Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Modificação genética de cianobactérias por conjugação usando o kit de ferramentas de clonagem modular CyanoGate

doi: 10.3791/60451 Published: October 31, 2019
* These authors contributed equally

Summary

Aqui, apresentamos um protocolo descrevendo como i) montar um vetor auto-replicante usando o kit de ferramentas de clonagem modular CyanoGate, ii) introduzir o vetor em um hospedeiro cianobacteriano por conjugação, e iii) caracterizar cepas transgênicas de cianobactérias usando um leitor de placa ou citometria de fluxo.

Abstract

Cianobactérias são um grupo diversificado de organismos fotosintéticos procarióticos que podem ser geneticamente modificados para a produção renovável de commodities industriais úteis. Os avanços recentes na biologia sintética conduziram ao desenvolvimento de diversos toolkits da clonagem tais como CyanoGate, um sistema modular estandardizado da clonagem para construir vectors plasmid para a transformação subseqüente ou transferência conjugal em cianobacteria. Aqui descrevemos um método detalhado para a montagem de um vetor auto-replicante (por exemplo, carregando uma fita de expressão marcador fluorescente) e transferência conjugal do vetor para as cepas cianobacterianas Synechocystis sp. PCC 6803 ou Synechococcus Elongatus UTEX 2973. Além disso, descrevemos como caracterizar o desempenho de uma parte genética (por exemplo, um promotor) usando um leitor de placa ou citometria de fluxo.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Cianobactérias são bactérias autotróficas que podem ser usadas para a biossíntese de uma grande variedade de produtos metabólicos naturais e heterologous de alto valor1,2,3,4,5, 6. Vários obstáculos ainda precisam ser superados para expandir sua viabilidade comercial, mais notavelmente, os rendimentos relativamente pobres em comparação com as bioplataformas heterotróficas (por exemplo, Escherichia coli e levedura)7. A recente expansão das ferramentas de engenharia genética disponíveis e a adoção do paradigma da biologia sintética na pesquisa cianobacteriana estão ajudando a superar tais desafios e desenvolver ainda mais as cianobactérias como biofábricas eficientes8, 9,10.

As principais abordagens para a introdução do DNA em cianobactérias são transformação, conjugação e eletroporação. Os vetores transferidos para cianobactérias por transformação ou eletroporação são vetores "suicidas" (ou seja, vetores integrativos que facilitam a recombinação homóloga), enquanto vetores auto-replicantes podem ser transferidos para cianobactérias por transformação, conjugação ou eletroporação. Para o primeiro, um protocolo está disponível para a engenharia de espécies modelo passível de transformação natural11. Mais recentemente, um kit de ferramentas modular de clonagem (MoClo) para cianobactérias chamado CyanoGate foi desenvolvido que emprega um método padronizado de montagem de vetores Golden Gate para engenharia usando transformação natural, eletroporação ou conjugação12.

Golden Gate-tipo técnicas de montagem tornaram-se cada vez mais popular nos últimos anos, e os padrões de montagem e bibliotecas parte estão agora disponíveis para uma variedade de organismos13,14,15,16 17depessoas. Golden Gate usa enzimas de restrição iis tipo (por exemplo, BsaI, BpiI, BsmBI, BtgZI e AarI) e um terno de aceitadores e saliências únicas para facilitar a montagem hierárquica direcional de várias seqüências em uma reação de montagem de "um pote". Enzimas de restrição tipo IIS reconhecem uma seqüência assimétrica única e reduzem uma distância definida de seus locais de reconhecimento para gerar um corte escalonado de "extremidade pegajosa" (tipicamente uma saliência de 4 nucleotídeos [NT]), que pode ser posteriormente explorada para dirigir o DNA ordenado reações de montagem15,18. Isso facilitou o desenvolvimento de grandes bibliotecas de peças modulares de nível 0 (por exemplo, promotores, quadros de leitura aberta e exterminadores) definidos por uma sintaxe comum, como o padrão PhytoBricks19. As peças de nível 0 podem então ser prontamente montadas em de expressão de nível 1, seguindo as quais conjuntos de ordem superior mais complexos (por exemplo, construções de expressão multigênica) podem ser construídos em um vetor de aceitação de escolha12,15. Uma vantagem fundamental das técnicas de montagem do tipo Golden Gate é a sua comodidade à automação em instalações de alta produção, como fundições de DNA20,21,que podem permitir o teste de projetos experimentais complexos que não pode ser facilmente alcançado por trabalho manual.

CyanoGate baseia-se no sistema moclo planta estabelecido12,15. Para incorporar uma nova parte no CyanoGate, a sequência de parte deve primeiro ser domesticada, ou seja, sites de reconhecimento "ilegais" para BsaI e BpiI devem ser removidos. No caso de uma codificação de parte para um quadro de leitura aberta (ou seja, uma sequência de codificação, CDS), os sites de reconhecimento podem ser interrompidos gerando mutações sinônimos na sequência (ou seja, alterando um códon para uma alternativa que codifica para o mesmo resíduo de aminoácidos). Isso pode ser alcançado por uma variedade de abordagens, que vão desde a síntese de DNA até estratégias baseadas em amplificação de amplificação de polimerase (PCR), como a montagemGibson 22. Dependendo da expressão do hospedeiro que está sendo usada, o cuidado deve ser tomado para evitar a introdução de códons raros que poderiam inibir a eficiência da tradução23. Remover sites de reconhecimento em sequências de promotores e exterminadores é tipicamente um esforço mais arriscado, pois as modificações podem afetar a função e a parte pode não funcionar como esperado. Por exemplo, as alterações aos locais de ligação ao fator de transcrição putativa ou ao site de ligação ribossoma dentro de um promotor podem alterar a força e a capacidade de resposta à indução/repressão. Da mesma forma, as modificações nas principais características estruturais do exterminador do futuro (por exemplo, o caule rico gc, loop e cauda poli-U) podem alterar a eficiência da terminação e afetar a expressão gênica24,25. Embora vários recursos on-line estejam disponíveis para prever a atividade das sequências de promotores e exterminadores, e informem se uma mutação proposta afetará o desempenho26,27,essas ferramentas são muitas vezes preditores pobres de desempenho em cianobactérias28,29,30.. . Como tal, a caracterização in vivo de peças modificadas ainda é recomendada para confirmar a atividade. Para ajudar com a clonagem de seqüências recalcitrantes, CyanoGate inclui uma cópia baixa de clonagem vetor convidado com base no vetor BioBrick pSB4K512,16,31. Além disso, um portal "Design and Build" está disponível através da Fundição do Genoma de Edimburgo para ajudar com o design vetorial (dab.genomefoundry.org). Por último, e mais importante, CyanoGate inclui dois projetos de vetor de aceitação nível T (equivalente a vetores de aceitadores de nível 2)15 para a introdução de DNA em cianobactérias usando vetores de suicídio, ou vetores de alcance de hospedeiro amplo capaz de auto-replicação em várias espécies cianobacterianas32,33,34.

Aqui vamos nos concentrar em descrever um protocolo para a geração de níveis T auto-replicantes vetores e a modificação genética de Synechocystis PCC 6803 e Synechococcus elongatus utex 2973 (Synechocystis PCC 6803 e S. elongatus UTEX 2973 depois disso) por conjugação (também conhecido como acasalamento triparental). A transferência conjugal de DNA entre células bacterianas é um processo bem descrito e tem sido usado anteriormente para a engenharia de espécies cianobacterianas, em particular aquelas que não são naturalmente competentes, como s. alongatus UTEX 297335, 36,37,38,39,40,41. Em resumo, as culturas cianobacterianas são incubadas com uma cepa De. coli carregando o vetor a ser transferido (o vetor de "carga") e vetores (seja na mesma cepa de E. coli ou em cepas adicionais) para permitir a conjugação ("mobilizador" e vetores de "ajudantes"). Quatro condições-chave são necessárias para a transferência conjugal ocorrer: 1) o contato direto entre as células envolvidas na transferência de DNA, 2) o vetor de carga deve ser compatível com o sistema de conjugação (ou seja, deve conter uma origem adequada de transferência (oriT), também conhecido como um bom (base de mobilidade) site), 3) uma proteína de corte de DNA (por exemplo, codificada pelo gene da máfia) que corta DNA no oriT para iniciar a transferência de dna para o cianobacterium deve estar presente e expressa de ambos os vetores de carga ou ajudante, e 4) o DNA transferido não deve ser destruído no receptor cyanobacterium (ou seja, deve ser resistente à degradação por, por exemplo, restrição atividade endosnuclease)35,42. Para que o vetor de carga persista, a origem da replicação deve ser compatível com a ciaanobacterium receptora para permitir a auto-replicação e proliferação em células filhas pós divisão. Para ajudar com as condições 3 e 4, vários vetores auxiliares estão disponíveis através de Addgene e outras fontes comerciais que codificam para a máfia, bem como várias metilases para proteger de endonucleases nativas no host cyanobacterium43. Neste protocolo, a conjugação foi facilitada por uma cepa MC1061 E. coli carregando mobilizadores e vetores auxiliares pRK24 (www.addgeneorg/51950) e pRL528 (www.addgene.org/58495), respectivamente. Deve ser tomado cuidado ao escolher os vetores para serem usados para transferência conjugal. Por exemplo, no kit CyanoGate o vetor de carga auto-replicante pPMQAK1-T codifica uma proteína Mob12. No entanto, pSEVA421-T não44,e, como tal, mob deve ser expressa a partir de um vetor ajudante adequado. Os vetores utilizados também devem ser apropriados para o organismo alvo. Por exemplo, a transferência conjugal eficiente em Anabaena sp. PCC 7120 requer um vetor auxiliar que proteja o vetor de mobilização contra a digestão (por exemplo, pRL623, que codifica as três metilases AvaiM, Eco47iiM e Ecot22iM)45, 46.

Neste protocolo, descrevemos ainda mais como caracterizar o desempenho das peças (ou seja, promotores) com um marcador fluorescente usando um leitor de placa ou um citometro de fluxo. Os citometros de fluxo são capazes de medir a fluorescência em uma única base celular para uma grande população. Além disso, os citometros de fluxo permitem aos usuários "portar" os dados adquiridos e remover o ruído de fundo (por exemplo, de material particulado na cultura ou contaminação). Em contraste, os leitores de placas adquirem uma medida agregada de fluorescência de um determinado volume de cultura, normalmente em vários poços de replicar. As principais vantagens dos leitores de placas sobre os citometros incluem o menor custo, maior disponibilidade e, normalmente, nenhum requisito para software especializado para análises de dados a jusante. As principais desvantagens dos leitores de placas são a sensibilidade relativamente menor em comparação com citometros e problemas potenciais com a densidade óptica de culturas medidas. Para análises comparativas, as amostras do leitor de placas devem ser normalizadas para cada poço (por exemplo, para uma medição da densidade cultural, normalmente tomada como a absorção na densidade óptica em 750 nm [OD750]),o que pode levar a imprecisões para amostras que são também denso e/ou não bem misturado (por exemplo, quando propenso à agregação ou flocculação).

Como uma visão geral, aqui demonstramos em detalhes os princípios de geração de peças de nível 0, seguido s uma montagem hierárquica usando o kit CyanoGate e clonagem em um vetor adequado para transferência conjugal. Em seguida, demonstramos o processo de transferência conjugal, a seleção de cepas transconjugantes axenic expressando um marcador fluorescente e a subsequente aquisição de dados de fluorescência usando um citometro de fluxo ou um leitor de placa.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Montagem vetorial usando os kits de ferramentas Plant MoClo e CyanoGate

NOTA: Antes de prosseguir com a montagem vetorial, recomenda-se fortemente que os usuários se familiarizem com as estruturas de nível vetorial dos sistemas Plant e CyanoGate MoClo12,15.

  1. Construção de peças de nível 0
    NOTA: As peças de nível 0 podem ser sintetizadas como vetores completos ou como sequências lineares para montagem com aceitadores de nível 0 (por exemplo, gBlocks, IDT). Alternativamente, as sequências podem ser amplificadas a partir de um modelo de origem (por exemplo, um vetor ou DNA genômico purificado). Aqui, como gerar uma nova parte de Nível 0 a partir de um produto amplificado é descrito. Uma visão geral do processo de montagem do Golden Gate do Nível 0 ao Nível T é mostradaFigura 1.
    1. Projete as cartilha.
      1. Decida qual módulo de nível 0 para montar e identificar os 5' e 3' saliências apropriados (Tabela 1)12,15. Verifique a sequência de DNA para clonar para a presença de sites de restrição BpiI ou BsaI.
        NOTA: Uma sequência contendo um desses sites deve ser domesticada modificando um ou mais NTs na sequência do site de restrição. Uma estratégia para fazer isso usando a montagem golden gate é delineada na Figura 2.
      2. Para amplificar uma seqüência de DNA, projete um par de primer adequado para a frente e para trás. Para a cartilha para a frente, selecione 18-30 bp complementar ao final 5′ da seqüência de modelo de DNA. Para a cartilha reversa, selecione 18-30 bp reverso complementar ao final de 3′ da seqüência de modelo de DNA.
        NOTA: Primers com temperaturas de rerrocada (Tm)de 58-62 °C normalmente dão os resultados de amplificação mais consistentes(Figura 1A).
      3. Adicione o seguinte ao final 5 ′ da cartilha para a frente: 1) uma seqüência aleatória de 4-6 NTs no final 5 ′ do site BpiI, 2) o site de restrição BpiI (GAAGAC), 3) dois NTs aleatórios, e 4) o excesso 5 ′ selecionados na etapa 1.1.1.1. Adicione o seguinte ao final 5′ da cartilha reversa: 1) uma seqüência aleatória de 4-6 NTs no final 5′ do site BpiI, 2) o site de restrição BpiI (GAAGAC), 3) dois NTs aleatórios, e 4) o excesso de 3′ selecionado na etapa 1.1.1.1.1. Quando finalizado, peça os pares primer.
        NOTA: Veja a Figura 1A para um exemplo de um par primer para a frente e reversa.
    2. Amplificar uma sequência de DNA do DNA genômico.
      1. Extraia DNA genômico como descrito na seção 5. Amplifique os produtos por PCR usando uma polimererase de DNA de alta fidelidade(Tabela de Materiais).
        NOTA: Como exemplo, configure reações de PCR (20 a 50 μL) de acordo com as instruções do fabricante. Use ~ 100 ng de DNA genômico por reação. Use um programa de ciclismo térmico composto por uma etapa inicial de desnaturação de 98 °C para 30 s, seguido por não mais de 25 ciclos de desnaturação a 98 °C para 10 s, primer annealing em 58 °C para 15 s e extensão de produto em 72 °C para 30 s (modificar o último, dependendo do tamanho do produto/tipo de polimererase de DNA utilizado), seguido por uma etapa de extensão final de 72 °C para 2 min.
      2. Se o produto PCR deve ser purificado em gel, execute toda a reação do PCR em um gel agarose, conforme descrito na seção 6. Corte a faixa de interesse fora do gel agarose e purifique-o usando um kit de extração de gel(Mesa de Materiais).
      3. Alternativa ao passo 1.1.2.2, se o produto PCR deve ser usado sem purificação de gel, verifique o tamanho da banda executando um alibamento da amostra de reação pcr (~5 μL) em um gel de agarose. Se o gel mostra apenas a banda apropriada e nenhuma evidência de dimers primer, purificar o produto PCR usando um kit de purificação de DNA(Tabela de Materiais).
      4. DNA purificado de elute em um pequeno volume de água desionizada (por exemplo, 10 μL) para obter uma alta concentração de DNA (>20 ng/μL é tipicamente suficiente).
    3. Monte o produto de DNA amplificado (ou produtos, consultea Figura 2 ) no Nível 0. Prepare uma mistura de reação de 20 μL com bpii (figura 1B)e configure o programa de cicloter térmico, conforme descrito na Tabela 2. Proceda à transformação de E. coli usando 5 μL da mistura montada da reação do nível 0 (como descrito na seção 2).
  2. Construção de montagens de nível 1
    1. Decida quais peças de nível 0 para montar(Figura 1C e Tabela 1). Escolha um vetor de aceitação de nível 1 apropriado15.
      NOTA: Nesta fase, é importante saber qual será o design vetorial final no Nível T, pois isso afetará a escolha do vetor de aceitação de nível 1. Nível 1 posição 1 (Forward) vetor de aceitação (pICH47732) pode ser usado como padrão se o objetivo é ter uma única montagem de nível 1 (por exemplo, uma fita de expressão gênica) no Nível T. No entanto, para que duas ou mais montagens de nível 1 sejam montadas no Nível T, a posição e a direção de cada montagem de nível 1 devem ser consideradas. Até sete montagens de nível 1 podem ser montadas em um vetor de aceitação de nível T usando vetores de aceitadores de nível 1 com posições apropriadas12.
    2. Monte as peças de nível 0 no Nível 1. Prepare uma mistura de reação de 20 μL com bsai e configurar o programa de ciclor térmico, como descrito na tabela 2. Proceda à transformação de E. coli usando 5 μL da mistura montada da reação do nível 1 (como descrito na seção 2).
  3. Construção de montagens de nível T
    1. Decida quais montagens de nível 1 para montar(Figura 1D). Escolha um vetor de aceitação de nível T apropriado.
      NOTA: pUC19A-T (resistência à ampicilina) e pUC19S-T (resistência à espectromicina) são vetores integrativos de alto número de cópia que não são capazes de replicar em cianobactérias e são usados principalmente para integração genômica (ou seja, knock-in ou knock-out de genes) via recombinação homóloga12. A entrega de vetores integrativos pode prosseguir por transformação natural em espécies cianobacterianas passíveis11. pPMQAK1-T é uma ampla gama de hospedeiros, vetor replicativo que é entregue por transferência conjugal (seção 3).
    2. Escolha um Link Final apropriado para ligar o final de 3′ da montagem final do Nível 1 à espinha dorsal nível T15.
      NOTA: O Link Final necessário é o mesmo número que a posição da parte final. Por exemplo, um vetor de nível T com apenas uma parte de nível 1 de posição 1 (para a frente ou para trás) exigirá end-Link 1 (pICH50872) para ligação na espinha dorsal do Nível T.
    3. Monte uma ou mais montagens de nível 1 no Nível T. Prepare uma mistura de reação com o BpiI e o vetor de End-Link necessário e configure o programa de cicloter térmico, conforme descrito na Tabela 2. Proceda à transformação de E. coli usando 5 μL da mistura montada da reação do nível T (como descrito na seção 2).

2. E. coli transformação e purificação vetorial

  1. E. coli transformação (dia 1)
    1. Defrost um alibado (~25 μL) de células quimicamente competentes de E. coli (Tabela de Materiais)e delicadamente pipeta em um tubo de 1,5 mL no gelo. Adicione 5 μL da mistura de montagem (Nível 0, 1 ou T) e incubar o tubo no gelo por mais 30-60 min.
    2. Células de choque térmico, incubando o tubo em um banho de água a 42 °C para 30 s, em seguida, coloque o tubo de volta no gelo por 2 min. Adicione a temperatura ambiente (RT) super caldo ideal com repressão catabolite (S.O.C.) médio (250 μL) para o tubo. Incubar o tubo a 37 °C por 1 h a 225 rpm em uma incubadora tremendo.
    3. Placa 40 μL da cultura em uma placa de ágar LB contendo a concentração final apropriada de antibióticos (100 μg/mL para glidrirato de espectroclorde de espectrocloride de fetilina pentahidrato [Nível 0], 100 μg/mL de dissódio de carbenicina [Nível 1], ou 50 μg/mL de sulfato de kanamicina [ Nível T]), 1 mM isopropyl-beta-D-thiogalactopyranoside (IPTG) e 40 μg/mL de 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal) para triagem azul-branco. Incubar a placa durante a noite a 37 °C.
      NOTA: A quantidade de cultura banhada pode ser variada dependendo da eficiência das células competentes de E. coli e da reação de ligadura. Placa de um volume maior se <10 colônias são observadas após a incubação durante a noite.
  2. Seleção de colônias brancas e preparação de culturas líquidas (dia 2)
    NOTA: Dependendo da eficiência da reação de montagem e da transformação subsequente, as placas de ágar LB podem não conter colônias, colônias azuis ou colônias brancas (Figura 3). Colônias azuis são indicativos de vetores aceitadores que não tenham sido submetidos a restrição (ou seja, uma cópia funcional do lacZ ainda está presente). Colônias brancas indicam que o de expressão lacZ foi perdido e substituído por uma peça/montagem.
    1. Opcionalmente, validar que as colônias brancas contêm o vetor esperado, realizando PCR como descrito na seção 7.
    2. Escolha colônias brancas únicas (ou colônias verificadas pcr) com uma ponta de 10 μL e transfira para um tubo de centrífuga de 15 mL contendo lb médio (5 mL) e concentrações de antibióticos apropriadas (passo 2.1.3). Incubar os tubos a 37 °C durante a noite às 225 rpm em uma incubadora tremendo.
  3. Purificação do vetor de Plasmid (dia 3)
    1. Opcionalmente, prepare um estoque de glicerol da cultura E. coli durante a noite para crioarmazenamento a longo prazo de vetores. Adicione 500 μL de cultura bacteriana a 500 μL de 50% (v/v) glicerol em um tubo apropriado de 1,5 a 2,0 mL para crioarmazenamento a -80 °C. Misture suavemente, invertendo 5-10x. Amostras de congelamento flash em nitrogênio líquido e armazenar em um freezer -80 °C.
    2. Despine culturas em 15 tubos de centrífuga mL a 3.000 x g por 5 a 10 min. Descarte o supernatant sem perturbar a pelota celular. Purificar o vetor usando um kit de purificação plasmídeo(Mesa de Materiais). Vetor purificado elute em 35 μL de água desionizada.
      NOTA: Use volumes mais baixos de elução para aumentar ainda mais a concentração de vetores. O mesmo eluente pode ser colocado através de uma coluna de purificação duas vezes para o aumento dos rendimentos.
    3. Medir a concentração do vetor no eluent usando um espectrômetro(Tabela de Materiais).
      NOTA: Vetores de alto número de cópia em E. coli, como pUC19, normalmente dão rendimentos de 50 a 300 ng/μL. Vetores de baixo número de cópia, como pPMQAK1-T, normalmente dão rendimentos de 15 a 60 ng/μL.
  4. Validação de vetor
    NOTA: Os vetores podem ser verificados por digestão de restrição (passo 2.4.1) e/ou sequenciamento (passo 2.4.2).
    1. Restringir 0,5-1 μg de vetor com uma enzima de restrição adequada (s) e verificar os tamanhos esperados da banda, conforme descrito na seção 6 (Figura 4).
      NOTA: Os tamanhos incorretos da faixa indicam tipicamente o conjunto errôneo, caso em que mais colônias brancas podem ser selecionadas ou o conjunto pode ser repetido. BsaI e BpiI podem ser usados para validar o tamanho correto da inserção para as montagens de nível 0 e nível 1, respectivamente. BsaI ou BpiI podem ser usados em conjunto com uma enzima de restrição adicional e compatível que corta dentro da inserção e/ou a espinha dorsal vetorial para produzir um conjunto distinto de bandas bem separadas após a digestão.
    2. Sequenciar o vetor por sequenciamento sanger usando uma cartilha apropriada a montante da região montada usando instalação de sequenciamento comercial(Tabela 3).
      NOTA: Todas as novas peças de Nível 0 devem ser sequenciadas para confirmar a identidade de sequência esperada. A validação de sequênciade de vetores de nível 1 e T normalmente não é necessária se montada a partir de peças de nível 0 previamente sequenciadas.

3. Geração de mutantes por conjugação

NOTA: Aqui, um protocolo para a transferência conjugal de um vetor de carga auto-replicante em Synechocystis PCC 6803 ou S. elongatus UTEX 297311,47 é descrito. Este protocolo é aplicável a outras espécies modelo (por exemplo, S. elongatus PCC 7942 e Synechococcus sp. PCC 7002). Todo o trabalho com cianobactérias (e preparações associadas do amortecedor) deve ser feito circunstâncias estéreis em uma capa de fluxo laminar.

  1. Crescimento da cultura cianobacteriana (dia 1)
    1. Prepare bg11 médio de acordo com Lea-Smith et al.11, e placas ágar com LB-BG11 e BG11+Kan50 (seção 8).
    2. Crie uma nova cultura de Synechocystis PCC 6803 ou S. elongatus UTEX 2973 inoculando um frasco cônico de 100 mL de bg11 médio fresco (50 mL) com células provenientes de uma placa de agar BG11 axenic. Crescer synechocystis PCC 6803 culturas a 30 °C, 100 μmol fótons m-2s-1 a 100 rpm e crescer S. elongatus UTEX 2973 em 40 °C, 300 μmol fótons m-2s-1 às 100 rpm. Crescer culturas até OD750 = 0,5-1,5 (normalmente 1-2 dias).
      NOTA: S. alongatus UTEX 2973 culturas podem ser cultivadas a 40 °C em altas intensidades de luz (por exemplo, 2000 μmol fótons m-2s-1)48.
  2. Crescimento de cepas de ajuda e carga E. coli (dia 2)
    1. Inoculate LB médio contendo ampicilina (concentração final 100 μg/mL) e chloramphenicol (concentração final 25 μg/mL) com uma cepa MC1061 E. coli contendo vetores pRK24 e pRL528 (ou seja, a cepa de ajudante) e crescer a 37 °C durante a noite às 225 rpm em uma incubadora tremendo. Crescer um volume suficiente de cultura de tensão ajudante, assumindo 1 mL de cultura é necessária por conjugação.
    2. Inocular lb médio (5 mL) contendo antibióticos adequados com a cultura E. coli carregando o vetor de carga (ou seja, um vetor de nível T). Crescer a cultura a 37 °C durante a noite em 225 rpm em uma incubadora tremendo.
  3. Transferência conjugal (acasalamento triparental) (dia 3)
    1. Prepare o ajudante e as tensões da carga de E. coli. Centrífuga o ajudante e a carga E. coli culturas durante a noite em 3.000 x g para 10 min à temperatura ambiente. Descarte o supernatant sem perturbar a pelota celular.
    2. Lave a pelota, adicionando fresco LB médio sem antibióticos. Use o mesmo volume que a cultura inicial. Resuspenda a pelota, suavemente tubulação para cima e para baixo. Não vórtice a cultura. Repita este passo 3x para remover antibióticos residuais da cultura durante a noite.
    3. Centrífuga a cultura resuspendida (como na etapa 3.3.1), descartar o supernatant e resuspender pela metade o volume de LB médio do volume de cultura inicial (por exemplo, 2,5 mL se a cultura durante a noite foi de 5 mL). Combine 450 μL da cepa auxiliar com 450 μL da cepa de carga em um tubo de 2 mL e reserve (sair em RT) até o passo 3.3.6.
    4. Prepare a cultura cianobacteriana. Para cada reação de conjugação, use 1 mL de cultura cianobacteriana (OD750 = 0,5 a 1,5).
    5. Centrífuga o volume total exigido da cultura cianobacteriana em 1.500 x g por 10 min em RT, em seguida, descartar o supernatant cuidadosamente sem perturbar a pelota celular. Lave a pelota adicionando fresco BG11 médio do mesmo volume inicial. Resuspenda a pelota, atubulaçndo suavemente para cima e para baixo, não vórtice a cultura. Repita este passo 3x e definir a cultura lavada de lado.
    6. Adicione um alibamento da cultura cianobacteriana lavada (900 μL) às cepas combinadas de E. coli (ajudante e carga) (900 μL) em um tubo de 2 mL. Misture as culturas suavemente tubulação para cima e para baixo. Não vórtice. Incubar a mistura em RT por 30 min para Synechocystis PCC 6803 ou 2 h para S. elongatus UTEX 2973.
    7. Centrífuga a mistura em 1.500 x g por 10 min em RT. Remover 1,6 mL do supernatant. Resuspenda a pelota no restante ~200 μL de supernatant. Coloque um filtro de membrana de 0,45 μm em uma placa de ágar LB-BG11 sem antibióticos (seção 8). Espalhe cuidadosamente 200 μL da mistura de cultura E.coli/cyanobacteriana na membrana com um propagador estéril ou uma ponta dobrada estéril e selar a placa com filme de parafina.
    8. Incubar a placa LB-BG11 com a membrana por 24 h. Manter as membranas com culturas Synechocystis PCC 6803 a 30 °C, 100 fótons μmol m-2s-1. Manter as membranas com culturas S. alongatus UTEX 2973 a 40 °C em 150 fótons μmol m-2s-1.
  4. Transferência de membrana
    1. Após 24 h, transfira cuidadosamente a membrana usando fórceps esterilizados por chama para uma placa de ágar BG11 fresca contendo antibióticos apropriados (seção 8) para selecionar para o vetor de carga. Selar a placa com filme de parafina.
    2. Incubar a placa de ágar BG11 condições de crescimento adequadas, como descrito acima para Synechocystis PCC 6803 ou S. elongatus UTEX 2973, até que as colônias apareçam.
      NOTA: Colônias geralmente aparecem após 7 a 14 dias para Synechocystis PCC 6803 e 3-7 dias para S. elongatus UTEX 2973.
  5. Seleção de conjugantes
    NOTA: Apenas colônias cianobacterianas que transportam o vetor de carga poderão crescer na membrana(Figura 5).
    1. Usando um laço estéril do calor, selecione pelo menos duas colônias individuais da membrana e raia em uma placa nova da ágar BG11 que contem antibióticos apropriados (figura 5C).
      NOTA: Colônias recém-listradas ainda podem estar contaminadas com E. coli transportada de conjugação (ou seja, se pequenas colônias brancas são evidentes na placa), então duas ou três rodadas adicionais de re-estrias em placas de ágar BG11 frescos normalmente são necessário para obter uma cultura canobacteriana axenic.
    2. Confirme a ausência de contaminação por E. coli inoculando uma sequência de cultura cianobacteriana em um tubo de centrífuga de 15 mL contendo 5 mL de lb médio e incubação em 37 °C durante a noite em 225 rpm em uma incubadora tremendo. Após um período de crescimento suficiente (~7 dias), escolha colônias axenic individuais para setup culturas líquidas para o criostorage a longo prazo ou a experimentação subseqüente.
  6. Crioarmazenamento de cepas cianobacterianas
    1. Crescer uma cultura líquida cianobacteriana em BG11 (como descrito na seção 3.1) até OD750 = 1,5-3,0. Centrífuga 10 mL de cultura por 10 min a 1.500 x g, remover o supernatant e resuspender as células em 5 mL de fresco BG11 médio.
    2. Adicione 3,5 mL de autoclave esterilizado 50% (v/v) glicerol para uma concentração final de glicerol de ~ 20% (v/v)49. Esta abordagem funciona bem para synechocystis PCC 6803. Alternativamente, adicione 5 mL de filtro esterilizado BG11 contendo 16% (v/v) dimetil sulfoxide (DMSO) para uma concentração final dmso de ~ 8% (v/ v)50. Esta abordagem é recomendada para a maioria das cepas, incluindo S. elongatus UTEX 2973.
      CUIDADO: O DMSO é tóxico e deve ser tratado com proteção adequada.
    3. Misture suavemente, invertendo 5-10x. Subaliquot ~1 mL de cultura em tubos separados de crioarmazenamento compatível com 1,5 mL de parafuso -tampão (Tabela de Materiais). Coloque tubos em um freezer de -80 °C para crioarmazenamento. Não flash congelar em nitrogênio líquido.
      NOTA: Pelo menos três estoques por cepa são recomendados.
    4. Para a recuperação, retire um tubo do congelador -80 °C e descongele a cultura em um banho de água de 35 °C enquanto mistura suavemente. Adicione a cultura descongelada a 50 mL de bg11 fresco médio e crescer como uma cultura líquida (como descrito na seção 3.1).
      NOTA: Alternativamente, a cultura pode ser listrada e crescida em uma placa fresca da ágar BG11. Culturas transgênicas carregando marcadores de seleção devem ser revividas inicialmente em placas de ágar BG11 sem antibióticos e, em seguida, restreaked em placas de ágar BG11 com antibióticos apropriados.

4. Caracterização promotor

NOTA: Aqui uma abordagem padrão é descrita para analisar a força de uma parte promotor, medindo os níveis de expressão de um marcador fluorescente (eYFP) após um período de crescimento de 72 h usando um leitor de placa ou um citometro de fluxo12.

  1. Crescimento da cultura
    1. Configure culturas de sementes inoculando 10 mL de BG11 médio contendo antibióticos apropriados com uma única colônia da cepa cianobacteriana transgênica carregando o de expressão marcador fluorescente. Prepare também culturas da semente para tensões negativas apropriadas do controle (por exemplo, uma tensão selvagem do tipo e/ou uma tensão transgénica que carreg a mesma espinha dorsal do vetor mas faltando o fluorescente da expressão do marcador).
      NOTA: Pelo menos quatro réplicas biológicas são recomendadas.
    2. Crescer as culturas de sementes por 48 h ou até OD750 = 1-1,5 em condições de crescimento adequadas para a cepa da espécie.
    3. Para acompanhar a expressão do promotor ao longo do tempo, primeiro medir o OD750 de cada cultura de sementes. Calcule os requisitos de diluição para levar cada cultura a um OD inicial750 = 0,2. Configure amostras de cultura experimental diluídas (2 mL de volume total) em uma placa de 24 poços de fundo plano(Tabela de Materiais).
    4. Incubar a placa em uma incubadora de agitação com luzes BRANCAS DO LED(tabela dos materiais)condições apropriadas do crescimento. Medir a densidade de crescimento da cultura (OD750)e maior fluorescência de proteína fluorescente amarela (eYFP) usando um leitor de placa (seção 4.2) ou um citometro de fluxo (seção 4.3).
      NOTA: Synechocystis PCC 6803 e S. elongatus UTEX 2973 culturas podem ser cultivadas como na etapa 3.1.2. É altamente recomendável que a placa seja mantida alta umidade (95%) para evitar a evaporação das amostras de cultura.
  2. Leitor de placas
    1. Misture brevemente as culturas na placa de 24 poços (passo 4.1.4) com tubulação suave. Transfira uma sub-amostra de cada cultura para uma placa preta de 96 poços de fundo chato(Mesa de Materiais). Diluir, se necessário (100 μL volume final). Evite a formação de bolhas, pois isso pode interferir com a precisão da medição.
      NOTA: Recomenda-se que todas as medições sejam realizadas em amostras em uma faixa de OD750 de 0,2 a 1,0. Como a densidade das culturas nos 24 poços aumentará ao longo do tempo, as seguintes diluições são recomendadas com base nos aumentos esperados nas condições de crescimento padrão: sem diluição em 0 h, 1:4 às 24 h, 1:10 às 48 h e 1:10 às 72 h. Assim, por exemplo, às 24 h de colheita 25 μL de cultura e misture com 75 μL de BG11 médio.
    2. Inclua dois poços em branco na placa de 96 poços (ou seja, 100 μL do meio BG11). Coloque o prato de 96 poços em um leitor de placas(Mesa de Materiais). Agite a placa para 60 s em 500 rpm usando o agitador orbital no leitor da placa para misturar os poços.
      NOTA: As culturas de cianobacteriano podem agregar e/ou flocculate, assim que a boa mistura é crítica antes da leitura para medidas exatas.
    3. Medir oD.OD 750 e a fluorescência do eYFP com comprimentos de onda da excitação/emissão em 485 nm/520 nm.
    4. Subtraia a média das medições od750 dos dois poços em branco da medição od750 de cada amostra bem contendo cultura de cianobactérias.
    5. Normalize os valores de fluorescência de cada amostra de cultura dividindo a medida de fluorescência do eYFP (passo 4,2,3) pelo OD750 ajustado da cultura (passo 4.2.4). Em seguida, subtraia o valor médio normalizado da fluorescência do eYFP (fluorescência/OD750)das réplicas biológicas de uma tensão de controle negativa apropriada das tensões transgênicas que carregam o da expressão do eYFP.
      NOTA: As cianobactérias fluorescem naturalmente devido à presença de pigmentos, como clorofila e fiobiliproteínas.
    6. Crescimento da cultura do enredo ao longo do tempo(Figura 6A)e os valores médios normalizados de fluorescência eYFP de cada cultura experimental nos pontos de tempo desejados (por exemplo, 72 h; Figura 6B).
  3. Citometro de fluxo
    1. Escolha uma placa compatível para o sistema de manuseio líquido citometro de fluxo. Por exemplo, use uma placa de 96 poços de fundo redondo(Tabela de Materiais)com o citometro de fluxo(Tabela de Materiais)usado neste protocolo.
    2. Misture brevemente as culturas na placa de 24 poços (passo 4.1.4) com tubulação suave. Diluir as culturas para OD750 = 0,1-0,2 para evitar bloqueios de bico no sistema de manuseio líquido. Adicione um volume apropriado de amostra de cultura à placa de 96 poços e traga para um volume final de 250 μL com soro fisiológico 1x amorteceu de fosfato esterilizado por filtro (PBS). Inclua um poço em branco para a solução média na placa contendo 60 μL de BG11 e 190 μL de 1x PBS.
      NOTA: Este volume é recomendado no caso de haver uma necessidade de re-executar amostras. Volumes superiores a 250 μL não são recomendados, pois o volume máximo de cada poço é de 300 μL.
    3. Uma vez que o citometro de fluxo está pronto para uso, coloque a placa de 96 poços com amostras de cultura na estação de manuseio líquido. Configure o protocolo de software para o citometro de fluxo para coletar as medições de 10.000 eventos individuais (por exemplo, células). Medir a fluorescência eYFP com comprimentos de onda de excitação/emissão de 488 nm/515-545 nm. Primeiro medir e verificar a leitura do poço em branco(Figura 7A), em seguida, executar as amostras.
    4. Gate a população de células cianobactérias dentro da frente e conjuntos de dados de dispersão lateral, excluindo regiões comuns com a leitura em branco (Figura 7B). Subtraia os valores médios de fluorescência eYFP das réplicas biológicas de uma cepa de controle negativa apropriada das cepas transgênicas que transportam o de expressão eYFP (Figura 7C,D). Traçar a média dos valores medianos de fluorescência por célula para cada cultura experimental nos pontos de tempo desejados (por exemplo, 72 h; Figura 7E).

5. Extração genômica do ADN das cianobactérias

NOTA: O protocolo abaixo utiliza um kit comercial de extração de DNA(Tabela de Materiais).

  1. Crescer uma cultura líquida cianobacteriana em BG11 (como descrito na seção 3.1) até OD750 = 1,5-3,0. Desça 10 mL de cultura a 3.000 x g por 10 min e descarte o supernatant. Congele a pelota incubando os tubos a -20 °C por 30 min.
  2. Adicione 400 μL de lume de lúce (buffer AP1) e 400 μL de solução de ribonuclease (RNase A) e 50% (w/v) de contas de vidro (0,5 mm de diâmetro). Interrompa amostras usando um moinho de contas(Mesa de Materiais)a 30 Hz (ou seja, equivalente a 1.800 oscilações/min) por 6 min.
  3. Gire a amostra em 17.000 x g por 5 min e transfira cuidadosamente o supernatant em um tubo novo e descarte a pelota. Prossiga de acordo com as instruções do fabricante(Tabela de Materiais).

6. Eletroforese de gel agarose

  1. Lançar um 1% (w/v) gel agarose contendo 0,02% (v/v) brometo de etídio. Carregue amostras e uma referência apropriada da escada do ADN.
  2. Executar as amostras por 50 min em 125 V. Verifique se há separação de banda em um transilluminator ultravioleta (UV).
    NOTA: O tempo de execução e a porcentagem de gel agarose pode ser modificado para atender ao tamanho esperado da banda. Por exemplo, um gel agarose de porcentagem maior e maior tempo de execução podem melhorar a resolução da banda e a separação de produtos de DNA <500 bp.

7. Colônia PCR

  1. Configure um mix de reação pcr usando um kit padrão(Tabela de Materiais)e uma combinação apropriada de primers (por exemplo, primers que flanqueiam a região de montagem ou são específicos para seqüências dentro da região de montagem(Tabela 3). Pipeta 10 μL em um tubo PCR.
  2. Toque delicadamente a parte superior de uma única colônia branca com um toothpick estéril ou uma ponta estéril da pipeta de 10 μL e inocule um tubo do PCR que contem a mistura da reação do PCR. Tome cuidado para marcar a colônia e combinar com o tubo PCR específico. Mexa delicadamente a mistura de reação para garantir que as células de E. coli sejam derramadas na solução.
  3. Amplifique os produtos por PCR. Use um programa composto por uma etapa inicial de desnaturação de 95 °C para 60 s, 30 rodadas de 95 °C para 15 s, 58 °C para 15 s (poucos graus abaixo dos valores Tm das cartilhas) , 72 °C para 30 s (30 s/kb de inserção) , seguido por uma etapa de extensão final de 72 °C para 5 min.

8. Preparação de BG11 médio e placas

  1. Prepare soluções de estoque de 100x BG11 médio, ferro (citrato férrico de amônio), oligoelementos, fosfato (K2HPO4),Na2CO3 e TAMPÃO TES de acordo com Lea-Smith et al.11. Fosfato de autoclave e estoques de CO3 Na2. Use filtros de 0,2 μm para filtrar esterilizar as soluções de ações TES buffer (pH 8.2) e NaHCO3.
  2. Prepare 1 L de BG11 médio. Misture 10 mL de 100x BG11, 1 mL de oligoelementos e 1 mL de ferro e autoclave a solução com 976 mL de água. Uma vez que a solução tenha esfriado para RT, adicione 1 mL de estoque de fosfato, 1 mL deestoqueDE 2 CO3 e 10 mL de NaHCO3,e ajuste para pH 7.6-7.8 com 1 M HCl.
  3. Placas de ágar LB-BG11 (1,5% [w/v])
    1. Combine 700 mL de água desionizada e 15 g de ágar em um frasco de vidro. Em um segundo frasco, adicione 186 mL de água, 10 mL de 100x BG11, 1 mL de oligoelementos e 1 mL de caldo de ferro. Autoclave ambas as soluções.
    2. Uma vez que as soluções esfriaram para cerca de 60 °C, combiná-los e adicionar 1 mL de estoque de fosfato, 1 mL de Na2CO3 estoque, 10 mL de NaHCO3 estoque e 50 mL de LB médio estéril, que deve dar um volume final de 1 L. Cast petri pratos com 25 mL de LB-BG11 agar médio.
  4. PLACAS de ágar BG11+Kan50 (1,5% [w/v])
    1. Combine 700 mL de água desionizada e 15 g de ágar em um frasco de vidro. Em um segundo frasco, adicione 3 g de tiosulfato de sódio (Na2S2O3),226 mL de água, 10 mL de 100x BG11 estoque, 1 mL de oligoelementos e 1 mL de ferro. Autoclave ambas as soluções.
    2. Uma vez que as soluções esfriaram para cerca de 60 °C, combiná-las e adicionar 1 mL de estoque de fosfato, 1 mL de estoque de NA2CO3, 10 mL de estoque tampão TES e 10 mL de estoque NaHCO3, o que deve dar um volume final de 1 L. Adicionar sulfato de kanamicina a uma concentração final de 50 μg/mL e molde pratos de Petri com 35 mL do meio.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Para demonstrar o fluxo de trabalho de montagem golden gate, uma fita de expressão foi montada no vetor de aceitação de nível 1 (Forward) (pICH47732) contendo as seguintes partes de nível 0: o promotor do operon C-phycocianina P cpc560 (pC0.005), contendo as seguintes partes de nível 0: o promotor do operon C-phycocianina P cpc560 (pC0.005), contendo as seguintes partes de nível 0: o promotor do operon C-phycocianina P cpc560 (pC0.005), contendo as seguintes partes de nível 0: o promotor do operon C-phycocianina P cpc560 (pC0.005), contendo as seguintes partes de nível 0: o promotor do operon C-phycocianina Pcpc560 (pC0.005), contendo as seguintes partes de nível 0: o promotor a sequência de codificação para eYFP (pC0.008) e o duplo exterminador TrrnB (pC0.082)12. Após a transformação da reação de montagem, assembléias bem-sucedidas foram identificadas usando a triagem azul-branca padrão das colônias de E. coli (Figura 3). O de expressão eYFP no vetor de nível 1 e o vetor End-Link 1 (pICH50872) foram então montados em um vetor de aceitação de Nível T (pPMQAK1-T) para dar ao vetor cpcBA-eYFP (Figura 4A). O vetor cpcBA-eYFP montado foi verificado por digestão de restrição (Figura 4B).

Transferência conjugal bem sucedida de cpcBA-eYFP ou o vetor pPMQAK1-T vazio (ou seja, um controle negativo sem o de expressão eYFP) resultou no crescimento de até várias centenas de colônias na membrana para Synechocystis PCC 6803 e S. alongatus UTEX 2973 após 7-14 dias e 3-7 dias, respectivamente (Figura 5). Colônias individuais foram colhidas e listradas em placas frescas de ágar BG11+Kan50; 2-3 re-estrias foram necessárias para gerar culturas axenic.

Como esperado para o forte promotor pcpc560 51, os valores para a fluorescência normalizada eYFP do leitor de placa e fluorescência eYFP por célula do citometro de fluxo foram elevados em comparação com o controle negativo (Figura 6 e Figura 7). Os valores de fluorescência foram maiores em S. elongatus UTEX 2973 do que no Synechocystis PCC 680312.

Figure 1
Figura 1: Visão geral do processo de montagem do Golden Gate em CyanoGate. A montagem de uma fita de expressão gênica é mostrada, a partir da amplificação de uma seqüência de interesse do DNA modelo à montagem em um vetor de Nível T (as peças não são desenhadas em escala). (A) Design de primers para frente e reversa para a amplificação de uma parte CDS1 do Modelo de DNA (por exemplo, DNA genômico ou plasmídeo). Os locais dos sites de restrição bpii e saliências necessárias para a inserção no vetor aceitador (ou seja, 5′ e 3′ da sequência de modelos) são destacados em vermelho e azul, respectivamente. A letra "n" denota que qualquer NT pode ser usado nesta posição. As regiões annealing das primers com o molde do ADN e suas temperaturas de derretimento recomendadas (Tm)são indicadas. (B) Montagem de nível 0 do produto PCR no nível 0 CDS1 acceptor vetor pICH41308. A seqüência que será extirpada pelo BpiI e ligada para o vetor aceitador é destacada em azul. (C) Montagem de nível 1 de uma fita de expressão gênica contendo três partes de nível 0 (Pro + 5U, CDS1 e 3U + Ter) na posição nível 1 (para a frente) vetor de veto pICH47732 usando BsaI. (D)Montagem de nível T da montagem de nível 1 e End-Link 1 (pICH50872, chamado de "Level M End-link 1" em Engler et al.15) em um vetor de aceitação de nível T (por exemplo, pPMQAK1-T) usando bpii. (E)O vetor de nível T montado final. Abreviaturas: AmpR, de resistência à ampicilina; CarbR, da resistência do carbenicillin; CDS1, sequência de codificação na sintaxe nível 015; EL1, End-Link 1 parte; KanR, da resistência do kanamycin; lacZα, β-galactosidase expressão cassete; SpecR, da resistência do spectinomycin. Clique aqui para ver uma versão maior deste número.

Figure 2
Figura 2: Uma estratégia de domesticação baseada em PCR para a remoção de um site de restrição iis tipo ilegal. (A) Diagrama esquemático que mostra dois pares de primer (em verde e laranja, respectivamente) para modificar um site BpiI (GAAGAC) para GAGGAC em uma seqüência de DNA codificação de proteínas destinada s montagem no vetor de aceitação cds1 nível 0 (pICH41308). Note-se que a modificação preserva o codon para o ácido glutamômico (Glu) (ou seja, GAA para GAG). Embora o site BpiI seja mostrado no quadro com o codon inicial, essa abordagem funcionará mesmo que o local não esteja no quadro (ou seja, enquanto o local for interrompido e a sequência de proteínas preservada). Os locais dos sites de restrição bpii e saliências nas cartilhasão são destacados em vermelho e azul, respectivamente. O modelo de DNA e a sequência de proteína traduzida são destacados em amarelo. As regiões annealing das primers com o molde do ADN e suas temperaturas de derretimento recomendadas (Tm)são indicadas. O par laranja é usado para amplificar o final 5′ da seqüência com saliências AATG e TGAA (fragmento 1), enquanto o par verde é usado para amplificar o final de 3′ com saliências TGAA e GCTT (fragmento 2). Antes de encomendar as cartilha, a fidelidade da saliência de fusão TGAA para o Fragmento 1 e 2 foi cuidadosamente verificada52. Saliências de fusão mal projetadas podem levar à falha de montagem (ou seja, nenhuma colônia após a transformação; Figura 5) ou falsos positivos (por exemplo, montados ou errôneos). Este último pode ser resolvido ser a triagem de um maior número de colônias brancas para identificar uma construção corretamente montada. (B)Amplicons dos fragmentos 1 e 2 após a limitação com BpiI durante o conjunto dourado da porta. (C)A seqüência domesticada montada no vetor de aceitação de Nível 0 CDS1. Clique aqui para ver uma versão maior deste número.

Figure 3
Figura 3: Triagem colônia azul-branco de e. coli transformants após golden gate montagem. As placas mostradas contêm agar LB (1% [w/v]) complementada com X-Gal, IPTG e antibióticos em concentrações apropriadas. (A)Sem colônias, sugerindo uma reação de montagem fracassada e/ou transformação de E. coli. (B) Principalmente colônias azuis, indicando uma montagem bem sucedida, mas que a eficiência da enzima de restrição usada na reação de montagem foi baixa. (C)Principalmente colônias brancas, indicativas de uma reação de montagem típica e bem-sucedida. (D)Não há colônias azuis, indicando montagem muito eficiente. Clique aqui para ver uma versão maior deste número.

Figure 4
Figura 4: Verificação de um vetor de nível T montado por digestão de restrição. Os vetores foram digeridos com HindIII e BamHI. (A) Mapa da sequência do vetor de aceitação pPMQAK1-T vazio (CT.0) e da montagem de Nível T(cpcBA-eYFP) mostrando componentes da de expressão eYFP (Pcpc560-eYFP-TrrnB). As posições dos locais de restrição para HindIII e BamHI são indicadas. Após a digestão dupla, os tamanhos previstos dos fragmentos de DNA são indicados: (1) 5.847 bp, (2) 2.004 bp, (3) 30 bp, (4) 374 bp, (5) 1.820 bp, (6) 1.289 bp, e (7) 156 bp. (B) Um gel agarose (0,8% [w/v]) executado em 125 V para 60 min carregado com o nível digerido T montagem (cpcBA-eYFP) mostrando as bandas 1, 5 e 6, o vetor de aceitação pPMQAK1-T vazio digerido (CT.0) mostrando as bandas 1 e 2 e uma escada de DNA(Tabela de Materiais). Note-se que as bandas 3, 4 e 7 eram pequenas demais para visualizar o gel. Clique aqui para ver uma versão maior deste número.

Figure 5
Figura 5: Crescimento das colônias transgênicas da Synechocystis PCC 6803 após conjugação bem-sucedida. Exemplos de membranas após a incubação em placas de ágar BG11+Kan50 são mostrados. (A)O crescimento excessivo que segue a conjugação muito eficiente as colônias 6803 do PCC de Synechocystis 6803 tornou-se em um gramado sem colônias individuais. (B) Uma boa eficiência de conjugação mostrando várias centenas de colônias individuais após 12 dias. (C) Crescimento de uma estirpe axenic após 14 dias após várias rodadas de re-estrias em uma placa de ágar BG11 + Kan50 fresco. A ausência de contaminação bacteriana indicou que o transconjugante Synechocystis PCC 6803 era axenic. Clique aqui para ver uma versão maior deste número.

Figure 6
Figura 6: Dados representativos de crescimento e valores normalizados de fluorescência eYFP usando um leitor de placas. (A) Comparação de crescimento de cepas que transportam cpcBA-eYFP ou o vetor pPMQAK1-T vazio (CT.0, controle negativo) em Synechocystis PCC 6803 e S. elongatus UTEX 2973. Os valores são os meios ± SE de quatro réplicas biológicas. Synechocystis Synechocystis PCC 6803 e S. elongatus UTEX 2973 foram cultivados por 72 h a 30 °C com luz contínua (100 fótons μmol m-2s-1)e 40 °C com 300 fótons μmol m-2s-1, respectivamente. (B) Valores normalizados de fluorescência eYFP para Synechocystis PCC 6803 ou S. elongatus UTEX 2973 conjugados com cpcBA-eYFP a 72 h. Valores são os meios ± SE de quatro réplicas biológicas. Clique aqui para ver uma versão maior deste número.

Figure 7
Figura 7: Valores representativos de fluorescência eYFP usando um citometro de fluxo. (A) Forward (FSC-H) e lado (SSC-H) espalham enredo da solução média "em branco" (BG11 e PBS). (B)Espalhe enredo para uma amostra Synechocystis PCC 6803 (direita). O círculo indica a região selecionada que gating a população dos cyanobacteria do restante do sinal da amostra. (C) Histograma da região fechada para uma cepa carregando o vetor pPMQAK1-T vazio (CT.0, controle negativo). (D)Histograma da região fechada para uma cepa que transporta cpcBA-eYFP. (E) eYFP fluorescência valores por célula em Synechocystis PCC 6803 e S. alongatus UTEX 2973 em 72 h. Fluorescência do controle negativo foi subtraído. Os valores são os meios ± SE de quatro réplicas biológicas. Clique aqui para ver uma versão maior deste número.

Não. Vector ID Nome Descrição 5' saliência 3' saliência
1 pICH41233 pICH41233 Pro Promotor GGAG GGAG Tato
2 pICH41295 pICH41295 Pro + 5U Pro + 5U Promotor e 5região não traduzida GGAG GGAG Gtaa
3 pAGM1251 pAGM1251 Pro + 5U (f) Promotor e sequência não traduzida de 5 para fusões terminais N GGAG GGAG CCAT CCAT
4 pICH41246 pICH41246 5U 5U 5região não traduzida Tato CCAT CCAT
5 pAGM1263 pAGM1263 5U (f) 5U (f) 5′ seqüência não traduzida para fusões terminais N Tato CCAT CCAT
6 pICH41246 pICH41246 5U + NT1 5U + NT1 Região 5' região não traduzida e região de codificação terminal N Tato CCAT CCAT
7 pAGM1276 pAGM1276 NT1 NT1 N terminal tag ou sinal de localização CCAT CCAT Gtaa
8 pICH41258 pICH41258 Sp Peptídeo do sinal Gtaa AGGT AGGT
9 pICH41258 pICH41258 NT2 NT2 N terminal tag ou sinal de localização Gtaa AGGT AGGT
10 pAGM1287 pAGM1287 CDS1 ns CDS1 ns Região de codificação sem parar codon Gtaa TTCG TTCG
11 pICH41308 pICH41308 Parada CDS1 Região de codificação com parada codon Gtaa GCTT GCTT
12 pAGM1299 pAGM1299 CDS2 ns CDS2 ns Região de codificação - sem iniciar e parar codon AGGT AGGT TTCG TTCG
13 pICH41264 pICH41264 Parada cds2 Região de codificação - sem início e com parada codon AGGT AGGT GCTT GCTT
14 pAGM1301 pAGM1301 Ct Tag terminal C ou sinal de localização TTCG TTCG GCTT GCTT
15 pICH53388 pICH53388 3u 3região não traduzida GCTT GCTT GGTA GGTA
16 pICH53399 pICH53399 Ter Ter Terminator GGTA GGTA CGCT CGCT
17 pICH41276 pICH41276 3U + Ter 3U + Ter 3região não traduzida e exterminador do futuro GCTT GCTT CGCT CGCT
18 pICH41331 pICH41331 Cgm Aceitador de genéticas completas GGAG GGAG CGCT CGCT
19 pCA0.002 pCA0.002 Pro (cópia baixa) Promotor, baixo número de cópia aceitador (pSC101 ori) GGAG GGAG Tato
20 pCA0.001 pCA0.001 Pro TSS Promotor truncado para o site de início de transcrição GGAG GGAG TAGC TAGC
21 Direto para o nível 1 srRNA SrRNA Pequeno RNA regulatório (para silenciamento translacional) TAGC TAGC GTTT GTTT
22 Direto para o nível 1 sgRNA sgRNA Único guia RNA (para CRISPRi) TAGC TAGC GTTT GTTT
23 pICH41295 pICH41295 ATÉ FLANCO Sequência de flanco a montante do site de recombinação homologous alvo GGAG GGAG Gtaa
24 pICH41276 pICH41276 FLANCO PARA BAIXO Sequência de flanco a jusante do site de recombinação homologous alvo GCTT GCTT CGCT CGCT

Tabela 1: Uma lista de vetores e saliências aceitadores de nível 0 disponíveis. Os vetores 1-18 são do kit Plant MoClo15. Vetores 19-22 são do kit CyanoGate12. Para partes srRNA e sgRNA, sequências sintetizadas ou produtos PCR são montados diretamente em vetores de aceitadores de nível 1. Os vetores 23-24 são do kit MoClo da planta que foram reaproveitados para transformação por recombinação homóloga usando o kit CyanoGate.

Componentes de montagem bpii (nível 0, T) Componentes de montagem BsaI (Nível 1)
50-100 ng de vetor aceitador 50-100 ng de vetor aceitador
Para que cada vetor/parte insira, use uma proporção de 2:1 de inserção: vetor de aceitação. Para que cada vetor/parte insira, use uma proporção de 2:1 de inserção: vetor de aceitação.
2 μL 10 mM ATP(Tabela de Materiais) 2 μL 10 mM ATP(Tabela de Materiais)
2 μL buffer G (buffer para BpiI/BsaI) 2 μL buffer G (buffer para BpiI/BsaI)
2 μL BSA (10x) (Tabela de Materiais) 2 μL BSA (10x) (Tabela de Materiais)
10 unidades BpiI (1 μL10 U/μL BpiI, Tabela de Materiais) 10 unidades BsaI (1 μL 10 U/μL BsaI, Tabela de Materiais)
Traga para 20 μL com dH2O. Traga para 20 μL com dH2O.
200 unidades T4 DNA ligase (1 μL 200 U/μL, Tabela de Materiais) 200 unidades T4 DNA ligase (1 μL 200 U/μL, Tabela de Materiais)
Protocolo de bicicmterlista (Nível 0, T) Protocolo de termociclo (Nível 1)
37 °C por 10 min ciclo x 5 37 °C por 10 min ciclo x 5
16 °C por 10 min 16 °C por 10 min
37 °C por 20 min 37 °C por 20 min
65 °C por 10 min 65 °C por 10 min
16 °C (espera) 16 °C (espera)

Tabela 2: Protocolos para montagens Golden Gate nos níveis 0, 1 e T. Montagem no nível 0 e os vetores de aceitadores de nível T usa a enzima de restrição BpiI (esquerda). Montagem no nível 1 vetores aceitadores usa restrição enzima BsaI (direita). Esta tabela foi adaptada de Vasudevan et al.12.

Primer No. Sequência (5'-3') Comprimento (bp) Descrição
L0T para a frente GTCTCATGAGCGGATACATA GTCTCATGAGCGGATACATA
TTTGAATG TTTGAATG
28 Para amplificação do Nível 0 e nível T
L1 reverso GAACCCTGTGGTTGGCATGC GAACCCTGTTTGGCATGC
ACATAC ACATAC
26 Para amplificação do Nível 1
L1 para a frente CTGGTGGCAGGATATTGT CTGGTGGCAGGATATTGT
GGTG GGTG
24 Para amplificação do Nível 1
L0T reverso TTGAGTGAGCTGATACCGCT TTGAGTGAGCTGATACCGCT 20 Para amplificação do Nível 0 e nível T

Tabela 3: Lista de cartetas para validação ou sequenciamento de PCR dos vetores de nível 0, 1 e T.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Golden Gate montagem tem várias vantagens em comparação com outros métodos de montagem vetorial, particularmente em termos de escalabilidade20,21. No entanto, a criação do sistema Golden Gate em um laboratório requer tempo para desenvolver uma familiaridade com as várias partes e bibliotecas vetorial aceitadoras e processos de montagem em geral. O planejamento cuidadoso é muitas vezes necessário para assembléias mais complexas ou ao realizar um grande número de assembléias complexas em paralelo (por exemplo, fazer um conjunto de vetores de nível T contendo várias de expressão gênica). Recomendamos primeiro listar todas as combinações de de expressão gênica necessárias e, em seguida, mapear o fluxo de trabalho do Nível 0 para o Nível T em silico. Durante este processo, os usuários devem considerar o Nível 1 "Manequim" peças disponíveis no kit MoClo Planta que permitem a montagem de não-sequenciais nível 1 vectores em nível T (por exemplo, nível 1 posição 1 e posição 3 vetores podem ser montados em conjunto com "Manequim" parte Nível 1 posição 2), que pode reduzir o número total de reações de montagem e etapas de clonagemnecessárias 15.

A síntese de DNA é tipicamente o método mais simples para a construção de novas peças de Nível 0. No entanto, quando a clonagem é necessária (por exemplo, a partir de plasmídeos ou DNA genômico), otimizar o design das cartilhas usadas para amplificação é importante para maximizar a eficiência da montagem vetorial nível 0 subsequente. Os dois passos mais críticos no design primer são: 1) verificando se as saliências corretas estão incluídas e estão na orientação apropriada para as cartilhas para frente e reversa (Figura 1 e Tabela 1), e 2) garantindo que o comprimento da cartilha seqüência que anneals para o modelo é suficientemente longo (18-30 bp) e que o valor Tm para esta seqüência (idealmente 58-62 °C) é semelhante para o par primer(Figura 1A). Se uma sequência requer domesticação, várias estratégias estão disponíveis. Para sequências curtas (por exemplo, <200 bp), um par de primers longos para a frente e reversa pode ser projetado em que o 3′ termina anneal uns aos outros (ou seja, uma sobreposição de >20 bp) e formar uma seqüência dupla encalhada após amplificação. Para sequências mais longas, fragmentos separados da sequência podem ser amplificados que removem locais de restrição ilegais e, em seguida, montados usando uma abordagem de montagem do Golden Gate(Figura 2). Se a eficiência da montagem com produtos PCR for ruim, fragmentos individuais de uma sequência de nível 0 podem ser clonados no vetor de aceitação universal nível 1 (pAGM1311), validado e, em seguida, montados juntos no vetor de aceitação de nível 015. Uma inserção 2:1:acceptor vetor molar ratio é recomendado para eficiente montagem Golden Gate. No entanto, para montagens de apenas 2-3 vetores (por exemplo, duas peças de nível 0 e um vetor de aceita-aceitação de nível 1), combinando ~ 100 ng de cada regularmente normalmente resulta em conjuntos bem sucedidos. A eficiência das assembléias tende a diminuir à medida que o número de vetores usados por reação aumenta, resultando em uma redução no número total de colônias brancas após a transformação(Figura 3).

Antes da conjugação, recomenda-se a validação dos vetores de nível T finalizados por limitação e o PCR. Transferência de DNA conjugal é uma técnica bem estabelecida para cepas cianobacterianas, incluindo aqueles que não são naturalmente transformáveis41,45. Etapas importantes no protocolo de conjugação incluem: 1) manuseio cuidadoso da cepa de E. coli auxiliar após o crescimento noturno (por exemplo, evitar vórtices)35, 2) tomando cuidado para remover completamente os vestígios dos antibióticos usados para crescer ajudante e cepas de carga E. coli, 3) um período de incubação adequado para a mistura de cepas de carga e ajudante e cianobactérias (por exemplo, um período de incubação mais longo foi fundamental para S. alongatus UTEX 2973) e 4) o período inicial de transferência da célula mistura em membranas em placas de ágar LB-BG11 sem antibióticos para 24 h.

Colônias hanobacterianas isoladas devem se desenvolver na membrana dentro de duas semanas para Synechocystis PCC 6803 e S. elongatus UTEX 2973, caso contrário, é provável que a conjugação tenha falhado. Várias modificações no protocolo poderiam então ser testadas, incluindo 1) usando uma cultura cianobacteriana com maior densidade inicial (por exemplo, OD750 = 1,5 a 2); 2) aumentar o período de incubação antes da transferência para a membrana; e 3) estendendo o período inicial de incubação na membrana de 24 h para 48 h (ou seja, para permitir mais tempo para a expressão do gene de resistência aos antibióticos no vetor transferido). Se a conjugação ainda falhar, métodos alternativos, como a eletroporação, podem ser experimentados53. Confirmar uma cepa cianobacteriana transgênica é axenic é importante antes de uma experimentação. Finalmente, é uma boa prática confirmar o tamanho do vetor heterologous na cepa cianobacteriana transgênica. Este último requer extração de DNA (seção 5), transformação em E. coli e seleção (seção 2.1) e validação vetorial (seção 2.4).

O protocolo de caracterização do promotor delineado usa pequenos volumes de cultura (ou seja, 2 mL) como um meio de alcançar uma metodologia de triagem de alta de seleção de vendas. Volumes maiores poderiam ser usados dependendo do espaço fotobiorreator disponível, o que ajudaria a mitigar os problemas de evaporação da cultura. Se a seleção elevada da taxa de crédito com volumes pequenos da cultura é exigida, é essencial ter a umidade elevada dentro da câmara do crescimento para inibir a evaporação. A evaporação durante um experimento de crescimento pode ser prejudicial à precisão e validade das medições da amostra. Verifique os volumes de cultura durante e após o experimento para confirmar a quantidade de evaporação.

Para as medições do leitor de placas, é importante medir culturas em baixas densidades, idealmente OD750 < 1, para garantir a aquisição de dados confiáveis e reproduzíveis de crescimento e fluorescência. Uma relação linear entre o número celular e o OD750 é observada apenas dentro de um intervalo específico54. Para estabelecer essa faixa, recomendamos a realização de uma diluição em série (por exemplo, de OD750 = 0,1-1,0) usando um transformante conhecido onde a fluorescência eYFP foi confirmada. A conspiração de fluorescência absoluta contra a fluorescência normalizada (fluorescência/OD750)ajudará a identificar a gama linear de densidades culturais. Vários leitores de placas incluem um recurso de "ganho" para modificar a sensibilidade do detector de fluorescência. Neste caso, o valor de ganho deve ser definido para um nível adequado antes de iniciar o experimento e não alterado entre diferentes corridas experimentais ou os dados não serão diretamente comparáveis.

Embora o funcionamento de diferentes citometros de fluxo varie entre os fabricantes, é importante fazer uma leitura em branco da solução média para facilitar a identificação e a marcha da população cianobacteriana alvo de qualquer sinal de fundo o meio (Figura 7A,B). Em seguir, a subtração do valor da fluorescência da amostra de controle negativo (por exemplo, uma cepa selvagem) ajudará a remover a autofluorescência nativa (Figura 7C,D). O parâmetro de tensão do tubo fotomultiplicador (TPM) em um citometro de fluxo tem uma função semelhante ao ganho em um leitor de placa, ou seja, aumentando ou diminuindo a sensibilidade do detector para a intensidade do sinal de fluorescência. Tal como acontece com o leitor de placa, tensão PMT deve ser definido para um nível adequado antes de iniciar o experimento55. Uma vez definido, o valor de tensão pmt deve ser mantido entre diferentes corridas experimentais ou os dados não serão diretamente comparáveis.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada a divulgar.

Acknowledgments

Os autores são gratos à Rede de Pesquisa em Biotecnologia e Ciências Biológicas da PHYCONET (BBSRC) em Biotecnologia Industrial e Bioenergia (NIBB) e ao Centro de Inovação em Biotecnologia Industrial (IBioIC) pelo apoio financeiro. GARG, AASO e AP reconhecem o apoio ao financiamento do programa BBSRC EASTBIO CASE PhD (número de subvenção BB/M010996/1), do Programa de Doutorado Consejo Nacional de Ciencia y Tecnología (CONACYT) e do programa de doutorado IBioIC-BBSRC Collaborative Training Partnership (CTP), Respectivamente. Agradecemos conrad Mullineaux (Queen Mary University de Londres), e Poul Eric Jensen e Julie Annemarie Zita Zedler (Universidade de Copenhague) para plasmid vetor e protocolo contribuições e conselhos.

Materials

Name Company Catalog Number Comments
5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal) Thermo Fisher Scientific R0404 Used in 2.1.3.
Adenosine 5′-triphosphate (ATP) disodium salt Sigma-Aldrich A2383 Used in Table 2.
Agar (microbiology tested) Sigma-Aldrich A1296-500g Used in 8.3.
Agarose Bioline BIO-41026 Used in 6.
Attune NxT Flow Cytometer Thermo Fisher Scientific - Used in 4.3.1.
Bovine Serum Albumin (BSA) Sigma-Aldrich A2153 Used in Table 2.
BpiI (BbsI) Thermo Fisher Scientific ER1011 Used in Table 2.
BsaI (Eco31I) Thermo Fisher Scientific ER0291 Used in Table 2.
Carbenicillin disodium VWR International A1491.0005 Used in 2.1.3.
Corning Costar TC-Treated flat-bottom 24 well plates Sigma-Aldrich CLS3527 Used in 4.1.3.
Dimethyl Sulfoxide (DMSO) Thermo Fisher Scientific BP231-100 Used in 3.6.2.
DNeasy Plant Mini Kit Qiagen 69104 DNA extraction kit. Used in 5.
FLUOstar Omega Microplate reader BMG Labtech - Used in 4.2.2.
GeneJET Plasmid Miniprep Kit Thermo Fisher Scientific K0503 Plasmid purification kit. Used in step 2.3.2.
Glass beads (0.5 mm diameter) BioSpec Products 11079105 Used in 5.2.
Glycerol Thermo Fisher Scientific 10021083 Used in 2.3.1, 3.6.2.
Isopropyl-beta-D-thiogalactopyranoside (IPTG) Thermo Fisher Scientific 10356553 Used in 2.1.3.
Kanamycin sulphate (Gibco) Thermo Fisher Scientific 11815-024 Used in 2.1.3.
Membrane filters (0.45 μm) MF-Millipore HAWP02500 Used in 3.3.7
Microplates, 96-well, flat-bottom (Chimney Well) µCLEAR Greiner Bio-One 655096 Used in 4.2.1.
Monarch DNA Gel Extraction Kit New England Biolabs T1020S Used in 1.1.2.2.
Monarch PCR DNA Cleanup Kit New England Biolabs T1030 DNA purification kit. Used in 1.1.2.3.
Multitron Pro incubator with LEDs Infors HT - Shaking incubator with white LED lights. Used in 4.1.4.
MyTaq DNA Polymerase Bioline BIO-21108 Used in 7.1.
NanoDrop One Thermo Fisher Scientific ND-ONE-W Used in 2.3.3.
One Shot TOP10 chemically competent E. coli Thermo Fisher Scientific C404010 Used in 2.1.1.
Phosphate buffer saline (PBS) solution (10X concentrate) VWR International K813 Used in 4.3.2.
Q5High-Fidelity DNA Polymerase New England Biolabs M0491S Used in 1.1.2.1.
Quick-Load 1 kb DNA Ladder New England Biolabs N0468S Used in Figure 4.
Screw-cap tubes (1.5 ml) Starstedt 72.692.210 Used in 3.6.3
Spectinomycin dihydrochloride pentahydrate VWR International J61820.06 Used in 2.1.3.
Sterilin Clear Microtiter round-bottom 96-well plates Thermo Fisher Scientific 612U96 Used in 4.3.1.
T4 DNA ligase Thermo Fisher Scientific EL0011 Used in Table 2.
TissueLyser II Qiagen 85300 Bead mill. Used in 5.2.

DOWNLOAD MATERIALS LIST

References

  1. Luan, G., Lu, X. Tailoring cyanobacterial cell factory for improved industrial properties. Biotechnology Advances. 36, (2), 430-442 (2018).
  2. Madsen, M. A., Semerdzhiev, S., Amtmann, A., Tonon, T. Engineering mannitol biosynthesis in Escherichia coli and Synechococcus sp. PCC 7002 using a green algal fusion protein. ACS Synthetic Biology. 7, (12), 2833-2840 (2018).
  3. Menin, B., et al. Non-endogenous ketocarotenoid accumulation in engineered Synechocystis sp. PCC 6803. Physiologia Plantarum. 166, (1), 403-412 (2019).
  4. Varman, A. M., Yu, Y., You, L., Tang, Y. J. Photoautotrophic production of D-lactic acid in an engineered cyanobacterium. Microbial Cell Factories. 12, (1), 1-8 (2013).
  5. Vavitsas, K., et al. Responses of Synechocystis sp. PCC 6803 to heterologous biosynthetic pathways. Microbial Cell Factories. 16, 140 (2017).
  6. Yang, G., et al. Photosynthetic production of sunscreen shinorine using an engineered cyanobacterium. ACS Synthetic Biology. 7, (2), 664-671 (2018).
  7. Nielsen, A. Z., et al. Extending the biosynthetic repertoires of cyanobacteria and chloroplasts. Plant Journal. 87, (1), 87-102 (2016).
  8. Nielsen, J., Keasling, J. D. Engineering cellular metabolism. Cell. 164, (6), 1185-1197 (2016).
  9. Stensjö, K., Vavitsas, K., Tyystjärvi, T. Harnessing transcription for bioproduction in cyanobacteria. Physiologia Plantarum. 162, (2), 148-155 (2018).
  10. Santos-Merino, M., Singh, A. K., Ducat, D. C. New applications of synthetic biology tools for cyanobacterial metabolic engineering. Frontiers in Bioengineering and Biotechnology. 7, 1-24 (2019).
  11. Lea-Smith, D. J., Vasudevan, R., Howe, C. J. Generation of marked and markerless mutants in model cyanobacterial species. Journal of Visualized Experiments. 111, e54001 (2016).
  12. Vasudevan, R., et al. CyanoGate: A modular cloning suite for engineering cyanobacteria based on the plant MoClo syntax. Plant Physiology. 180, (1), 39-55 (2019).
  13. Andreou, A. I., Nakayama, N. Mobius assembly: A versatile golden-gate framework towards universal DNA assembly. PLoS ONE. 13, (1), 1-18 (2018).
  14. Crozet, P., et al. Birth of a Photosynthetic Chassis: A MoClo toolkit enabling synthetic biology in the microalga Chlamydomonas reinhardtii. ACS Synthetic Biology. 7, (9), 2074-2086 (2018).
  15. Engler, C., et al. A Golden Gate modular cloning toolbox for plants. ACS Synthetic Biology. 3, (11), 839-843 (2014).
  16. Moore, S. J., et al. EcoFlex: A multifunctional MoClo kit for E. coli synthetic biology. ACS Synthetic Biology. 5, (10), 1059-1069 (2016).
  17. Pollak, B., et al. Loop assembly: a simple and open system for recursive fabrication of DNA circuits. New Phytologist. 222, (1), 628-640 (2019).
  18. Werner, S., Engler, C., Weber, E., Gruetzner, R., Marillonnet, S. Fast track assembly of multigene constructs using golden gate cloning and the MoClo system. Bioengineered Bugs. 3, (1), 38-43 (2012).
  19. Patron, N. J., et al. Standards for plant synthetic biology: a common syntax for exchange of DNA parts. New Phytologist. 208, (1), 13-19 (2015).
  20. Chao, R., Mishra, S., Si, T., Zhao, H. Engineering biological systems using automated biofoundries. Metabolic Engineering. 42, 98-108 (2017).
  21. Chambers, S., Kitney, R., Freemont, P. The Foundry: the DNA synthesis and construction Foundry at Imperial College. Biochemical Society Transactions. 44, (3), 687-688 (2016).
  22. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  23. Rosano, G. L., Ceccarelli, E. A. Rare codon content affects the solubility of recombinant proteins in a codon bias-adjusted Escherichia coli strain. Microbial Cell Factories. 8, 1-9 (2009).
  24. Cambray, G., et al. Measurement and modeling of intrinsic transcription terminators. Nucleic Acids Research. 41, (9), 5139-5148 (2013).
  25. Chen, Y. J., et al. Characterization of 582 natural and synthetic terminators and quantification of their design constraints. Nature Methods. 10, (7), 659-664 (2013).
  26. Münch, R., et al. Virtual Footprint and PRODORIC: An integrative framework for regulon prediction in prokaryotes. Bioinformatics. 21, (22), 4187-4189 (2005).
  27. Salis, H. M., Mirsky, E. A., Voigt, C. A. Automated design of synthetic ribosome binding sites to control protein expression. Nature Biotechnology. 27, (10), 946-950 (2009).
  28. Englund, E., Liang, F., Lindberg, P. Evaluation of promoters and ribosome binding sites for biotechnological applications in the unicellular cyanobacterium Synechocystis sp. PCC 6803. Scientific Reports. 6, 36640 (2016).
  29. Heidorn, T., et al. Synthetic biology in cyanobacteria engineering and analyzing novel functions. Methods in Enzymology. 497, 539-579 (2011).
  30. Thiel, K., et al. Translation efficiency of heterologous proteins is significantly affected by the genetic context of RBS sequences in engineered cyanobacterium Synechocystis sp. PCC 6803. Microbial Cell Factories. 17, 34 (2018).
  31. Liu, Q., Schumacher, J., Wan, X., Lou, C., Wang, B. Orthogonality and burdens of heterologous and gate gene circuits in E. coli. ACS Synthetic Biology. 7, (2), 553-564 (2018).
  32. Ferreira, E. A., et al. Expanding the toolbox for Synechocystis sp. PCC 6803: Validation of replicative vectors and characterization of a novel set of promoters. Synthetic Biology. (August), 1-39 (2018).
  33. Liang, F., Lindblad, P. Synechocystis PCC 6803 overexpressing RuBisCO grow faster with increased photosynthesis. Metabolic Engineering Communications. 4, 29-36 (2017).
  34. Taton, A., et al. Broad-host-range vector system for synthetic biology and biotechnology in cyanobacteria. Nucleic Acids Research. 42, (17), e136 (2014).
  35. Elhai, J., Wolk, C. P. Conjugal transfer of DNA to cyanobacteria. Methods in Enzymology. 167, (1984), 747-754 (1988).
  36. Gormley, E. P., Davies, J. Transfer of plasmid RSF1010 by conjugation from Escherichia coli to Streptomyces lividans and Mycobacterium smegmatis. Journal of Bacteriology. 173, (21), 6705-6708 (1991).
  37. Huang, H. H., Camsund, D., Lindblad, P., Heidorn, T. Design and characterization of molecular tools for a synthetic biology approach towards developing cyanobacterial biotechnology. Nucleic Acids Research. 38, (8), 2577-2593 (2010).
  38. Huang, H. H., Lindblad, P. Wide-dynamic-range promoters engineered for cyanobacteria. Journal of Biological Engineering. 7, 10 (2013).
  39. Li, S., Sun, T., Xu, C., Chen, L., Zhang, W. Development and optimization of genetic toolboxes for a fast-growing cyanobacterium Synechococcus elongatus UTEX 2973. Metabolic Engineering. 48, 163-174 (2018).
  40. Pansegrau, W., Balzer, D., Kruft, V., Lurz, R., Lanka, E. In vitro assembly of relaxosomes at the transfer origin of plasmid RP4. Proceedings of the National Academy of Sciences, USA. 87, (17), 6555-6559 (1990).
  41. Song, K., Tan, X., Liang, Y., Lu, X. The potential of Synechococcus elongatus UTEX 2973 for sugar feedstock production. Applied Microbiology and Biotechnology. 100, (18), 7865-7875 (2016).
  42. Waters, V. L., Guiney, D. G. Processes at the nick region link conjugation, T-DNA transfer and rolling circle replication. Molecular Microbiology. 9, (6), 1123-1130 (1993).
  43. Elhai, J., Vepritskiy, A., Muro-Pastor, A. M., Flores, E., Wolk, C. P. Reduction of conjugal transfer efficiency by three restriction activities of Anabaena sp. strain PCC 7120. Journal of Bacteriology. 179, (6), 1998-2005 (1997).
  44. Silva-Rocha, R., et al. The Standard European Vector Architecture (SEVA): A coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research. 41, (D1), D666-D675 (2013).
  45. Mandakovic, D., et al. CyDiv, a conserved and novel filamentous cyanobacterial cell division protein involved in septum localization. Frontiers in Microbiology. 7, (FEB), 1-11 (2016).
  46. Masukawa, H., Inoue, K., Sakurai, H., Wolk, C. P., Hausinger, R. P. Site-directed mutagenesis of the Anabaena sp. strain PCC 7120 nitrogenase active site to increase photobiological hydrogen production. Applied and Environmental Microbiology. 76, (20), 6741-6750 (2010).
  47. Yu, J., et al. Synechococcus elongatus UTEX 2973, a fast growing cyanobacterial chassis for biosynthesis using light and CO2. Scientific Reports. 5, (1), 8132 (2015).
  48. Ungerer, J., Wendt, K. E., Hendry, J. I., Maranas, C. D., Pakrasi, H. B. Comparative genomics reveals the molecular determinants of rapid growth of the cyanobacterium Synechococcus elongatus UTEX 2973. Proceedings of the National Academy of Sciences, USA. 115, (50), E11761-E11770 (2018).
  49. Lepesteur, M., Martin, J. M., Fleury, A. A comparative study of different preservation methods for phytoplankton cell analysis by flow cytometry. Marine Ecology Progress Series. 93, (1-2), 55-63 (1993).
  50. Day, J. G. Cryopreservation of cyanobacteria. Cyanobacteria: An Economic perspective. Wiley Blackwell. New York. 319-327 (2014).
  51. Zhou, J., et al. Discovery of a super-strong promoter enables efficient production of heterologous proteins in cyanobacteria. Scientific Reports. 4, 4500 (2014).
  52. Potapov, V., et al. Comprehensive profiling of four base overhang ligation fidelity by T4 DNA ligase and application to DNA assembly. ACS Synthetic Biology. 7, (11), 2665-2674 (2018).
  53. Ravindran, C. R. M., Suguna, S., Shanmugasundaram, S. Electroporation as a tool to transfer the plasmid pRL489 in Oscillatoria MKU 277. Journal of Microbiological Methods. 66, 174-176 (2006).
  54. Stevenson, K., McVey, A. F., Clark, I. B. N., Swain, P. S., Pilizota, T. General calibration of microbial growth in microplate readers. Scientific Reports. 6, 38828 (2016).
  55. Maecker, H. T., Trotter, J. Flow cytometry controls, instrument setup, and the determination of positivity. Cytometry Part A. 69, (9), 1037-1042 (2006).
Modificação genética de cianobactérias por conjugação usando o kit de ferramentas de clonagem modular CyanoGate
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Gale, G. A. R., Schiavon Osorio, A. A., Puzorjov, A., Wang, B., McCormick, A. J. Genetic Modification of Cyanobacteria by Conjugation Using the CyanoGate Modular Cloning Toolkit. J. Vis. Exp. (152), e60451, doi:10.3791/60451 (2019).More

Gale, G. A. R., Schiavon Osorio, A. A., Puzorjov, A., Wang, B., McCormick, A. J. Genetic Modification of Cyanobacteria by Conjugation Using the CyanoGate Modular Cloning Toolkit. J. Vis. Exp. (152), e60451, doi:10.3791/60451 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter