kontroller de forventede bånd størrelsene som er beskrevet i avsnitt 6 (Figur 4).
      Merk: feil band størrelser indikerer vanligvis feilaktig montering, i så fall kan flere hvite kolonier bli vist eller montering kan gjentas. BsaI og BpiI kan brukes til å validere den riktige størrelsen på innsettings nivået for henholdsvis nivå 0 og nivå 1-samlinger. BsaI eller BpiI kan brukes i forbindelse med en ekstra, kompatibel restriksjon enzym som kutter i innsatsen og/eller vektoren ryggraden til å produsere et distinkt sett av godt separert band etter fordøyelsen.
    2. Sekvens vektoren ved sanger sekvensering bruker en passende primer oppstrøms av den sammensatte regionen ved hjelp av kommersielle sekvensering anlegget (tabell 3).
      Merk: alle nye nivå 0-deler bør være i rekkefølge for å bekrefte forventet sekvens identitet. Sekvens validering av nivå 1 og T vektorer er vanligvis ikke nødvendig hvis samlet fra tidligere sekvens nivå 0 deler.

3. generering av mutanter av Bøyning

Merk: her, en protokoll for ekteskapelige overføring av en selv-replikere Last vektor i Synechocystis PCC 6803 eller S. elongatus UTEX 297311,47 er beskrevet. Denne protokollen gjelder for andre modell arter (f. eks S. elongatus PCC 7942 og SYNECHOCOCCUS Sp. PCC 7002). Alt arbeid med cyanobakterier (og tilhørende buffer forberedelser) bør gjøres under sterile forhold i en laminær strømnings hette.

  1. Veksten av cyanobacterial kulturen (dag 1)
    1. Forbered BG11 medium i henhold til Lea-Smith et al.11, og agar plater med lb-BG11 og BG11 + Kan50 (del 8).
    2. Sett opp en frisk kultur av Synechocystis PCC 6803 eller S. elongatus UTEX 2973 av vaksinere en 100 ml KONISK kolbe av fersk BG11 medium (50 ml) med celler HENTET fra en axenic BG11 agar plate. Grow Synechocystis PCC 6803 kulturer ved 30 ° c, 100 mikromol fotoner m-2s-1 ved 100 RPM og Grow s. elongatus UTEX 2973 ved 40 ° c, 300 mikromol fotoner m-2s-1 ved 100 RPM. Dyrke kulturer til OD750 = 0,5 − 1.5 (vanligvis 1 − 2 dager).
      Merk: S. elongatus UTEX 2973 kulturer kan dyrkes ved 40 ° c i høylys intensitet (f. eks, 2000 mikromol fotoner m-2S-1)48.
  2. Vekst av hjelperen og lasten E. coli stammer (dag 2)
    1. Vaksinere LB-medium som inneholder Ampicillin (siste konsentrasjon 100 μg/mL) og kloramfenikol (siste konsentrasjon 25 μg/mL) med MC1061 E. coli -stamme som inneholder vektorer PRK24 og pRL528 (dvs. hjelpe stammen) og vokse ved 37 ° c over natten ved 225 RPM i en risting inkubator. Vokse opp et tilstrekkelig volum av hjelperen belastning kultur, antar 1 mL av kulturen er nødvendig per Bøyning.
    2. Vaksinere LB medium (5 mL) som inneholder egnede antibiotika med E. coli kultur bærer lasten vektoren (dvs. en level T vektor). Dyrke kulturen ved 37 ° c over natten ved 225 RPM i en risting inkubator.
  3. Ekteskapelige overføring (Tri-foreldre mating) (dag 3)
    1. Forbered E. coli Helper og Last stammer. Sentrifuger hjelperen og lasten E. coli over natten kulturer ved 3 000 x g i 10 min ved romtemperatur. Kast supernatanten uten å forstyrre celle pellet.
    2. Vask pellet ved å legge fersk LB medium uten antibiotika. Bruk samme volum som den opprinnelige kulturen. Resuspend pellet ved forsiktig pipettering opp og ned. Ikke Vortex kulturen. Gjenta dette trinnet 3x for å fjerne rester av antibiotika fra natten kultur.
    3. Sentrifuger den resuspendert kulturen (som i trinn 3.3.1), forkaste supernatanten og resuspend i halve volumet av LB medium for den opprinnelige kulturen volumet (f. eks, 2,5 mL hvis natten kulturen var 5 mL). Kombiner 450 μL av hjelpe belastningen med 450 μL av Last belastningen i et 2 mL rør og sett til side (permisjon ved RT) til trinn 3.3.6.
    4. Forbered cyanobacterial kulturen. For hver Bøyning reaksjon, bruk 1 mL cyanobacterial kultur (OD750 = 0,5 − 1.5).
    5. Sentrifuger det nødvendige totale volumet av cyanobacterial kulturen på 1 500 x g for 10 min ved RT, deretter forkaste supernatanten nøye uten å forstyrre cellen pellet. Vask pellet ved å legge friskt BG11 medium av samme opprinnelige volum. Resuspend pellet ved forsiktig pipettering opp og ned, ikke Vortex kulturen. Gjenta dette trinnet 3x og sette den vasket kulturen til side.
    6. Tilsett en alikvot av vasket cyanobacterial kultur (900 μL) til den kombinerte E. coli stammer (hjelper og Last) (900 μL) i et 2 ml rør. Bland kulturer ved forsiktig pipettering opp og ned. Ikke Vortex. Ruge blandingen ved RT i 30 min for Synechocystis PCC 6803 eller 2 h for S. elongatus UTEX 2973.
    7. Sentrifuger blandingen ved 1 500 x g i 10 min ved RT. Remove 1,6 ml av supernatanten. Resuspend pellet i de resterende ~ 200 μL av supernatanten. Plasser en 0,45 μm membran filter på en LB-BG11 agar plate mangler antibiotika (§ 8). Forsiktig spre 200 μL av E. coli/cyanobacterial kultur Mix på membranen med en steril spredning eller en steril bøyde spissen og forsegle platen med parafin film.
    8. Ruge LB-BG11 plate med membranen for 24 h. Oppretthold membraner med Synechocystis PCC 6803 kulturer ved 30 ° c, 100 mikromol fotoner m-2s-1. Oppretthold membraner med S. elongatus UTEX 2973 kulturer ved 40 ° c i 150 mikromol fotoner m-2S-1.
  4. Membran overføring
    1. Etter 24 h, forsiktig overføre membranen ved hjelp av flamme sterilisert tang til en frisk BG11 agar plate som inneholder egnede antibiotika (§ 8) for å velge for lasten vektor. Forsegle platen med para fin film.
    2. Ruge den BG11 agar plate under passende vekstforhold, som beskrevet ovenfor for Synechocystis PCC 6803 eller S. elongatus UTEX 2973, inntil koloniene vises.
      Merk: kolonier vises vanligvis etter 7 − 14 dager for Synechocystis PCC 6803 og 3 − 7 dager for S. elongatus UTEX 2973.
  5. Valg av conjugants
    Merk: bare cyanobacterial kolonier bærer lasten vektoren vil være i stand til å vokse på membranen (figur 5).
    1. Ved hjelp av en varme steril sløyfe, velger minst to individuelle kolonier fra membranen og strek på en ny BG11 agar plate som inneholder egnede antibiotika (figur 5C).
      Merk: fersk stripete kolonier kan fortsatt være forurenset med E. coli overført fra Bøyning (dvs. Hvis små hvite kolonier er tydelig på tallerkenen), så to eller tre ekstra runder med re-striper på fersk BG11 agar plater vanligvis er nødvendig for å få en axenic cyanobacterial kultur.
    2. Bekreft fravær av E. coli forurensning ved vaksinere en stripe av cyanobacterial kultur i et 15 ml sentrifugerør som inneholder 5 ml lb medium og incubating ved 37 ° c over natten ved 225 RPM i en risting inkubator. Etter en tilstrekkelig vekst periode (~ 7 dager), plukke individuelle axenic kolonier å sette opp flytende kulturer for langsiktig cryostorage eller påfølgende eksperimentering.
  6. Cryostorage av cyanobacterial stammer
    1. Dyrke en cyanobacterial flytende kultur i BG11 (som beskrevet i avsnitt 3,1) til OD750 = 1.5 − 3,0. Sentrifuger 10 mL kultur for 10 min ved 1 500 x g, Fjern supernatanten og resuspend cellene i 5 ml friskt BG11 medium.
    2. Tilsett 3,5 mL autoklav sterilisert 50% (v/v) glyserol for en endelig glyserol konsentrasjon på ~ 20% (v/v)49. Denne tilnærmingen fungerer bra for Synechocystis PCC 6803. Alternativt, tilsett 5 mL filter sterilisert BG11 inneholder 16% (v/v) dimethyl sulfoxide (DMSO) for en endelig DMSO-konsentrasjon på ~ 8% (v/v)50. Denne tilnærmingen anbefales for de fleste stammer, inkludert S. elongatus UTEX 2973.
      FORSIKTIG: DMSO er giftig og bør håndteres med riktig beskyttelse.
    3. Bland forsiktig med invertere 5 − 10x. Subaliquot ~ 1 mL av kulturen i separate cryostorage kompatible 1,5 mL skruen-cap rør (tabell av materialer). Plasser rør i en-80 ° c fryser for cryostorage. Ikke Frys i flytende nitrogen.
      Merk: minst tre aksjer per stamme anbefales.
    4. For gjenvinning, Fjern et rør fra-80 ° c fryseren og tine kulturen i et 35 ° c vannbad mens forsiktig miksing. Legg til tint kulturen til 50 mL frisk BG11 medium og vokse som en flytende kultur (som beskrevet i § 3,1).
      Merk: Alternativt kan kulturen være stripete og dyrkes på en frisk BG11 agar plate. Transgene kulturer bærer utvalgs markører må gjenopplivet først på BG11 agar plater uten antibiotika og deretter restreaked på BG11 agar plater med egnede antibiotika.

4. promoter karakterisering

Merk: Her er en standard tilnærming er beskrevet for å analysere styrken til en formidler del ved å måle uttrykket nivåer av en fluorescerende markør (eYFP) etter en 72 h vekst periode ved hjelp av enten en plate leser eller en flyt flowcytometer12.

  1. Kultur vekst
    1. Sett opp frø kulturer med vaksinere 10 mL BG11 medium som inneholder egnede antibiotika med en enkelt koloni av transgene cyanobacterial stamme som bærer fluorescerende markør uttrykket kassetten. Også forberede frø kulturer for passende negativ kontroll stammer (f. eks en vill type stamme og/eller en transgene stamme bærer samme vektoren ryggraden men mangler fluorescerende markør uttrykket kassett).
      Merk: minst fire biologiske replikerer anbefales.
    2. Dyrke frø kulturer for 48 h eller til OD750 = 1 − 1.5 under vekstforhold egnet for arten belastning.
    3. For å spore promoter uttrykk over tid, må du først måle OD750 for hver frø kultur. Beregn fortynning kravene for å bringe hver kultur til en start OD750 = 0,2. Sett opp utvannet eksperimentell kultur prøver (2 mL totalt volum) i en flat-Bottom 24-brønn plate (tabell av materialer).
    4. Ruge platen i en risting inkubator med hvite LED-lys (tabell av materialer) under passende vekstforhold. Mål kultur vekst tetthet (OD750) og forbedret gult fluorescerende protein (eYFP) fluorescens ved hjelp av enten en plate leser (del 4,2) eller en Flow flowcytometer (§ 4,3).
      Merk: Synechocystis PCC 6803 og S. elongatus UTEX 2973 kulturer kan dyrkes som i trinn 3.1.2. Det anbefales sterkt at platen opprettholdes under en høy luftfuktighet (95%) for å unngå fordampning av kultur prøvene.
  2. Plate-leser
    1. Bland kort kulturene i 24-brønnen plate (trinn 4.1.4) med milde pipettering. Overfør et underutvalg av hver kultur til en svart flat-Bottom 96-brønn plate (tabell over materialer). Fortynne om nødvendig (100 μL endelig volum). Unngå dannelse av bobler, da dette kan forstyrre målenøyaktigheten.
      Merk: det anbefales at alle målinger utføres på prøver i et OD750 -område på 0,2 − 1,0. Som tettheten av kulturer i 24-brønnen vil øke over tid, er følgende fortynninger anbefales basert på den forventede økningen i standard vekstforhold: ingen fortynning ved 0 h, 1:4 ved 24 h, 1:10 på 48 h og 1:10 på 72 h. Så for eksempel ved 24 h Harvest 25 μL av kultur og bland med 75 μL av BG11 medium.
    2. Ta med to blanke brønner i 96 brønn platen (dvs. 100 μL av BG11 medium). Sett 96-brønn platen inn i en plate leser (tabell med materialer). Rist platen for 60 s ved 500 RPM ved hjelp av orbital shaker i plate leseren til å blande brønnene.
      Merk: Cyanobacterial kulturer kan samle og/eller flocculate, så god miksing er avgjørende før lesing for nøyaktige målinger.
    3. Mål OD750 og eYFP fluorescens med eksitasjon/utslipps bølgelengder ved 485 NM/520 NM.
    4. Trekke gjennomsnittet av OD750 målinger av de to tomme BRØNNER fra OD750 måling av hver prøve godt inneholder cyanobakterier kultur.
    5. Normalisere de fluorescens verdiene for hvert kulturutvalg ved å dele eYFP fluorescens måling (trinn 4.2.3) med den justerte OD750 for kulturen (Step 4.2.4). Deretter trekker du den gjennomsnittlige normalisert eYFP fluorescens verdi (eYFP fluorescens/OD750) av biologiske replikerer av en passende negativ kontroll stamme fra transgene stammene bærer eYFP uttrykket kassetten.
      Merk: cyanobakterier naturlig fluorescerer på grunn av tilstedeværelsen av pigmenter, slik som klorofyll og phycobiliproteins.
    6. Plot kultur vekst over tid (figur 6a) og gjennomsnittlig normalisert eYFP fluorescens verdier for hver eksperimentell kultur i ønsket tid poeng (f. eks 72 h; Figur 6B).
  3. Flow-flowcytometer
    1. Velg en kompatibel plate for strømnings flowcytometer væske håndteringssystem. Bruk for eksempel en rund bunn med 96-brønn (tabell med materialer) med flyt Flowcytometer (innholdsfortegnelsen) som brukes i denne protokollen.
    2. Bland kort kulturene i 24-brønnen plate (trinn 4.1.4) med milde pipettering. Fortynne kulturer til OD750 = 0,1 − 0,2 for å unngå dyse blokkeringer i væske håndterings systemet. Legg et passende volum av kultur prøve til 96-brønn platen og Bring til et endelig volum på 250 μL med filter-sterilisert 1x fosfat-bufret saltvann (PBS). Ta med en blank brønn for medium løsningen på platen som inneholder 60 μL av BG11 og 190 μL av 1x PBS.
      Merk: dette volumet anbefales i tilfelle det er behov for å kjøre prøver på nytt. Volumer høyere enn 250 μL er ikke anbefalt som maksimalt volum for hver brønn er 300 μL.
    3. Når strømnings flowcytometer er klar til bruk, plasser 96 brønn platen med kultur prøver i væske håndterings stasjonen. Sett opp programvare protokollen for strømnings flowcytometer for å samle inn målingene for 10 000 individuelle hendelser (f.eks. celler). Mål eYFP fluorescens med eksitasjon/utslipps bølgelengder på 488 NM/515 − 545 NM. Først måle og sjekke lesing fra den tomme brønnen (figur 7A), deretter kjøre prøvene.
    4. Gate befolkningen av cyanobakterier celler innenfor frem og side scatter datasett, unntatt regioner vanlig med blank lesing (figur 7B). Trekke den gjennomsnittlige eYFP fluorescens verdier av biologiske replikerer av en passende negativ kontroll stamme fra transgene stammene bærer eYFP uttrykket kassetten (figur 7C, D). Plot gjennomsnittet av median fluorescens verdier per celle for hver eksperimentell kultur i ønsket tid poeng (for eksempel 72 h; Figur 7E).

5. genomisk DNA-ekstraksjon fra cyanobakterier

Merk: protokollen nedenfor bruker et kommersielt DNA-ekstraksjon Kit (tabell av materialer).

  1. Dyrke en cyanobacterial flytende kultur i BG11 (som beskrevet i avsnitt 3,1) til OD750 = 1.5 − 3,0. Snurr ned 10 mL kultur ved 3 000 x g i 10 min og kast supernatanten. Frys pellet ved å incubating rørene ved-20 ° c i 30 min.
  2. Tilsett 400 μL av lyseringsbuffer (buffer AP1) og 400 μL av ribonuklease oppløsning (RNase A) og 50% (w/v) av glassperler (0,5 mm diameter). Forstyrre prøvene ved bruk av en perle mølle (tabell av materialer) ved 30 Hz (dvs. tilsvarende 1 800 svingninger/min) i 6 min.
  3. Snurr prøven på 17 000 x g i 5 minutter, og Overfør supernatanten forsiktig inn i et nytt rør og kast pellet. Fortsett i henhold til produsentens anvisninger (materialfortegnelsen).

6. Agarose gel elektroforese

  1. Cast en 1% (w/v) agarose gel som inneholder 0,02% (v/v) etidiumbromid bromide. Last prøver og en passende DNA stige referanse.
  2. Kjør prøvene for 50 min ved 125 V. Sjekk for bånd separasjon på en ultrafiolett (UV) transilluminator.
    Merk: kjøretiden og agarose gel kan endres slik at den passer til den forventede bånd størrelsen. For eksempel, en høyere prosentandel agarose gel og lengre kjøretid kan forbedre bandet oppløsning og separasjon av DNA-produkter < 500 BP.

syvende koloni PCR

  1. Sett opp en PCR-reaksjons miks ved hjelp av et standard sett (tabell av materialer) og en passende kombinasjon av primere (f. eks, grunning som flanke forsamlingen regionen eller er spesifikke for sekvenser innenfor forsamlingen regionen (tabell 3). Pipetter 10 μL i et PCR-rør.
  2. Berør forsiktig toppen av en enkelt hvit koloni med en steril tannpirker eller 10 μL pipette spissen og vaksinere et PCR-rør som inneholder PCR-reaksjons miks. Pass på å markere kolonien og matche med den spesifikke PCR røret. Rør reaksjonsblandingen forsiktig for å sikre at E. coli -cellene blir utgytt i løsningen.
  3. Forsterk produkter fra PCR. Bruk et program som består av et innledende denaturering trinn på 95 ° c for 60 s, 30 runder med 95 ° c i 15 s, 58 ° c for 15 s (få grader under Tm -verdiene til grunning), 72 ° c for 30 s (30 s/KB av sett inn) , etterfulgt av et siste Utvidelses trinn på 72 ° c i 5 minutter.

8. utarbeidelse av BG11 medium og plater

  1. Forbered lager løsninger med 100-BG11 medium, jern (ammonium Ferric citrate), sporstoffer, fosfat (K2HPO4), na2co3 og tes buffer i henhold til Lea-Smith et al.11. Autoklav fosfat og na2co3 aksjer. Bruk 0,2 μm-filter til å sterilisere TES buffer (pH 8,2) og NaHCO3 Stock-løsninger.
  2. Forbered 1 L av BG11 medium. Bland 10 mL 100 BG11, 1 mL sporstoffer og 1 mL jern lager og autoklav oppløsningen med 976 mL vann. Når oppløsningen er avkjølt til RT, tilsett 1 mL fosfat lager, 1 mL av na2co3 Stock og 10 ml NaHCO3, og Juster til pH 7.6 − 7.8 med 1 M HCL.
  3. LB-BG11 agar plater (1,5% [w/v])
    1. Kombiner 700 mL deionisert vann og 15 g agar i et glass kolbe. I en annen kolbe legger du til 186 mL vann, 10 mL 100 BG11, 1 mL sporstoffer og 1 mL jern lager. Autoklav begge løsninger.
    2. Når løsningene har kjølt ned til rundt 60 ° c, kombinere dem og tilsett 1 mL fosfat lager, 1 mL av na2co3 lager, 10 ml NaHCO3 lager og 50 ml lb sterilt medium, som skal gi et endelig volum av 1 L. cast Petri retter med 25 mL LB-BG11 agar medium.
  4. BG11 + Kan50 agar plater (1,5% [w/v])
    1. Kombiner 700 mL deionisert vann og 15 g agar i et glass kolbe. I en annen kolbe legger du til 3 g natrium AmmoniumThioSulfat (na2S2O3), 226 ml med vann, 10 ml 100 a BG11 lager, 1 ml sporstoffer og 1 ml jern lager. Autoklav begge løsninger.
    2. Når løsningene har kjølt ned til rundt 60 ° c, kombinere dem og tilsett 1 mL fosfat lager, 1 mL av na2co3 Stock, 10 ml av tes buffer lager, og 10 ml NaHCO3 Stock, som skal gi et endelig volum på 1 L. Legg kanamycin sulfat til en endelig konsentrasjon på 50 μg/mL og støpte Petri-retter med 35 mL medium.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

For å demonstrere Golden Gate montering arbeidsflyt, en uttrykks kassett ble montert i nivå 1 posisjon 1 (Forward) Acceptor vektor (pICH47732) som inneholder følgende nivå 0 deler: arrangøren av C-phycocyanin operon Pcpc560 (PC 0.005), kodingen sekvensen for eYFP (pC 0.008) og den doble Terminator TrrnB (PC 0.082)12. Etter transformasjon av monterings reaksjonen ble vellykkede forsamlinger identifisert ved bruk av standard blå-hvit screening av E. coli -koloniene (Figur 3). Den eYFP uttrykket kassetten i nivå 1 vektor og end-link 1 vektor (pICH50872) ble deretter satt sammen til en level T Acceptor vektor (pPMQAK1-T) for å gi vektoren cpcBA-EYFP (Figur 4a). Den monterte cpcBA-eYFP Vector ble verifisert av Begrensnings fordøyelsen (Figur 4B).

Vellykket ekteskapelige overføring av cpcBA-eYFP eller den tomme PPMQAK1-T vektor (dvs. en negativ kontroll mangler eYFP uttrykket kassett) resulterte i veksten av opp til flere hundre kolonier på membranen for Synechocystis PCC 6803 og S. elongatus UTEX 2973 etter henholdsvis 7 − 14 dager og 3 − 7 dager (figur 5). Individuelle kolonier ble plukket og stripete på fersk BG11 + Kan50 agar plater; 2 − 3 re-striper ble pålagt å generere axenic kulturer.

Som forventet for den sterke Pcpc560 promoter51, var verdiene for normalisert eYFP fluorescens fra plate leseren og eYFP fluorescens per celle fra strømnings flowcytometer høye sammenlignet med den negative kontrollen (figur 6 og Figur 7). Fluorescens verdier var høyere i S. elongatus UTEX 2973 enn i Synechocystis PCC 680312.

Figure 1
Figur 1: oversikt over monteringsprosessen Golden Gate i CyanoGate. Montering av et genuttrykk kassett vises, fra forsterkning av en sekvens av interesse fra mal DNA til montering i en nivå T vektor (deler er ikke trukket til skala). (A) design av Forward og Reverse primere for forsterkning av en CDS1 del fra mal DNA (f. eks, genomisk eller plasmider DNA). Plasseringene av BpiI begrensning steder og overheng krevde for innsettingen inn i Acceptor vektor (i.e., 5 ′ og 3 ′ av malen orden) er fremhevet inne rød og blåfarge, respectively. Bokstaven "n" angir at alle NT kan brukes i denne posisjonen. De annealing delene av primere med DNA-malen og deres anbefalte smelte temperaturer (Tm) er indikert. (B) nivå 0 montering av PCR produktet i nivå 0 CDS1 Acceptor vektor pICH41308. Sekvensen som vil bli excised av BpiI og ligaturer inn i Acceptor vektoren er uthevet i blått. (C) nivå 1 montering av et gen uttrykks kassett som inneholder tre deler på nivå 0 (Pro + 5U, CDS1 og 3U + ter) på nivå 1 posisjon 1 (forover) Acceptor vektor PICH47732 med BsaI. (D) nivå t montering av nivå 1 montering og ende-link 1 (pICH50872, kalt "level M end-link 1" i engler et al.15) til et nivå t Acceptor vektor (f. eks pPMQAK1-T) ved hjelp av BpiI. (E) den endelige sammensatte Level T vektor. Forkortelser: AmpR, Ampicillin motstand kassett; CarbR, carbenicillin motstand kassett; CDS1, koding sekvens i nivå 0 syntaks15; EL1, end-link 1 del; KanR, kanamycin motstand kassett; lacZα, β-galaktosidase uttrykk kassett; SpecR, spectinomycin motstands kassett. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: en PCR-basert domestisering strategi for fjerning av en ulovlig type IIS restriksjons område. (A) skjematisk diagram som viser to primer par (i grønt og oransje, henholdsvis) for å endre en BpiI nettsted (GAAGAC) til GAGGAC i et PROTEIN koding DNA sekvens beregnet for montering i CDS1 Level 0 Acceptor vektor (pICH41308). Merk at modifisering bevarer Codon for Glutaminsyre syre (Glu) (dvs. GAA til GAG). Selv om BpiI området er vist i rammen med start Codon, vil denne tilnærmingen fungerer selv om området ikke er i rammen (dvs. så lenge området er forstyrret, og protein sekvensen bevart). Plasseringen av BpiI restriksjons nettsteder og overheng i primere er uthevet i rødt og blått, henholdsvis. DNA malen og den oversatte protein sekvensen er uthevet i gult. De annealing delene av primere med DNA-malen og deres anbefalte smelte temperaturer (Tm) er indikert. Den oransje paret brukes til å forsterke den 5 ' slutten av sekvensen med overheng AATG og TGAA (fragment 1), mens den grønne paret brukes til å forsterke 3 ' end med overheng TGAA og GCTT (fragment 2). Før du bestiller primere, ble gjengivelsen av TGAA fusjons overheng for fragment 1 og 2 nøye kontrollert52. Dårlig utformet Fusion overheng kan føre til montering svikt (dvs. ingen kolonier etter transformasjon; Figur 5) eller falske positiver (f.eks. avkortet eller feilaktige sammenstillinger). Sistnevnte kan løses være screening et større antall hvite kolonier for å identifisere en riktig sammensatt konstruksjon. (B) Amplicons av fragmenter 1 og 2 etter begrensning med BpiI under Golden Gate-monteringen. (C) den tamme sekvensen satt sammen i Level 0 CDS1 Acceptor vektor. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: blå-hvit koloni screening av E. coli Transformants følgende Golden Gate montering. Platene som vises inneholder LB agar (1% [w/v]) supplert med X-gal, IPTH og antibiotika ved passende konsentrasjoner. (A) ingen kolonier, antyder en mislykket montering reaksjon og/eller E. coli transformasjon. (B) for det meste blå kolonier, som indikerer en vellykket forsamling, men at effektiviteten av restriksjonen enzym som brukes i forsamlingen reaksjonen var lav. (C) hovedsakelig hvite kolonier, tegn på en typisk, vellykket montering reaksjon. (D) ingen blå kolonier, noe som indikerer svært effektiv montering. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4: verifisering av en samlet Level T vektor av restriksjon fordøyelsen. Den vektorer ble fordøyd med HindIII og BamHI. (A) sekvens kart over tomme PPMQAK1-T Acceptor VEKTOR (CT. 0) og Level T-montering (cpcBA-eYFP) viser komponenter i EYFP uttrykket kassetten (PCpc560-eYFP-TrrnB). Plasseringene til Begrensnings områdene for HindIII og BamHI er angitt. Etter dobbel fordøyelse er de anslåtte størrelsene på DNA-fragmentene indikert: (1) 5 847 BP, (2) 2 004 BP, (3) 30 BP, (4) 374 BP, (5) 1 820 BP, (6) 1 289 BP, og (7) 156 BP. (B) en agarose gel (0,8% [w/v]) kjøre på 125 v for 60 min lastet med fordøyd Level T montering (cpcBA-eYFP) viser band 1, 5 og 6, den fordøyd tomme PPMQAK1-T Acceptor VEKTOR (CT. 0) viser band 1 og 2 og en DNA stige (tabell av materialer). Merk at band 3, 4 og 7 var for små til å visualisere på gel. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 5
Figur 5: vekst av transgene Synechocystis PCC 6803 kolonier etter vellykket Bøyning. Eksempler på membraner etter inkubasjons på BG11 + Kan50 agar plater er vist. (A) overvekst etter svært effektiv Bøyning-den Synechocystis PCC 6803 koloniene har utviklet seg til en plen med ingen individuelle kolonier. (B) en god Bøyning effektivitet viser flere hundre individuelle kolonier etter 12 dager. (C) vekst av en axenic stamme etter 14 dager etter flere runder med re-striper på en frisk BG11 + Kan50 agar plate. Fravær av bakteriell forurensning indikerte at Synechocystis PCC 6803 transconjugant var axenic. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 6
Figur 6: representative vekst data og normalisert eYFP fluorescens verdier ved hjelp av en plate leser. (A) vekst sammenligning av stammer som frakter cpcBA-EYFP eller den tomme pPMQAK1-T-vektoren (CT. 0, negativ kontroll) i Synechocystis PCC 6803 og S. elongatus UTEX 2973. Verdier er midlene ± SE fra fire biologiske replikerer. Synechocystis PCC 6803 og S. elongatus UTEX 2973 var kultivert for 72 h ved 30 ° c med kontinuerlig lys (100 mikromol fotoner m-2s-1) og 40 ° c med 300 mikromol fotoner m-2s-1, henholdsvis. (B) normalisert eYFP fluorescens verdier for Synechocystis PCC 6803 eller S. Elongatus UTEX 2973 bøyd med CpcBA-eYFP ved 72 h. verdier er midlene ± se fra fire biologiske replikerer. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 7
Figur 7: representative eYFP fluorescens verdier ved hjelp av en flyt flowcytometer. (A) Forward (FSC-h) og side (SSC-h) scatter plot fra "blank" medium løsning (BG11 og PBS). (B) scatter plot for en Synechocystis PCC 6803 sample (høyre). Sirkelen viser den valgte regionen gating den cyanobakterier populasjonen fra resten av prøvesignalet. (C) histogram av gated region for en belastning bærer den tomme PPMQAK1-T VEKTOR (CT. 0, negativ kontroll). (D) histogram av gated region for en belastning bærer cpcBA-eYFP. (E) eYFP fluorescens verdier per celle i Synechocystis PCC 6803 og S. elongatus UTEX 2973 ved 72 h. fluorescens fra negativ kontroll er trukket fra. Verdier er midlene ± SE fra fire biologiske replikerer. Vennligst klikk her for å se en større versjon av dette tallet.

nei. Vektor-ID navn Beskrivelse 5 ' overheng 3 ' overheng
1 pICH41233 Pro Promoter GGAG Takt
2 pICH41295 Pro + 5U Promoter og 5 uoversatt region GGAG AATG
3 pAGM1251 Pro + 5U (f) Arrangøren og 5 uoversatt sekvens for N-Terminal fusjoner GGAG CCAT
4 pICH41246 5u 5 uoversatt region Takt CCAT
5 pAGM1263 5U (f) 5 ′ uoversatt sekvens for N Terminal fusjoner Takt CCAT
6 pICH41246 5U + NT1 5 uoversatt region og N Terminal koding region Takt CCAT
7 pAGM1276 NT1 N Terminal kode eller lokaliserings signal CCAT AATG
8 pICH41258 Sp Signal peptid AATG AGGT
9 pICH41258 NT2 N Terminal kode eller lokaliserings signal AATG AGGT
10 pAGM1287 CDS1 NS Coding regionen uten stopp Codon AATG TTCG
11 pICH41308 CDS1 Coding region med stopp Codon AATG GCTT
12 pAGM1299 CDS2 NS Coding region-uten start og stopp Codon AGGT TTCG
13 pICH41264 CDS2 Coding region-uten start og med stopp Codon AGGT GCTT
14 pAGM1301 Ct C terminal kode eller lokalisering signal TTCG GCTT
15 pICH53388 3U 3 uoversatt-regionen GCTT GGTA
16 pICH53399 Ter Terminator GGTA CGCT
17 pICH41276 3U + ter 3 uoversatt region og Terminator GCTT CGCT
18 pICH41331 Cgm Acceptor for komplette gen kassetter GGAG CGCT
19 pCA-0.002 Pro (lav kopi) Promoter, lavt kopi nummer Acceptor (pSC101 Ori) GGAG Takt
20 pCA-0.001 Pro TSS Arrangøren avkortet til transkripsjon Start site GGAG TAGC
21 Direkte til nivå 1 srRNA Små regulatoriske RNA (for translational demping) TAGC GTTT
22 Direkte til nivå 1 sgRNA Enkel guide RNA (for CRISPRi) TAGC GTTT
23 pICH41295 OPP FLANKE Flankerer sekvens oppstrøms av målet homologe rekombinasjon nettsted GGAG AATG
24 pICH41276 NED FLANKE Flankerer sekvens nedstrøms av målet homologe rekombinasjon nettsted GCTT CGCT

Tabell 1: en liste over tilgjengelige nivå 0 Acceptor vektorer og overheng. Vektorer 1 − 18 er fra Plant MoClo-settet15. Vektorer 19 − 22 er fra CyanoGate Kit12. For srRNA-og sgRNA-deler settes syntetisert sekvenser eller PCR-produkter direkte inn i nivå 1 Acceptor vektorer. Vektorer 23 − 24 er fra Plant MoClo-settet som har blitt re-purposed for transformasjon av homologe rekombinasjon ved hjelp av CyanoGate-settet.

BpiI monteringskomponenter (nivå 0, T) BsaI monteringskomponenter (nivå 1)
50 − 100 ng av Acceptor vektor 50 − 100 ng av Acceptor vektor
For hver vektor/del å sette inn, bruk en 2:1 ratio av INSERT: Acceptor vektor. For hver vektor/del å sette inn, bruk en 2:1 ratio av INSERT: Acceptor vektor.
2 μL 10 mM ATP (tabell av materialer) 2 μL 10 mM ATP (tabell av materialer)
2 μL buffer G (buffer for BpiI/BsaI) 2 μL buffer G (buffer for BpiI/BsaI)
2 μL BSA (10x) (tabell med materialer) 2 μL BSA (10x) (tabell med materialer)
10 enheter BpiI (1 μL10 U/μL BpiI, tabell over materialer) 10 enheter BsaI (1 μL 10 U/μL BsaI, tabell over materialer)
Bring til 20 μL med dH2O. Bring til 20 μL med dH2O.
200 enheter T4 DNA-ligase (1 μL 200 U/μL, tabell over materialer) 200 enheter T4 DNA-ligase (1 μL 200 U/μL, tabell over materialer)
Thermocycler protokoll (nivå 0, T) Thermocycler protokoll (nivå 1)
37 ° c i 10 min syklus x 5 37 ° c i 10 min syklus x 5
16 ° c i 10 min 16 ° c i 10 min
37 ° c i 20 min 37 ° c i 20 min
65 ° c i 10 min 65 ° c i 10 min
16 ° c (hold) 16 ° c (hold)

Tabell 2: protokoller for Golden Gate-samlinger i nivå 0, 1 og T. Montering i nivå 0 og Level T Acceptor vektorer bruker restriksjon enzym BpiI (venstre). Montering i nivå 1 Acceptor vektorer bruker restriksjon enzym BsaI (høyre). Denne tabellen er tilpasset fra Vasudevan et al.12.

Primer nr. Sekvens (5 '-3 ') Lengde (BP) Beskrivelse
L0T fremover GTCTCATGAGCGGATACATA
TTTGAATG
28 For forsterkning fra nivå 0 og nivå T
L1 revers GAACCCTGTGGTTGGCATGC
ACATAC
26 For forsterkning fra nivå 1
L1 forover CTGGTGGCAGGATATATTGT
GGTG
24 For forsterkning fra nivå 1
L0T revers TTGAGTGAGCTGATACCGCT 20 For forsterkning fra nivå 0 og nivå T

Tabell 3: liste over primere for PCR-validering eller sekvensering av nivå 0, 1 og T vektorer.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Golden Gate forsamlingen har flere fordeler sammenlignet med andre vektor montering metoder, spesielt i form av skalerbarhet20,21. Likevel, å sette opp Golden Gate-systemet i et laboratorium krever tid til å utvikle en fortrolighet med de ulike delene og Acceptor vektor biblioteker og generelle monteringsprosesser. Nøye planlegging er ofte nødvendig for mer komplekse forsamlinger eller når du utfører et stort antall komplekse forsamlinger parallelt (for eksempel å lage en pakke med nivå T vektorer som inneholder flere genuttrykk kassetter). Vi anbefaler å først liste alle de Gene Expression kassett kombinasjonene som kreves og deretter kartlegge arbeidsflyten fra nivå 0 til nivå T i silisiummangan. Under denne prosessen bør brukere vurdere nivå 1 "dummy"-delene som er tilgjengelige i Plant MoClo-settet som tillater montering av ikke-sammenhengende nivå 1-vektorer på nivå T (for eksempel nivå 1-posisjon 1 og plassering av 3-vektorer kan settes sammen med en del av "dummy" Nivå 1 posisjon 2), som kan redusere det totale antallet monterings reaksjoner og kloning trinn kreves15.

DNA-syntese er vanligvis den enkleste metoden for å bygge nye nivå 0 deler. Men når kloning er nødvendig (f. eks, fra plasmider eller genomisk DNA), optimalisere utformingen av primere brukes til forsterkning er viktig for å maksimere effektiviteten av påfølgende Level 0 vektor montering. De to mest kritiske trinnene i primer design er: 1) kontrollerer at de riktige overheng er inkludert og er i riktig retning for forover og bakover primere (figur 1 og tabell 1), og 2) sikrer at lengden på primer sekvensen som anneals til malen er tilstrekkelig lang (18 − 30 BP) og at Tm -verdien for denne sekvensen (ideelt 58 − 62 ° c) er lik for primer paret (figur 1A). Hvis en sekvens krever domestisering, er flere strategier tilgjengelige. For korte sekvenser (f. eks < 200 BP), et par lange fremover og omvendt primere kan utformes der 3 ' ender anneal til hverandre (dvs. en overlapping av > 20 BP) og danner en dobbel strandet sekvens etter forsterkning. For lengre sekvenser, kan separate fragmenter av sekvensen forsterkes som fjerner ulovlig begrensning nettsteder og deretter monteres ved hjelp av en Golden Gate montering tilnærming (figur 2). Hvis monterings effektivitet med PCR-produkter er dårlig, kan individuelle fragmenter av en nivå 0-sekvens bli klonet i den universelle Acceptor vektoren for nivå 1 (pAGM1311), validert og deretter satt sammen til riktig nivå 0 Acceptor vektor15. En 2:1 innsats: Acceptor vektor molar ratio anbefales for effektiv Golden Gate montering. Men for forsamlinger av bare 2-3 vektorer (f. eks, to nivå 0 deler og en nivå 1 Acceptor vektor), kombinere ~ 100 ng av hver regelmessig vanligvis resulterer i vellykkede forsamlinger. Effektiviteten av forsamlinger har en tendens til å avta som antall vektorer brukes per reaksjon øker, noe som resulterer i en reduksjon i totalt antall hvite kolonier etter transformasjon (Figur 3).

Før Bøyning anbefales validering av endelige nivå T-vektorer av Begrensnings Sammendrag og PCR. Ekteskapelige DNA Transfer er en godt oppbygget teknikk for cyanobacterial stammer, inkludert de som ikke er naturlig transformable41,45. Viktige trinn i Bøyning protokollen inkluderer: 1) forsiktig håndtering av hjelperen E. coli stamme etter natten vekst (f. eks, unngå virvlingen)35, 2) å ta vare å fjerne spor av antibiotika som brukes til å dyrke hjelperen og Last E. coli stammer, 3) en passende inkubasjonsperiode for blanding av Last og hjelper stammer og cyanobakterier (for eksempel en lengre inkubasjonsperiode var avgjørende for S. elongatus UTEX 2973), og 4) den første overgangsperioden av cellen blanding på membraner i LB-BG11 agar plater mangler antibiotika for 24 h.

Isolerte cyanobacterial kolonier bør utvikles på membranen innen to uker for Synechocystis PCC 6803 og S. elongatus UTEX 2973, ellers er det sannsynlig at Bøyning mislyktes. Flere modifikasjoner på protokollen kan deretter testes, inkludert 1) ved bruk av en cyanobacterial kultur med en høyere Start tetthet (f.eks. OD750 = 1.5 − 2); 2) øke inkubasjonsperioden før overføring til membranen; og 3) utvide den første inkubasjonsperioden på membranen fra 24 h til 48 h (dvs. å tillate mer tid for uttrykket av antibiotikaresistens genet på den overførte vektoren). Hvis Bøyning fortsatt svikter, kan alternative metoder som electroporation prøves53. Bekrefter en transgene cyanobacterial stamme er axenic er viktig før videre eksperimentering. Til slutt er det god praksis å bekrefte størrelsen på heterologous vektoren i transgene cyanobacterial-belastningen. Sistnevnte krever DNA-ekstraksjon (§ 5), transformasjon til E. coli og valg (§ 2,1), og vektor validering (§ 2,4).

Skissert promoter karakterisering protokollen bruker små kultur volumer (dvs. 2 mL) som et middel for å oppnå en høy gjennomstrømming screening metodikk. Større volumer kan brukes avhengig av photobioreactor tilgjengelig plass, noe som vil bidra til å redusere kultur fordampning problemer. Hvis høy gjennomstrømming screening med små kultur volumer er nødvendig, er det viktig å ha høy luftfuktighet i vekst kammeret for å hemme fordampning. Fordampning under en vekst eksperiment kan være skadelig for nøyaktigheten og gyldigheten av prøven målinger. Må sjekke kultur volumer under og etter eksperimentet for å bekrefte hvor mye fordampning har skjedd.

For plate leser målinger er det viktig å måle kulturer ved lav tetthet, ideelt OD750 < 1, for å sikre oppkjøpet av pålitelige og reproduserbar vekst og fluorescens data. En lineær sammenheng mellom celle nummer og OD750 er observert bare innenfor et bestemt område54. For å etablere dette området anbefaler vi at du utfører en seriell fortynning (f.eks. fra OD750 = 0,1 − 1.0) ved hjelp av en kjent Transformant der eYFP-fluorescens er bekreftet. Plotting absolutt fluorescens mot normalisert fluorescens (eYFP fluorescens/OD750) vil bidra til å identifisere den lineære arbeider spekter av kultur tetthet. Flere plate lesere inkluderer en "gevinst"-funksjon for å endre følsomheten til fluorescens detektoren. I dette tilfellet må forsterknings verdien settes til et passende nivå før eksperimentet starter, og ikke endres mellom ulike eksperimentelle kjøringer eller dataene vil ikke være direkte sammenlignbare.

Selv om driften av ulike Flow cytometers vil variere mellom produsentene, er det viktig å ta en blank lesning av medium løsning for å lette identifisering og gating av målet cyanobacterial befolkningen fra enhver bakgrunn signal i mediet (figur 7A, B). Etter dette, subtraksjon av den fluorescens verdien av den negative kontrollen prøven (f. eks en vill type stamme) vil bidra til å fjerne innfødte autofluorescence (figur 7C, D). Spennings parameteren photomultiplier Tube (PMT) i en strømnings flowcytometer har en lignende funksjon til forsterkningen i en plate leser, det vil si å øke eller redusere følsomheten til detektoren til intensiteten av det fluorescens signalet. Som med plate leseren, bør PMT-spenningen settes til et passende nivå før forsøket starter eksperimentet55. Når det er angitt, skal verdien for PMT-spenning opprettholdes mellom ulike eksperimentelle kjøringer eller dataene vil ikke være direkte sammenlignbare.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ingenting å avsløre.

Acknowledgments

Forfatterne er takknemlige for PHYCONET bioteknologi og biologisk vitenskap Research Council (BBSRC) nettverk i Industrial bioteknologi og bioenergi (NIBB) og Industrial bioteknologi Innovation Centre (IBioIC) for økonomisk støtte. GARG, AASO og AP erkjenner finansiering støtte fra BBSRC EASTBIO CASE PhD-programmet (gi nummer BB/M010996/1), Consejo Nacional de Ciencia y Tecnología (CONACYT) PhD-programmet, og IBioIC-BBSRC Collaborative Training Partnership (CTP) PhD-programmet, Henholdsvis. Vi takker Conrad Mullineaux (Queen Mary University of London), og Poul Eric Jensen og Julie Annemarie Zita Zedler (Universitetet i København) for plasmider vektor og protokoll bidrag og råd.

Materials

Name Company Catalog Number Comments
5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal) Thermo Fisher Scientific R0404 Used in 2.1.3.
Adenosine 5′-triphosphate (ATP) disodium salt Sigma-Aldrich A2383 Used in Table 2.
Agar (microbiology tested) Sigma-Aldrich A1296-500g Used in 8.3.
Agarose Bioline BIO-41026 Used in 6.
Attune NxT Flow Cytometer Thermo Fisher Scientific - Used in 4.3.1.
Bovine Serum Albumin (BSA) Sigma-Aldrich A2153 Used in Table 2.
BpiI (BbsI) Thermo Fisher Scientific ER1011 Used in Table 2.
BsaI (Eco31I) Thermo Fisher Scientific ER0291 Used in Table 2.
Carbenicillin disodium VWR International A1491.0005 Used in 2.1.3.
Corning Costar TC-Treated flat-bottom 24 well plates Sigma-Aldrich CLS3527 Used in 4.1.3.
Dimethyl Sulfoxide (DMSO) Thermo Fisher Scientific BP231-100 Used in 3.6.2.
DNeasy Plant Mini Kit Qiagen 69104 DNA extraction kit. Used in 5.
FLUOstar Omega Microplate reader BMG Labtech - Used in 4.2.2.
GeneJET Plasmid Miniprep Kit Thermo Fisher Scientific K0503 Plasmid purification kit. Used in step 2.3.2.
Glass beads (0.5 mm diameter) BioSpec Products 11079105 Used in 5.2.
Glycerol Thermo Fisher Scientific 10021083 Used in 2.3.1, 3.6.2.
Isopropyl-beta-D-thiogalactopyranoside (IPTG) Thermo Fisher Scientific 10356553 Used in 2.1.3.
Kanamycin sulphate (Gibco) Thermo Fisher Scientific 11815-024 Used in 2.1.3.
Membrane filters (0.45 μm) MF-Millipore HAWP02500 Used in 3.3.7
Microplates, 96-well, flat-bottom (Chimney Well) µCLEAR Greiner Bio-One 655096 Used in 4.2.1.
Monarch DNA Gel Extraction Kit New England Biolabs T1020S Used in 1.1.2.2.
Monarch PCR DNA Cleanup Kit New England Biolabs T1030 DNA purification kit. Used in 1.1.2.3.
Multitron Pro incubator with LEDs Infors HT - Shaking incubator with white LED lights. Used in 4.1.4.
MyTaq DNA Polymerase Bioline BIO-21108 Used in 7.1.
NanoDrop One Thermo Fisher Scientific ND-ONE-W Used in 2.3.3.
One Shot TOP10 chemically competent E. coli Thermo Fisher Scientific C404010 Used in 2.1.1.
Phosphate buffer saline (PBS) solution (10X concentrate) VWR International K813 Used in 4.3.2.
Q5High-Fidelity DNA Polymerase New England Biolabs M0491S Used in 1.1.2.1.
Quick-Load 1 kb DNA Ladder New England Biolabs N0468S Used in Figure 4.
Screw-cap tubes (1.5 ml) Starstedt 72.692.210 Used in 3.6.3
Spectinomycin dihydrochloride pentahydrate VWR International J61820.06 Used in 2.1.3.
Sterilin Clear Microtiter round-bottom 96-well plates Thermo Fisher Scientific 612U96 Used in 4.3.1.
T4 DNA ligase Thermo Fisher Scientific EL0011 Used in Table 2.
TissueLyser II Qiagen 85300 Bead mill. Used in 5.2.

DOWNLOAD MATERIALS LIST

References

  1. Luan, G., Lu, X. Tailoring cyanobacterial cell factory for improved industrial properties. Biotechnology Advances. 36, (2), 430-442 (2018).
  2. Madsen, M. A., Semerdzhiev, S., Amtmann, A., Tonon, T. Engineering mannitol biosynthesis in Escherichia coli and Synechococcus sp. PCC 7002 using a green algal fusion protein. ACS Synthetic Biology. 7, (12), 2833-2840 (2018).
  3. Menin, B., et al. Non-endogenous ketocarotenoid accumulation in engineered Synechocystis sp. PCC 6803. Physiologia Plantarum. 166, (1), 403-412 (2019).
  4. Varman, A. M., Yu, Y., You, L., Tang, Y. J. Photoautotrophic production of D-lactic acid in an engineered cyanobacterium. Microbial Cell Factories. 12, (1), 1-8 (2013).
  5. Vavitsas, K., et al. Responses of Synechocystis sp. PCC 6803 to heterologous biosynthetic pathways. Microbial Cell Factories. 16, 140 (2017).
  6. Yang, G., et al. Photosynthetic production of sunscreen shinorine using an engineered cyanobacterium. ACS Synthetic Biology. 7, (2), 664-671 (2018).
  7. Nielsen, A. Z., et al. Extending the biosynthetic repertoires of cyanobacteria and chloroplasts. Plant Journal. 87, (1), 87-102 (2016).
  8. Nielsen, J., Keasling, J. D. Engineering cellular metabolism. Cell. 164, (6), 1185-1197 (2016).
  9. Stensjö, K., Vavitsas, K., Tyystjärvi, T. Harnessing transcription for bioproduction in cyanobacteria. Physiologia Plantarum. 162, (2), 148-155 (2018).
  10. Santos-Merino, M., Singh, A. K., Ducat, D. C. New applications of synthetic biology tools for cyanobacterial metabolic engineering. Frontiers in Bioengineering and Biotechnology. 7, 1-24 (2019).
  11. Lea-Smith, D. J., Vasudevan, R., Howe, C. J. Generation of marked and markerless mutants in model cyanobacterial species. Journal of Visualized Experiments. 111, e54001 (2016).
  12. Vasudevan, R., et al. CyanoGate: A modular cloning suite for engineering cyanobacteria based on the plant MoClo syntax. Plant Physiology. 180, (1), 39-55 (2019).
  13. Andreou, A. I., Nakayama, N. Mobius assembly: A versatile golden-gate framework towards universal DNA assembly. PLoS ONE. 13, (1), 1-18 (2018).
  14. Crozet, P., et al. Birth of a Photosynthetic Chassis: A MoClo toolkit enabling synthetic biology in the microalga Chlamydomonas reinhardtii. ACS Synthetic Biology. 7, (9), 2074-2086 (2018).
  15. Engler, C., et al. A Golden Gate modular cloning toolbox for plants. ACS Synthetic Biology. 3, (11), 839-843 (2014).
  16. Moore, S. J., et al. EcoFlex: A multifunctional MoClo kit for E. coli synthetic biology. ACS Synthetic Biology. 5, (10), 1059-1069 (2016).
  17. Pollak, B., et al. Loop assembly: a simple and open system for recursive fabrication of DNA circuits. New Phytologist. 222, (1), 628-640 (2019).
  18. Werner, S., Engler, C., Weber, E., Gruetzner, R., Marillonnet, S. Fast track assembly of multigene constructs using golden gate cloning and the MoClo system. Bioengineered Bugs. 3, (1), 38-43 (2012).
  19. Patron, N. J., et al. Standards for plant synthetic biology: a common syntax for exchange of DNA parts. New Phytologist. 208, (1), 13-19 (2015).
  20. Chao, R., Mishra, S., Si, T., Zhao, H. Engineering biological systems using automated biofoundries. Metabolic Engineering. 42, 98-108 (2017).
  21. Chambers, S., Kitney, R., Freemont, P. The Foundry: the DNA synthesis and construction Foundry at Imperial College. Biochemical Society Transactions. 44, (3), 687-688 (2016).
  22. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  23. Rosano, G. L., Ceccarelli, E. A. Rare codon content affects the solubility of recombinant proteins in a codon bias-adjusted Escherichia coli strain. Microbial Cell Factories. 8, 1-9 (2009).
  24. Cambray, G., et al. Measurement and modeling of intrinsic transcription terminators. Nucleic Acids Research. 41, (9), 5139-5148 (2013).
  25. Chen, Y. J., et al. Characterization of 582 natural and synthetic terminators and quantification of their design constraints. Nature Methods. 10, (7), 659-664 (2013).
  26. Münch, R., et al. Virtual Footprint and PRODORIC: An integrative framework for regulon prediction in prokaryotes. Bioinformatics. 21, (22), 4187-4189 (2005).
  27. Salis, H. M., Mirsky, E. A., Voigt, C. A. Automated design of synthetic ribosome binding sites to control protein expression. Nature Biotechnology. 27, (10), 946-950 (2009).
  28. Englund, E., Liang, F., Lindberg, P. Evaluation of promoters and ribosome binding sites for biotechnological applications in the unicellular cyanobacterium Synechocystis sp. PCC 6803. Scientific Reports. 6, 36640 (2016).
  29. Heidorn, T., et al. Synthetic biology in cyanobacteria engineering and analyzing novel functions. Methods in Enzymology. 497, 539-579 (2011).
  30. Thiel, K., et al. Translation efficiency of heterologous proteins is significantly affected by the genetic context of RBS sequences in engineered cyanobacterium Synechocystis sp. PCC 6803. Microbial Cell Factories. 17, 34 (2018).
  31. Liu, Q., Schumacher, J., Wan, X., Lou, C., Wang, B. Orthogonality and burdens of heterologous and gate gene circuits in E. coli. ACS Synthetic Biology. 7, (2), 553-564 (2018).
  32. Ferreira, E. A., et al. Expanding the toolbox for Synechocystis sp. PCC 6803: Validation of replicative vectors and characterization of a novel set of promoters. Synthetic Biology. (August), 1-39 (2018).
  33. Liang, F., Lindblad, P. Synechocystis PCC 6803 overexpressing RuBisCO grow faster with increased photosynthesis. Metabolic Engineering Communications. 4, 29-36 (2017).
  34. Taton, A., et al. Broad-host-range vector system for synthetic biology and biotechnology in cyanobacteria. Nucleic Acids Research. 42, (17), e136 (2014).
  35. Elhai, J., Wolk, C. P. Conjugal transfer of DNA to cyanobacteria. Methods in Enzymology. 167, (1984), 747-754 (1988).
  36. Gormley, E. P., Davies, J. Transfer of plasmid RSF1010 by conjugation from Escherichia coli to Streptomyces lividans and Mycobacterium smegmatis. Journal of Bacteriology. 173, (21), 6705-6708 (1991).
  37. Huang, H. H., Camsund, D., Lindblad, P., Heidorn, T. Design and characterization of molecular tools for a synthetic biology approach towards developing cyanobacterial biotechnology. Nucleic Acids Research. 38, (8), 2577-2593 (2010).
  38. Huang, H. H., Lindblad, P. Wide-dynamic-range promoters engineered for cyanobacteria. Journal of Biological Engineering. 7, 10 (2013).
  39. Li, S., Sun, T., Xu, C., Chen, L., Zhang, W. Development and optimization of genetic toolboxes for a fast-growing cyanobacterium Synechococcus elongatus UTEX 2973. Metabolic Engineering. 48, 163-174 (2018).
  40. Pansegrau, W., Balzer, D., Kruft, V., Lurz, R., Lanka, E. In vitro assembly of relaxosomes at the transfer origin of plasmid RP4. Proceedings of the National Academy of Sciences, USA. 87, (17), 6555-6559 (1990).
  41. Song, K., Tan, X., Liang, Y., Lu, X. The potential of Synechococcus elongatus UTEX 2973 for sugar feedstock production. Applied Microbiology and Biotechnology. 100, (18), 7865-7875 (2016).
  42. Waters, V. L., Guiney, D. G. Processes at the nick region link conjugation, T-DNA transfer and rolling circle replication. Molecular Microbiology. 9, (6), 1123-1130 (1993).
  43. Elhai, J., Vepritskiy, A., Muro-Pastor, A. M., Flores, E., Wolk, C. P. Reduction of conjugal transfer efficiency by three restriction activities of Anabaena sp. strain PCC 7120. Journal of Bacteriology. 179, (6), 1998-2005 (1997).
  44. Silva-Rocha, R., et al. The Standard European Vector Architecture (SEVA): A coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research. 41, (D1), D666-D675 (2013).
  45. Mandakovic, D., et al. CyDiv, a conserved and novel filamentous cyanobacterial cell division protein involved in septum localization. Frontiers in Microbiology. 7, (FEB), 1-11 (2016).
  46. Masukawa, H., Inoue, K., Sakurai, H., Wolk, C. P., Hausinger, R. P. Site-directed mutagenesis of the Anabaena sp. strain PCC 7120 nitrogenase active site to increase photobiological hydrogen production. Applied and Environmental Microbiology. 76, (20), 6741-6750 (2010).
  47. Yu, J., et al. Synechococcus elongatus UTEX 2973, a fast growing cyanobacterial chassis for biosynthesis using light and CO2. Scientific Reports. 5, (1), 8132 (2015).
  48. Ungerer, J., Wendt, K. E., Hendry, J. I., Maranas, C. D., Pakrasi, H. B. Comparative genomics reveals the molecular determinants of rapid growth of the cyanobacterium Synechococcus elongatus UTEX 2973. Proceedings of the National Academy of Sciences, USA. 115, (50), E11761-E11770 (2018).
  49. Lepesteur, M., Martin, J. M., Fleury, A. A comparative study of different preservation methods for phytoplankton cell analysis by flow cytometry. Marine Ecology Progress Series. 93, (1-2), 55-63 (1993).
  50. Day, J. G. Cryopreservation of cyanobacteria. Cyanobacteria: An Economic perspective. Wiley Blackwell. New York. 319-327 (2014).
  51. Zhou, J., et al. Discovery of a super-strong promoter enables efficient production of heterologous proteins in cyanobacteria. Scientific Reports. 4, 4500 (2014).
  52. Potapov, V., et al. Comprehensive profiling of four base overhang ligation fidelity by T4 DNA ligase and application to DNA assembly. ACS Synthetic Biology. 7, (11), 2665-2674 (2018).
  53. Ravindran, C. R. M., Suguna, S., Shanmugasundaram, S. Electroporation as a tool to transfer the plasmid pRL489 in Oscillatoria MKU 277. Journal of Microbiological Methods. 66, 174-176 (2006).
  54. Stevenson, K., McVey, A. F., Clark, I. B. N., Swain, P. S., Pilizota, T. General calibration of microbial growth in microplate readers. Scientific Reports. 6, 38828 (2016).
  55. Maecker, H. T., Trotter, J. Flow cytometry controls, instrument setup, and the determination of positivity. Cytometry Part A. 69, (9), 1037-1042 (2006).
Genetisk modifisering av cyanobakterier av Bøyning bruke CyanoGate Modular kloning Toolkit
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Gale, G. A. R., Schiavon Osorio, A. A., Puzorjov, A., Wang, B., McCormick, A. J. Genetic Modification of Cyanobacteria by Conjugation Using the CyanoGate Modular Cloning Toolkit. J. Vis. Exp. (152), e60451, doi:10.3791/60451 (2019).More

Gale, G. A. R., Schiavon Osorio, A. A., Puzorjov, A., Wang, B., McCormick, A. J. Genetic Modification of Cyanobacteria by Conjugation Using the CyanoGate Modular Cloning Toolkit. J. Vis. Exp. (152), e60451, doi:10.3791/60451 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter