Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Генетическая модификация цианобактерий путем конъюгации с помощью цианогейтмодульного клонирования Toolkit

doi: 10.3791/60451 Published: October 31, 2019
* These authors contributed equally

Summary

Здесь мы представляем протокол, описывающий, как i) собрать самовоспроизводящий вектор с помощью модульного инструментария клонирования CyanoGate, ii) ввести вектор в цианобактериальный хост путем спряжения, и iii) характеризуют трансгенные штаммы цианобактерий с помощью плита читателя или потока цитометрии.

Abstract

Цианобактерии представляют собой разнообразную группу прокариотических фотосинтетических организмов, которые могут быть генетически модифицированы для возобновляемого производства полезных промышленных товаров. Последние достижения в области синтетической биологии привели к разработке нескольких наборов инструментов клонирования, таких как CyanoGate, стандартизированная модульная система клонирования для построения векторов плазмида для последующей трансформации или супружеской передачи в цианобактерии. Здесь мы намечаем детальный метод для сборки самовоспроизводящегося вектора (например, проведение флуоресцентной маркерной экспрессии) и супружеской передачи вектора в цианобактериальные штаммы Synechocystis sp. PCC 6803 или Synechococcus эллонгат UTEX 2973. Кроме того, мы описываем, как охарактеризовать производительность генетической части (например, промоутер) с помощью считывателя пластин или цитометрии потока.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Цианобактерии являются аутотрофными бактериями, которые могут быть использованы для биосинтеза широкого спектра природных и гетерологических продуктов высокой стоимости метаболических1,2,3,4,5 6. Несколько препятствий еще предстоит преодолеть, чтобы расширить свою коммерческую жизнеспособность, прежде всего, относительно низкие урожаи по сравнению с гетеротрофной био-платформ (например, Escherichia coli и дрожжей)7. Недавнее расширение доступных инструментов генной инженерии и поглощение парадигмы синтетической биологии в цианобактериальных исследованиях помогает преодолеть такие проблемы и дальнейшее развитие цианобактерий как эффективных биофабрик8, 9,10.

Основными подходами к внедрению ДНК в цианобактерии являются трансформация, спряжение и электропорация. Переносчики, передаваемые к цианобактериям путем трансформации или электропорации, являются «самоубийственные» векторами (т.е. интегративными векторами, способствующих гомологичной рекомбинации), в то время как самовоспроизводящиеся векторы могут быть перенесены на цианобактерии трансформация, спряжение или электропорация. Для первого, протокол доступен для инженерных видов модели поддаются естественной трансформации11. Совсем недавно был разработан модульный набор инструментов для клонирования (MoClo) для цианобактерий под названием CyanoGate, который использует стандартизированный метод векторной сборки Золотых ворот для проектирования с использованием естественной трансформации, электропорации или спряжения12.

Технологии сборки типа «Золотые ворота» становятся все более популярными в последние годы, а стандарты сборки и библиотеки частей теперь доступны для различных организмов13,14,15,16 ,17. Золотые ворота использует ферменты ограничения IIS типа (например, BsaI, BpiI, BsmBI, Btg'i и AarI) и костюм приемников и уникальные свесы для облегчения направленной иерархической сборки нескольких последовательностей в реакции сборки «одного горшка». Ферменты ограничения типа IIS распознают уникальную асимметричную последовательность и вырезают определенное расстояние от их сайтов распознавания, чтобы создать пошатнувшееся, «липкий конец» разреза (обычно 4 нуклеотида (nt) свеса), которые могут быть впоследствии использованы для привода упорядоченной ДНК сборки реакции15,18. Это способствовало развитию больших библиотек модульных частей уровня 0 (например, промоутеров, открытых кадров для чтения и терминаторов), определяемых общим синтаксисом, таким как стандарт PhytoBricks19. Части уровня 0 могут быть легко собраны в кассеты выражения уровня 1, после чего более сложные сборки более высокого порядка (например, многогенные конструкции выражения) могут быть построены в векторе принятия выбора12,15. Ключевым преимуществом методов сборки типа Golden Gate является их удобство автоматизации на высокопроизводительных объектах, таких как ДНК-литейные заводы20,21, которые могут позволить для тестирования сложных экспериментальных конструкций, которые не может быть легко достигнуто с помощью ручного труда.

CyanoGate строится на установленной системе Завода MoClo12,15. Для включения новой части в CyanoGate, часть последовательности должны быть сначала одомашнены, т.е. "незаконные" признания сайтов для BsaI и BpiI должны быть удалены. В случае кодирования детали для открытого кадра чтения (т.е. последовательности кодирования, CDS) сайты распознавания могут быть нарушены путем генерации синонимных мутаций в последовательности (т.е. изменение кодона на альтернативу, которая кодирует тот же остатками аминокислоты). Это может быть достигнуто с помощью различных подходов, начиная от синтеза ДНК полимеразы цепной реакции (PCR) усиления на основе стратегий, таких как Гибсон сборки22. В зависимости от используемого принимающего выражения следует позаботиться о том, чтобы избежать введения редких кодонов, которые могут препятствовать эффективности перевода23. Удаление сайтов распознавания в последовательности промоутера и терминатора, как правило, более рискованное усилие, так как изменения могут повлиять на функцию и часть может не выполнять, как ожидалось. Например, изменения в местах связывания фактора транскрипции или ribosome связывающий сайт внутри промоутера могут изменить силу и отзывчивость к индукции/репрессии. Аналогичным образом, изменения в ключевых структурных характеристиках терминатора (например, богатый стебель GC, петля и поли-U хвост) могут изменить эффективность прекращения и эффект экспрессии гена24,25. Хотя несколько интернет-ресурсов доступны для прогнозирования активности промотора и последовательности терминаторов, и сообщить, повлияет ли предлагаемая мутация на производительность26,27, эти инструменты часто являются плохими предикторами производительность у цианобактерий28,29,30.. Таким образом, in vivo характеристика модифицированных частей по-прежнему рекомендуется для подтверждения активности. Для оказания помощи в клонировании непокорных последовательностей, CyanoGate включает в себя низкий вектор клонирования копий на основе векторного bioBrick pSB4K512,16,31. Кроме того, портал "Дизайн и сборка" доступен через Эдинбургский геном литейный завод, чтобы помочь с векторным дизайном (dab.genomefoundry.org). Наконец, и самое главное, CyanoGate включает в себя два векторных конструкций приемного уровня T (эквивалент вектору приемного уровня 2)15 для введения ДНК в цианобактерии с использованием векторов самоубийств, или широких векторов диапазона, способных к самовоспроизводствам в нескольких видов цианобактерий32,33,34.

Здесь мы сосредоточимся на описании протокола для генерации самовоспроизводящих векторов уровня T и генетической модификации Synechocystis PCC 6803 и Synechococcus elongatus UTEX 2973(Synechocystis PCC 6803 и S. elongatus UTEX 2973 в дальнейшем) путем спряжения (также известный как три-родительских спаривания). Супружеская передача ДНК между бактериальными клетками является хорошо описанным процессом и ранее использовалась для инженерных цианобактериальных видов, в частности тех, которые не являются естественными компетентными, такими как S. elongatus UTEX 297335, 36,37,38,39,40,41. Короче говоря, цианобактериальные культуры инкубируются штаммом кишечной палочки, несущим переносчик ("грузовой" вектор) и векторами (либо в том же штамме кишечной палочки, либо в дополнительных штаммах), чтобы обеспечить спряжение ("мобилизатор" и векторы «помощника»). Для супружеской передачи требуется четыре ключевых условия: 1) прямой контакт между клетками, участвующими в передаче ДНК, 2) вектор груза должен быть совместим с системой спряжения (т.е. он должен содержать подходящее происхождение передачи(oriT), также известный как бом (основа мобильности) сайт), 3) ДНК nicking белка (например, кодируется моб гена), что ники ДНК на oriT инициировать одноцепочечную передачу ДНК в цианобактерий должны присутствовать и выражается от грузового или помощника векторов, и 4) переданная ДНК не должна быть уничтожена в цианобактериях цианобактерия (т.е. должна быть устойчива к деградации, например, ограничивая эндонуклеазией деятельности)35,42. Для того чтобы грузовой вектор сохранялся, происхождение репликации должно быть совместимо с цианобактерией получателя, чтобы обеспечить самовоспроизводство и распространение в дочерних ячеек после деления. Для помощи с условиями 3 и 4, несколько векторов помощника доступны через Addgene и другие коммерческие источники, которые кодируют для толпы, а также несколько метилаз, чтобы защитить от родной эндонуклизии в принимающей цианобактерий43. В этом протоколе спряжению способствовали штамм MC1061 E. coli, несущий мобилизатор и помощник векторов pRK24 (www.addgeneorg/51950) и pRL528 (www.addgene.org/58495), соответственно. Необходимо проявлять осторожность при выборе векторов, которые будут использоваться для супружеской передачи. Например, в комплекте CyanoGate самовоспроизводящий грузовой вектор pPM-AK1-T кодирует белок Mob12. Тем не менее, pSEVA421-T не44, и как таковой, толпа должна быть выражена из подходящего вектора помощника. Используемые векторы также должны соответствовать организму-мишеням. Например, эффективный супружеский перевод в Anabaena sp. PCC 7120 требует вектора помощника, который защищает вектор мобилизации от пищеварения (например, pRL623, который кодирует для трех метилазов AvaiM, Eco47iiM и Ecot22iM)45, 46.

В этом протоколе мы далее наметить, как охарактеризовать производительность частей (т.е. промоутеров) с флуоресцентным маркером с помощью считывателя пластин или цитометра потока. Цитометры потока способны измерять флуоресценцию на основе одной клетки для большой популяции. Кроме того, цитометры потока позволяют пользователям "загонять" полученные данные и удалять фоновый шум (например, от твердых частиц в культуре или загрязнении). В отличие от этого, считывательы пластин приобретают совокупное измерение флуоресценции данного объема культуры, как правило, в нескольких репликационных скважинах. Основные преимущества считывателей пластин над цитометрами включают более низкую стоимость, более высокую доступность и, как правило, отсутствие требований к специализированного программного обеспечения для анализа данных ниже по течению. Основными недостатками считывателей пластин являются относительно более низкая чувствительность по сравнению с цитометрами и потенциальные проблемы с оптической плотностью измеренных культур. Для сравнительного анализа образцы считывания пластин должны быть нормализированы для каждой скважины (например, для измерения плотности культуры, обычно в качестве абсорбции при оптической плотности в 750 нм, что может привести к неточностям для образцов, которые являются слишком плотной и/или не очень смешанной (например, при подверженности агрегации или флоккуляции).

В качестве обзора, здесь мы демонстрируем в деталях принципы генерации частей уровня 0, а затем иерархической сборки с использованием комплекта CyanoGate и клонирования в вектор, пригодный для супружеской передачи. Затем мы демонстрируем процесс конъюгальной передачи, выбор топорных трансконъюгантных штаммов, выражающих флуоресцентный маркер, и последующее получение данных флуоресценции с помощью цитометра потока или считывателя пластин.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Векторная сборка с использованием инструментариев Plant MoClo и CyanoGate

ПРИМЕЧАНИЕ: Прежде чем приступить к векторной сборке, настоятельно рекомендуется, чтобы пользователи ознакомились с структурами уровня переносчиков систем завода и CyanoGate MoCloсистем 12,15.

  1. Строительство частей уровня 0
    ПРИМЕЧАНИЕ: Части уровня 0 могут быть синтезированы в виде полных векторов или в виде линейных последовательностей для сборки с приемщиками уровня 0 (например, gBlocks, IDT). Кроме того, последовательности могут быть усилены из исходного шаблона (например, вектор или очищенная геномная ДНК). Здесь описано, как создать новую часть уровня 0 из усиленного продукта. Обзор процесса сборки Золотых Ворот от уровня 0 до уровня T отображается вРисунок 1.
    1. Дизайн грунтовки.
      1. Решите, какой модуль уровня 0 для сборки и определения соответствующих 5 "и 3" свесы (Таблица 1)12,15. Проверьте последовательность ДНК, чтобы клонировать на наличие biI или BsaI места ограничения.
        ПРИМЕЧАНИЕ: Последовательность, содержащая один из этих сайтов, должна быть одомашнена путем изменения одного или нескольких НТ в последовательности сайта ограничения. Стратегия для этого с помощью сборки Золотые ворота изложена на рисунке 2.
      2. Чтобы усилить последовательность ДНК, разработай соответствующую передовую и обратную грунтовую пару. Для переднего грунта выберите 18-30 bp, дополняющих 5-й конец последовательности шаблонов ДНК. Для обратной грунтовки выберите обратный 18–30 bp, дополняющие 3-й конец последовательности шаблонов ДНК.
        ПРИМЕЧАНИЕ: Праймеры с температурой плавления (Tм) от 58-62 градусов по Цельсию, как правило, дают наиболее последовательные результаты усиления(рисунок 1A).
      3. Добавьте следующее к концу 5 "форварда: 1) случайная строка из 4'6 НТ в конце 5 "в конце сайта BpiI, 2) biI ограничение сайта (GAAGAC), 3) два случайных NTs, и 4) 5 "свес выбран в шаге 1.1.1.1. Добавьте следующее к концу 5 "обратной грунтовки: 1) случайная строка 4'6 NTs в 5 "конец сайта BpiI, 2) bpiI ограничение сайта (GAAGAC), 3) два случайных NTs, и 4) 3 "свес выбран в шаге 1.1.1.1. При завершении работы закажите пары грунтовки.
        ПРИМЕЧАНИЕ: См Рисунок 1А на примере вперед и обратной пары грунтовки.
    2. Усиль последовательность ДНК из геномной ДНК.
      1. Извлекайте геномную ДНК, описанную в разделе 5. Усиливать продукты ПЦР с помощью полимеразы высокой точности ДНК(Таблица материалов).
        ПРИМЕЧАНИЕ: В качестве примера, настроить ПЦР реакции (20-50 л) в соответствии с инструкциями производителя. Используйте 100 нг геномной ДНК на одну реакцию. Используйте термическую программу велоспорта, состоящую из первоначального шага денатурации 98 градусов по Цельсию на 30 с, а затем не более 25 циклов денатурации при 98 градусах по Цельсию на 10 с, грунтовка при 58 градусах По кв. м и расширение продукта при 72 градусах по Цельсию на 30 с (изменение последнего в зависимости от размер продукта/типа используемой ДНК-полимераза), а затем заключительный этап расширения 72 градусов по Цельсию в течение 2 мин.
      2. Если продукт ПЦР должен быть очищен гелем, запустите всю реакцию ПЦР на гель агарозы, как описано в разделе 6. Вырежьте полосу интереса из геля агарозы и очистить его с помощью комплекта извлечения геля(Таблица материалов).
      3. Альтернатива шагу 1.1.2.2, если продукт ПЦР должен использоваться без очистки геля, проверьте размер полосы, запустив аликот образца реакции ПЦР (5 кЛ) на геле агарозы. Если гель показывает только соответствующую полосу и никаких доказательств грунтовки димеры, очистить продукт ПЦР с помощью комплекта очистки ДНК (Таблица материалов).
      4. Elute очищенной ДНК в небольшом объеме деионизированной воды (например, 10 л), чтобы получить высокую концентрацию ДНК (Зgt;20 нг / Л, как правило, достаточно).
    3. Соберите усиленный продукт ДНК (или продукты, см. Рисунок 2)на уровне 0. Подготовьте смесь реакции на 20 л с bpiI(рисунок 1B) и назначьте программу теплового циклизатора, как описано в таблице 2. Приступить к преобразованию кишечной палочки с использованием 5 ЗЛ собранной смеси реакции уровня 0 (как описано в разделе 2).
  2. Строительство сборок уровня 1
    1. Решите, какие части уровня 0 собрать(Рисунок 1C и таблица 1). Выберите подходящий вектор приемного уровня1 15.
      ПРИМЕЧАНИЕ: На данном этапе важно знать, что окончательный вектор дизайн будет в уровне T, так как это повлияет на выбор уровня 1 вектора приемного. Вектора приемного приема уровня 1 (Forward) (pICH47732) может быть использована по умолчанию, если цель состоит в том, чтобы иметь одну сборку уровня 1 (например, кассету экспрессии гена) в уровне T. Однако, если две или более сборки уровня 1 должны быть собраны в уровне T, необходимо учитывать положение и направление каждой сборки уровня 1. До семи сборок уровня 1 можно собрать в векторе приемного уровня T, используя вектор приемов уровня 1 с соответствующими позициями12.
    2. Соберите части уровня 0 на уровне 1. Подготовьте смесь реакции на 20 л с BsaI и навядийте программу теплового циклизатора, как описано в таблице 2. Приступить к преобразованию кишечной палочки с использованием 5 ЗЛ собранной смеси реакции уровня 1 (как описано в разделе 2).
  3. Строительство сборок уровня T
    1. Решите, какие сборки уровня 1 собрать(Рисунок 1D). Выберите подходящий вектор приема уровня T.
      ПРИМЕЧАНИЕ: pUC19A-T (устойчивость ампициллин) и pUC19S-T (устойчивость спектромицицина) являются высококопированными числом интегративных векторов, которые не способны размножаться в цианобактериях и в первую очередь используются для геномной интеграции (т.е. стук-ин или выбивания генов) через гомологичная рекомбинация12. Доставка интегративных векторов может осуществляться путем естественной трансформации в поддающихся цианобактериальных видах11. pPM-AK1-T - это широкий диапазон хоста, репликационный вектор, который доставляется путем супружеской передачи (раздел 3).
    2. Выберите подходящий End-Link, чтобы связать 3 "конец окончательного уровня 1 сборки на уровне Tпозвоночника 15.
      ПРИМЕЧАНИЕ: Требуется end-Link, это то же самое число, что и позиция финальной части. Например, вектор уровня Т, в основе чего входит только одна позиция 1 уровня 1 (передняя или обратная) часть, потребует end-Link 1 (pICH50872) для перевязки в магистраль уровня T.
    3. Соберите одну или несколько сборок уровня 1 в уровне T. Подготовьте смесь реакции с BpiI и требуемым вектором End-Link и навязайте программу теплового циклизатора, описанную в таблице 2. Приступить к преобразованию кишечной палочки с использованием 5 зЛ собранной смеси реакции уровня T (как описано в разделе 2).

2. Преобразование кишечной палочки и очистка вектора

  1. Преобразование кишечной палочки (день 1)
    1. Разморозить аликвот (25 л) химически компетентных клеток кишечной палочки (Таблица материалов)и аккуратно пипетку в трубку 1,5 мл на льду. Добавьте 5 qL сборочной смеси (уровень 0, 1 или T) и инкубировать трубку на льду еще 30–60 минут.
    2. Тепло-шоковые клетки путем инкубации трубки в водяной бане при температуре 42 градусов по Цельсию в течение 30 с, затем поместите трубку обратно на лед в течение 2 мин. Добавить комнатной температуры (RT) супер оптимальный бульон с катаболитом репрессии (S.O.C.) среднего (250 qL) в трубку. Инкубировать трубку при 37 градусах по Цельсию на 1 ч при 225 об/мин в трясущемся инкубаторе.
    3. Плита 40 зЛ культуры на агарную пластину LB, содержащую соответствующую окончательную концентрацию антибиотиков (100 мкг/мл для спектромицицина дигидрохлорида пентагидрата «Уровень 0», 100 мкг/мл карбенициллина динатрия «Уровень 1», или 50 мкг/мл канамицина сульфата Уровень ТЗ), 1 мМ изопропил-бета-D-thiogalactopyranoside (IPTG) и 40 мкг/мл 5-бромо-4-хлоро-3-индолил-З-Д-галактопиранозид (X-Gal) для сине-белого скрининга. Инкубировать тарелку на ночь при 37 градусах Цельсия.
      ПРИМЕЧАНИЕ: Количество культуры покрытием может быть разнообразным в зависимости от эффективности E. coli компетентных клеток и перевязочных реакций. Плита большего объема, если злт;10 колоний наблюдается после ночной инкубации.
  2. Выбор белых колоний и подготовка жидких культур (день 2)
    ПРИМЕЧАНИЕ: В зависимости от эффективности реакции сборки и последующей трансформации, LB агар пластины могут содержать никаких колоний, синих колоний или белых колоний(рисунок 3). Синие колонии свидетельствуют о векторе-приемном, которые не подверглись ограничению (т.е. функциональная копия лака все еще присутствует). Белые колонии указывают на то, что кассета с выражением лака была утеряна и заменена частью/сборкой.
    1. Дополнительно, проверить, что белые колонии содержат ожидаемый вектор, выполняя ПЦР, как описано в разделе 7.
    2. Выберите одиночные белые колонии (или пЦР проверенные колонии) с наконечником 10 Лл и перенесите в центрифугу 15 мл, содержащую среднюю среднюю LB (5 мл) и соответствующие концентрации антибиотиков (шаг 2.1.3). Инкубировать трубки при 37 градусов По Цельсию ночь при 225 об/мин в трясущихся инкубаторе.
  3. Плазмерная очистка вектор (день 3)
    1. Дополнительно, подготовить глицерол запас ночь E. coli культуры для долгосрочного криохранения переносчиков. Добавьте 500 кЛ бактериальной культуры до 500 л 50% (v/v) глицерола в соответствующей трубке 1,5-2,0 мл для криохранения при -80 градусах По цельсии. Смешайте осторожно, инвертируя 5'10x. Флэш-заморозки образцов в жидком азоте и хранить в морозильной камере -80 градусов.
    2. Спин вниз культур в 15 мл центрифуговых труб на 3000 х г в течение 5-10 мин. Отбросьте супернатант, не нарушая клеточных гранул. Очистите вектор с помощью плазмидного комплектаочистки (Таблица материалов). Очищенный вектор в 35 л деионизированной воды.
      ПРИМЕЧАНИЕ: Используйте более низкие объемы elution для дальнейшего увеличения концентрации переносчика. Один и тот же eluent можно положить через колонку очистки дважды для увеличения урожайности.
    3. Измерьте концентрацию переносчика в элевательном с помощью спектрофотометра(Таблица материалов).
      ПРИМЕЧАНИЕ: Высокие векторы числа копий в E. coli,такие как pUC19, обычно дают урожайность 50-300 нг/Л. Низкий векторы копирования, такие как pPM-AK1-T, обычно дают урожайность 15-60 нг/Зл.
  4. Векторная проверка
    ПРИМЕЧАНИЕ: Векторы могут быть проверены путем ограничения пищеварения (шаг 2.4.1) и/или секвенирования (шаг 2.4.2).
    1. Ограничьте 0,5-1 мкг вектора соответствующим ферментом ограничения (ы) и проверьте ожидаемые размеры полосы, как описано в разделе 6(рисунок 4).
      ПРИМЕЧАНИЕ: Неправильные размеры полосы обычно указывают на ошибочную сборку, и в этом случае можно просеивать больше белых колоний или повторять сборку. BsaI и BpiI могут быть использованы для проверки правильного размера вставки для сборок уровня 0 и уровня 1, соответственно. BsaI или BpiI можно использовать в сочетании с дополнительным, совместимым ферментом ограничения, который режет в вставке и/или векторный позвоночник для получения отдельного набора хорошо разделенных полос после пищеварения.
    2. Последовательность вектор секвенирования Сэнгер с помощью соответствующего грунтовки вверх по течению собранного региона с использованием коммерческого секвенирования объекта (Таблица 3).
      ПРИМЕЧАНИЕ: Все новые части уровня 0 должны быть секвенированы, чтобы подтвердить ожидаемую идентификацию последовательности. Последовательность проверки векторов уровня 1 и Т обычно не требуется, если они собраны из ранее секвенированных частей 0 уровня.

3. Поколение мутантов путем спряжения

ПРИМЕЧАНИЕ: Здесь описан протокол для супружеской передачи самовоспроизводящемся грузового вектора в Synechocystis PCC 6803 или S. elongatus UTEX 297311,47. Этот протокол применим к другим типовидам (например, S. elongatus PCC 7942 и Synechococcus sp. PCC 7002). Вся работа с цианобактериями (и связанными с ними буферными препаратами) должна осуществляться в стерильных условиях в ламинарном капоте потока.

  1. Рост цианобактериальной культуры (день 1)
    1. Подготовка BG11 среды в соответствии с Lea-Smith и др.11, и агар пластины с LB-BG11 и BG11-Kan50 (раздел 8).
    2. Настройка свежей культуры Synechocystis PCC 6803 или S. elongatus UTEX 2973 путем прививки 100 мл конической колбы свежей среды BG11 (50 мл) с клетками, полученными из топорной агаровой пластины BG11. Выращивайте Synechocystis PCC 6803 культур при 30 градусах По Цельсия, 100 фотонов м-2с-1 при 100 об/мин и выращивайте S. elongatus UTEX 2973 при 40 градусах Цельсия, 300 фотонов м-2s-1 при 100 об/мин. Выращивайте культуры до OD750 и 0,5-1,5 (обычно 1–2 дня).
      ПРИМЕЧАНИЕ: S. elongatus UTEX 2973 культур ы можно вырастить при 40 градусах Цельсия при высокой интенсивности света (например, 2000 фотонов м-2с-1)48.
  2. Рост штаммов помощи и груза E. coli (день 2)
    1. Прививать среднюю среду LB, содержащую ампициллин (окончательная концентрация 100 мкг/мл) и хлорамфеникол (окончательная концентрация 25 мкг/мл) с штаммом MC1061 E. coli, содержащим переносчики pRK24 и pRL528 (т.е. штамм помощника) и вырастают при 37 градусах по Цельсию при 225 об/мин в дрожащего инкубатора. Вырастите вверх достаточный объем культуры напряжения helper, предполагая 1 mL культуры необходимо per conjugation.
    2. Прививать среднюю lb (5 мл), содержащую соответствующие антибиотики с культурой кишечной палочки, перевозящих вектор груза (т.е. вектор уровня Т). Выращивайте культуру при 37 градусах Цельсия на ночь при 225 об/мин в тряся инкубаторе.
  3. Супружеская передача (три-родительский спаривание) (день 3)
    1. Подготовьте e. coli помощника и грузовых штаммов. Centrifuge помощник и груз E. coli ночных культур на 3000 х г в течение 10 минут при комнатной температуре. Откажитесь от супернатанта, не нарушая клеточные гранулы.
    2. Вымойте гранулы, добавив свежий средний LB без антибиотиков. Используйте тот же объем, что и начальная культура. Resuspend гранулы, мягко pipetting вверх и вниз. Не вихрь культуры. Повторите этот шаг 3x, чтобы удалить остаточные антибиотики из ночной культуры.
    3. Центрифуге переподвески культуры (как в шаге 3.3.1), отбросить супернатант и resuspend в два раза объем LB среды первоначального объема культуры (например, 2,5 мл, если ночная культура была 5 мл). Смешайте 450 л сосевого штамма с 450 л грузо-нагрузки в трубке 2 мл и отложите (оставьте на РТ) до 3,3,6 шага.
    4. Подготовьте цианобактериальную культуру. Для каждой реакции спряжения используйте 1 мл цианобактериальной культуры (OD750 и 0,5-1,5).
    5. Centrifuge необходимый общий объем цианобактериальной культуры на 1500 х г в течение 10 минут на RT, а затем отбросить супернатант тщательно, не нарушая клеточной гранулы. Вымойте гранулы, добавив свежий BG11 среды того же первоначального объема. Resuspend гранулы, мягко pipetting вверх и вниз, не вихрь культуры. Повторите этот шаг 3x и установить мыть культуры в сторону.
    6. Добавьте аликот промытой цианобактериальной культуры (900 л) к комбинированным штаммам кишечной палочки (помощник и груз) (900 л) в трубке объемом 2 мл. Смешайте культуры, мягко пипетки вверх и вниз. Не вихрь. Инкубировать смесь на RT в течение 30 мин для Synechocystis PCC 6803 или 2 ч для S. elongatus UTEX 2973.
    7. Центрифуга смесь на 1500 х г в течение 10 мин на RT. Удалить 1,6 мл супернатанта. Отрежь гранулу в оставшихся 200 евро супернатанта. Поместите один мембранный фильтр 0,45 мкм на агарную пластину LB-BG11, в ней нет антибиотиков (раздел 8). Тщательно распределите 200 л e. coli/cyanobacterialсмесь культуры на мембране с стерильным распределителей или стерильным согнутым кончиком и загерметизируйте пластину парафинаю пленкой.
    8. Инкубировать пластину LB-BG11 с мембраной на 24 ч. Поддерживать мембраны с Synechocystis PCC 6803 культур при 30 градусах Цельсия, 100 фотонов м-2s-1. Поддержание мембран с S. elongatus UTEX 2973 культур при 40 градусах По Цельсия в 150 фотонов м-2s -1.
  4. Передача мембраны
    1. После 24 ч тщательно перенесите мембрану с помощью стерилизованных щипцы BG11 на свежую агарную пластину BG11, содержащую соответствующие антибиотики (раздел 8), чтобы выбрать для грузового вектора. Запечатать тарелку парафиновой пленкой.
    2. Инкубировать пластину BG11 агара при соответствующих условиях роста, как описано выше для Synechocystis PCC 6803 или S. elongatus UTEX 2973, пока не появятся колонии.
      ПРИМЕЧАНИЕ: Колонии обычно появляются после 7-14 дней для Synechocystis PCC 6803 и 3-7 дней для S. elongatus UTEX 2973.
  5. Выбор конъюгантов
    ПРИМЕЧАНИЕ: Только цианобактериальные колонии, несущие грузовой вектор, смогут расти на мембране(рисунок 5).
    1. Используя тепловую стерильную петлю, выберите по крайней мере две отдельные колонии из мембраны и полосой на новую агарную пластину BG11, содержащую соответствующие антибиотики(рисунок 5C).
      ПРИМЕЧАНИЕ: Свежеполосые колонии все еще могут быть загрязнены кишечной палочкой, перенесенной из спряжения (т.е. если маленькие белые колонии видны на тарелке), так что два или три дополнительных раунда повторного полосирования на свежие пластины агара BG11, как правило, необходимо получить топоровую цианобактериальную культуру.
    2. Подтвердите отсутствие загрязнения кишечной палочкой, прививая полосу цианобактериальной культуры в центрифугу 15 мл, содержащую 5 мл среды LB и инкубируя при 37 градусах Цельсия на ночь при 225 об/мин в дрожащий инкубатор. После достаточного периода роста (7 дней) выберите отдельные опорные колонии для создания жидких культур для длительного криохранилища или последующего экспериментирования.
  6. Криохранилище цианобактериальных штаммов
    1. Выращивайте цианобактериальную жидкую культуру в BG11 (как описано в разделе 3.1) до OD750 и 1,5-3,0. Центрифуга 10 мл культуры в течение 10 минут при 1500 х г,удалить супернатант и resuspend клеток в 5 мл свежей среде BG11.
    2. Добавьте 3,5 мл автоклава стерилизованного 50% (v/v) глицерола для окончательной концентрации глицерола в размере 20% (v/v)49. Этот подход хорошо работает для Synechocystis PCC 6803. Кроме того, добавьте 5 мл фильтра стерилизованного BG11, содержащего 16% (v/v) диметилсульфид (DMSO) для окончательной концентрации DMSO в размере 8% (v/v)50. Этот подход рекомендуется для большинства штаммов, в том числе S. elongatus UTEX 2973.
      ВНИМАНИЕ: DMSO является токсичным и должны быть обработаны с соответствующей защитой.
    3. Смешайте осторожно, инвертируя 5'10x. Subaliquot 1 мл культуры в отдельные криохранилище совместимы 1,5 мл винт-крышка труб (Таблица материалов). Поместите трубки в морозильную камеру -80 градусов для криохранилища. Не мигает замораживанием в жидком азоте.
      ПРИМЕЧАНИЕ: Рекомендуется по крайней мере три запаса на штамм.
    4. Для восстановления, удалить трубку из морозильной камеры -80 градусов и разморозить культуру в 35 градусов по Цельсию водяной бане во время мягкосмешивания. Добавьте оттаять культуру до 50 мл свежей среды BG11 и вырастикакзайте как жидкая культура (как описано в разделе 3.1).
      ПРИМЕЧАНИЕ: Кроме того, культура может быть полосатый и выращенный на свежем BG11 агар пластины. Трансгенные культуры, несущие маркеры отбора, должны быть возрождены сначала на агарных пластинах BG11 без антибиотиков, а затем перебрасываются на агарные пластины BG11 с соответствующими антибиотиками.

4. Характеристика промоутера

ПРИМЕЧАНИЕ: Здесь стандартный подход описан для анализа силы промоутер части путем измерения уровня экспрессии флуоресцентного маркера (eYFP) после 72 ч период роста с использованием либо пластины читателя или потока цитометра12.

  1. Рост культуры
    1. Настройка семенных культур путем прививки 10 мл BG11 среды, содержащей соответствующие антибиотики с одной колонией трансгенного цианобактериального штамма, несущего флуоресцентный маркер экспресс-кассеты. Также подготовьте культуры семян для соответствующих отрицательных штаммов контроля (например, штамм дикого типа и/или трансгенный штамм, несущий тот же векторный костяк, но не обладающий флуоресцентным маркером экспресс-кассеты).
      ПРИМЕЧАНИЕ: Рекомендуется по крайней мере четыре биологических репликации.
    2. Выращивайте семенные культуры в течение 48 ч или до OD750 и 1,5 в условиях роста, подходящих для штамма видов.
    3. Чтобы отслеживать выражение промоутера с течением времени, сначала измерьте OD750 каждой культуры семян. Рассчитайте требования к разбавлению, чтобы довести каждую культуру до стартового OD750 и 0,2. Настройка разбавленных образцов экспериментальной культуры (2 мл общего объема) в плоской нижней 24-колодскойпластине (Таблица материалов).
    4. Инкубировать тарелку в трясущегося инкубатора белыми светодиодными фонарями(Таблица Материалов)при соответствующих условиях роста. Измерьте плотность роста культуры (OD750) и усиленный желтый флуоресцентный белок (eYFP) флуоресценция с помощью либо считывателя пластин (раздел 4.2) или цитометра потока (раздел 4.3).
      ПРИМЕЧАНИЕ: Synechocystis PCC 6803 и S. elongatus UTEX 2973 культур могут быть выращены как в шаге 3.1.2. Настоятельно рекомендуется поддерживать пластину при высокой влажности (95%) во избежание испарения образцов культуры.
  2. Читатель плиты
    1. Кратко смешайте культуры в 24-хорошей пластине (шаг 4.1.4) с нежным пипеттингом. Передача подобразца каждой культуры в черную плоскую 96-колодную пластину(Таблица материалов). При необходимости разбавить (100 л конечного объема). Избегайте образования пузырьков, так как это может помешать точности измерения.
      ПРИМЕЧАНИЕ: Рекомендуется, чтобы все измерения проводились на образцах в диапазоне OD750 от 0,2 до 1,0. Поскольку плотность культур в 24 скважине будет увеличиваться с течением времени, рекомендуется следующее разбавление на основе ожидаемого увеличения стандартных условий роста: не разбавлять на 0 ч, 1:4 при 24 ч, 1:10 при 48 ч и 1:10 при 72 ч. Так, например, при 24 ч урожая 25 л культуры и смешать с 75 л bg11 среды.
    2. Включите две пустые скважины в 96-ну хорошую пластину (т.е. 100 л среды BG11). Положите 96-ну колодец в тарелку читателя(Таблица материалов). Встряхните пластину на 60 с при 500 об/мин с помощью орбитального шейкера в считывателе пластины, чтобы смешать колодцы.
      ПРИМЕЧАНИЕ: Цианобактериальные культуры могут агрегировать и / или flocculate, так что хорошее смешивание имеет решающее значение до чтения для точных измерений.
    3. Измерьте OD750 и флуоресценцию eYFP с волной возбуждения/выбросов на уровне 485 нм/520 нм.
    4. Вычесть среднее OD750 измерений двух пустых скважин из OD750 измерения каждого образца хорошо содержащие цианобактерии культуры.
    5. Нормализовать значения флуоресценции каждого образца культуры путем деления измерения флуоресценции eYFP (шаг 4.2.3) на скорректированный OD750 культуры (шаг 4.2.4). Затем вычесть среднее нормализованное значение флуоресценции eYFP (eYFP флуоресценция/OD750) биологических репликаций соответствующего отрицательного контрольного штамма трансгенных штаммов, несущих кассету выражения eYFP.
      ПРИМЕЧАНИЕ: Цианобактерии естественно флуоресцирует из-за присутствия пигментов, таких как хлорофилл и фикобилипротеины.
    6. Рост культуры участка с течением времени(рисунок 6A)и средние нормализованные значения флуоресценции eYFP каждой экспериментальной культуры в желаемые временные точки (например, 72 ч; Рисунок 6B).
  3. Цитометр потока
    1. Выберите совместимую пластину для системы обработки цитометра потока жидкости. Например, используйте кругло-нижнюю пластину 96-ну колодец(Таблица материалов)с цитометром потока(Таблица материалов),используемой в этом протоколе.
    2. Кратко смешайте культуры в 24-хорошей пластине (шаг 4.1.4) с нежным пипеттингом. Разбавлять культуры до OD750 и 0,1-0,2, чтобы избежать завалов сопла в системе обработки жидкости. Добавьте соответствующий объем образца культуры в 96-ну хорошую пластину и доведите до конечного объема 250 зл с фильтром стерилизованного 1x фосфат-буферизированного солей (PBS). Включите пустой колодец для среднего раствора на пластине, содержащей 60 зл BG11 и 190 Л 1x PBS.
      ПРИМЕЧАНИЕ: Этот том рекомендуется в случае необходимости повторного запуска образцов. Объемы, превышают 250 л, не рекомендуются, так как максимальный объем каждой скважины составляет 300 л.
    3. Как только цитометр потока будет готов к использованию, поместите 96-ну колодец с образцами культуры в станцию обработки жидкости. Настройка программного протокола для цитометра потока для сбора измерений 10 000 отдельных событий (например, ячеек). Измерьте флуоресценцию eYFP с волной возбуждения/выбросов 488 нм/515-545 нм. Сначала измерьте и проверьте показания из пустого колодца(рисунок 7А),затем запустите образцы.
    4. Ворота населения клеток цианобактерий в вперед и боковой рассеяния наборов данных, за исключением регионов, общих с пустым чтением (Рисунок 7B). Вычесть средние значения флуоресценции eYFP биологических репликации соответствующего отрицательного штамма контроля от трансгенных штаммов, несущих кассету выражения eYFP (Рисунок 7C,D). Участок среднего значения медианной флуоресценции на ячейку для каждой экспериментальной культуры в желаемые временные точки (например, 72 ч; Рисунок 7E).

5. Геномная экстракция ДНК из цианобактерий

ПРИМЕЧАНИЕ: Протокол ниже использует коммерческий комплект извлечения ДНК (Таблица материалов).

  1. Выращивайте цианобактериальную жидкую культуру в BG11 (как описано в разделе 3.1) до OD750 и 1,5-3,0. Спин вниз 10 мл культуры на 3000 х г в течение 10 минут и отбросить супернатант. Заморозить гранулы, инкубируя трубки при -20 градусов по Цельсию в течение 30 минут.
  2. Добавьте 400 кЛ буфера лизиса (буфер AP1) и 400 л раствора рибонуклеазы (RNase A) и 50% (w/v) стеклянных бусин (диаметр омичей 0,5 мм). Нарушить образцы с помощью бисомного завода(Таблица материалов) на 30 Гц (т.е., что эквивалентно 1800 колебаний / мин) в течение 6 мин.
  3. Спин образца на 17000 х г в течение 5 минут и тщательно передать супернатант в новую трубку и отказаться от гранул. Продолжить в соответствии с инструкциями производителя(Таблица материалов).

6. Электрофораз геля Агарозе

  1. Броймид этия 1% (w/v), содержащий 0,02% (v/v) бромистого этидия. Образцы нагрузки и соответствующая справка по лестнице ДНК.
  2. Выполнить образцы в течение 50 минут на 125 V. Проверьте для разделения полосы на ультрафиолетовый (УФ) трансиллюминор.
    ПРИМЕЧАНИЕ: Время работы и процент агарозного геля могут быть изменены в соответствии с ожидаемым размером полосы. Например, более высокий процент агарозного геля и более длительное время работы могут улучшить разрешение полосы и разделение продуктов ДНК.

7. Колония ПЦР

  1. Настройка смеси реакции ПЦР с использованием стандартного комплекта(Таблица материалов)и соответствующей комбинации грунтовок (например, грунтовки, которые обрамляют область сборки или специфичны для последовательностей в области сборки (таблица 3). Пипетка 10 л в трубку ПЦР.
  2. Аккуратно коснитесь верхней части одной белой колонии стерильной зубочисткой или наконечником пипетки в 10 л и привить трубку ПЦР, содержащую смесь реакции ПЦР. Позаботьтесь, чтобы отметить колонию и матч с конкретной трубки ПЦР. Аккуратно перемешать реакцию смесь для обеспечения E. coli клетки пролить в раствор.
  3. Усиливаем продукты с помощью ПЦР. Используйте программу, состоящую из первоначального шага денатурации 95 градусов по Цельсию для 60 с, 30 раундов 95 градусов по Цельсию для 15 с, 58 градусов для 15 с (несколько градусов ниже значения Тм грунтовки) , 72 КК для 30 с (30 с/кб вставки) , а затем заключительный шаг расширения 72 кК в течение 5 мин.

8. Подготовка средней и тарелки BG11

  1. Подготовка фондовых решений 100x BG11 среднего, железа (аммоний феррик цитрат), микроэлементы, фосфат (K2HPO4), Na2CO3 и TES буфера в соответствии с Lea-Smith и др.11. Автоклав фосфат и Na2CO3 запасов. Используйте 0,2 мкм фильтры для фильтрации стерилизации буфера TES (pH 8.2) и наскладовых решений NaHCO3.
  2. Подготовьте 1 L среды BG11. Смешайте 10 мл 100x BG11, 1 мл микроэлементов и 1 мл железного бульона и автоматически йодля раствор с 976 мл воды. После того, как раствор охладился до RT, добавьте 1 мл фосфатного запаса, 1 мл запасов Na2CO3 и 10 мл NaHCO3,и приспособите к рН 7,6-7,8 с 1 М Л.К.
  3. Агарные тарелки LB-BG11 (1,5% (w/v)
    1. Смешайте 700 мл деионизированной воды и 15 г агара в стеклянной колбе. Во вторую колбу добавьте 186 мл воды, 10 мл 100x BG11, 1 мл микроэлементов и 1 мл железного бульона. Autoclave обоих решений.
    2. После того, как растворы охладились примерно до 60 градусов по Цельсию, объединить их и добавить 1 мл фосфатного бульона, 1 мл Na2CO3 шт., 10 мл запасов NaHCO3 и 50 мл lb стерильной среды, которая должна дать окончательный объем 1 L. Cast Петри блюда с 25 mL агар-среды LB-BG11.
  4. Агарные тарелки BG11-Kan50 (1,5% (w/v)
    1. Смешайте 700 мл деионизированной воды и 15 г агара в стеклянной колбе. Во вторую колбу добавьте 3 г тиосульфата натрия (Na2S2O3),226 мл воды, 10 мл 100x запаса BG11, 1 мл микроэлементов и 1 мл железного бульона. Autoclave обоих решений.
    2. После того, как растворы охладились примерно до 60 градусов по Цельсию, объединить их и добавить 1 мл фосфатного бульона, 1 мл Na2CO3 запасов, 10 мл буферного запаса TES, и 10 мл запасов NaHCO3, который должен дать окончательный объем 1 Л. Добавить канамицин сульфат до конечной концентрации 50 мкг/мл и отливаем блюда Петри с 35 мл средней.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Для демонстрации рабочего процесса сборки Золотых Ворот в векторе приемки 1-го уровня (Forward) (pICH47732) была собрана экспресс-кассета, содержащая следующие части уровня 0: промоутер C-фикоцианина оперона Pcpc560 (pC0.005), последовательность кодирования для eYFP (pC0.008) и двойной терминатор TrrnB (pC0.082)12. После преобразования реакции сборки, успешные сборки были определены с помощью стандартного сине-белого скрининга колоний кишечной палочки (рисунок 3). Кассета выражения eYFP в векторе уровня 1 и вектор End-Link 1 (pICH50872) были затем собраны в вектор приемного уровня T (pPM-AK1-T), чтобы дать вектор cpcBA-eYFP(Рисунок 4A). Собранный вектор cpcBA-eYFPбыл проверен путем ограничения пищеварения(рисунок 4B).

Успешная супружеская передача cpcBA-eYFPили пустого вектора pPM-AK1-T (т.е. отрицательного контроля, не имеющего кассеты выражения eYFP) привела к росту до нескольких сотен колоний на мембране для Synechocystis PCC 6803 и S. elongatus UTEX 2973 после 7-14 дней и 3–7 дней, соответственно(рисунок 5). Отдельные колонии были собраны и полосатые на свежие пластины агара BG11-Kan50; Для создания топорных культур требовались реполосы.

Как и ожидалось для сильного Pcpc560 промоутер51, значения для нормализуенных eYFP флуоресценции от плиты читателя и eYFP флуоресценции на клетку от цитометра потока были высокими по сравнению с отрицательным контролем (Рисунок 6 и Рисунок 7). Значения флуоресценции были выше в S. elongatus UTEX 2973, чем в Synechocystis PCC 680312.

Figure 1
Рисунок 1: Обзор процесса сборки Золотых ворот в CyanoGate. Показано сборка кассеты экспрессии гена, начиная от усиления последовательности интереса от ДНК шаблона до сборки в векторе уровня Т (части не нарисованы в масштаб). (A)Дизайн передних и обратных грунтовок для усиления части CDS1 из шаблона ДНК (например, геномной или плазмидной ДНК). Места сайтов ограничения BpiI и свесы, необходимые для вставки в вектор принимает (т.е. 5 и 3 "из последовательности шаблонов) выделены красным и синим цветами соответственно. Буква "n" означает, что любой NT может быть использован в этом положении. Показаны аннеалинговые области грунтовок с шаблоном ДНК и рекомендуемыми температурами плавления (Tm). (B) Уровень 0 сборки продукта ПЦР в уровень 0 CDS1 приемовектор pICH41308. Последовательность, которая будет вырезана BpiI и ligated в вектор приемного является выделена синим цветом. (C) Уровень 1 сборки кассеты экспрессии гена, содержащей три уровня 0 частей (Pro 5U, CDS1 и 3U и Ter) в уровень 1 позиция 1 (вперед) вектор pICH47732 с использованием BsaI. (D) Сборка уровня T сборки уровня 1 и End-Link 1 (pICH50872, называется "Level M End-link 1" в Энглере и др.15) в вектор приемного уровня T (например, pPM-AK1-T) с использованием BpiI. (E) Окончательный собранный вектор уровня T. Аббревиаты: AmpR, кассета сопротивления ампициллина; КарбР, кассета сопротивления карбениколлина; CDS1, последовательность кодирования в синтаксисе уровня 0; EL1, End-Link 1 часть; КанР, кассета сопротивления канамицина; лаке, кассета выражения выражения ; SpecR, кассета сопротивления спектромицина. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 2
Рисунок 2: Стратегия одомашнивания на основе ПЦР для удаления незаконного типа сайта ограничения IIS. (A) Схема, показывающая две грунтовые пары (зеленым и оранжевым, соответственно) для изменения сайта BpiI (GAAGAC) в GAGGAC в последовательности ДНК кодирования белка, предназначенной для сборки в вектор приемного регистратора УРОВНЯ CDS1 0 (pICH41308). Обратите внимание, что модификация сохраняет кодон для глутаминовой кислоты (Glu) (т.е. GAA к GAG). Хотя сайт BpiI показан в кадре с стартовым кодоном, этот подход будет работать, даже если сайт не находится в кадре (т.е. до тех пор, пока сайт нарушается, и последовательность белка сохраняется). Места расположения сайтов ограничения BpiI и свесы в грунтовках выделены красным и синим цветами соответственно. Шаблон ДНК и переведенная белковая последовательность выделены желтым цветом. Показаны аннеалинговые области грунтовок с шаблоном ДНК и рекомендуемыми температурами плавления (Tm). Оранжевая пара используется для усиления 5 "конец последовательности с свесами AATG и TGAA (фрагмент 1), в то время как зеленая пара используется для усиления 3 "конец с свесами TGAA и GCTT (фрагмент 2). Перед заказом грунтовки, верность TGAA синтеза свес для Фрагмент 1 и 2 был тщательно проверен52. Плохо спроектированные свесы синтеза могут привести к отказу сборки (т.е. отсутствие колоний после преобразования; Рисунок 5) или ложные срабатывания (например, усеченные или ошибочные сборки). Последнее может быть решена для проверки большего числа белых колоний для определения правильно собранной конструкции. (B) Ампликоны фрагментов 1 и 2 после ограничения с BpiI во время сборки Золотые ворота. (C) Одомашненая последовательность собрана в вектор приемного учитываются уровень 0 CDS1. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 3
Рисунок 3: Сине-белая колония скрининг E. coli трансформаторов после сборки Золотые ворота. Пластины, показанные содержат агар LB (1% «w/v»), дополненный X-Gal, IPTG и антибиотиками в соответствующих концентрациях. (A) Нет колоний, предполагая неудавшуюся реакцию сборки и / или E. coli трансформации. (B) В основном синие колонии, что свидетельствует об успешной сборке, но что эффективность фермента ограничения, используемого в реакции сборки была низкой. (C) В основном белые колонии, что свидетельствует о типичной, успешной реакции сборки. (D) Нет синих колоний, что указывает на очень эффективную сборку. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 4
Рисунок 4: Проверка собранного вектора уровня Т путем ограничения пищеварения. Векторы были переварены с HindIII и BamHI. (A) Последовательность карта пустого вектора pPM-AK1-T (CT.0) и сборки уровня T(cpcBA-eYFP) с указанием компонентов кассеты выражения eYFP (Pcpc560-eYFP-TrrnB). Указаны позиции мест ограничения для Хиндии и Бамхи. После двойного пищеварения, прогнозируемые размеры фрагментов ДНК указаны: (1) 5,847 bp, (2) 2,004 bp, (3) 30 bp, (4) 374 bp, (5) 1,820 bp, (6) 1,289 bp, and (7) 156 bp. (B) Agarose gel (0.8% sw/v) run at 125 V for 60 min loaded with the digest Level T сборка(cpcBA-eYFP) с указанием полос 1, 5 и 6, переваренный пустой вектор pPM-AK1-T (CT.0), показывающий диапазоны 1 и 2 и ДНК-лестница(Таблица Материалов). Обратите внимание, что полосы 3, 4 и 7 были слишком малы, чтобы визуализировать на гель. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 5
Рисунок 5: Рост трансгенных колоний Synechocystis PCC 6803 после успешного спряжения. Приведены примеры мембран после инкубации на агарных пластинах BG11-Kan50. (A) Разрастание после очень эффективного спряжения-Synechocystis PCC 6803 колонии превратились в газон без отдельных колоний. (B) Хорошая эффективность спряжения, показывающая несколько сотен отдельных колоний после 12 дней. (C) Рост топорного штамма после 14 дней после нескольких раундов повторного полосна на свежий BG11'Kan50 агар пластины. Отсутствие бактериального загрязнения указывает на то, что transconjugant Synechocystis PCC 6803 был топором. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 6
Рисунок 6: Репрезентативные данные роста и нормализованные значения флуоресценции eYFP с помощью считывателя пластин. (A) Сравнение роста штаммов, несущих cpcBA-eYFPили пустой вектор pPM-AK1-T (CT.0, отрицательный контроль) в Synechocystis PCC 6803 и S. elongatus UTEX 2973. Значения являются средствами sE от четырех биологических репликатов. Синехоцист PCC 6803 и S. elongatus UTEX 2973 были культивированы для 72 ч при 30 градусах Цельсия с непрерывным светом (100 фотонов м-1) и 40 градусов по Цельсию с 300 фотонами м-2s-1, соответственно. (B) Нормализованные значения флуоресценции eYFP для Synechocystis PCC 6803 или S. elongatus UTEX 2973, спрягаемые с cpcBA-eYFP на уровне 72 ч. Значения являются средствами SE от четырех биологических репликаций. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 7
Рисунок 7: Значения флуоресценции представителя eYFP с использованием цитометра потока. (A)Вперед (FSC-H) и боковой (SSC-H) рассеяние участка от "пустого" среднего решения (BG11 и PBS). (B) Рассеянный участок для образца Synechocystis PCC 6803 (справа). Круг указывает на выбранную область, которая вывозит популяцию цианобактерий из оставшейся части сигнала образца. (C) Гистограмма закрытой области для штамма, несущего пустой вектор pPM-AK1-T (CT.0, отрицательный контроль). (D) Гистограмма закрытого региона для штамма, несущего cpcBA-eYFP. (E)значения флуоресценции eYFP на одну ячейку в Synechocystis PCC 6803 и S. elongatus UTEX 2973 при 72 ч. Флуоресценция из отрицательного контроля была вычтена. Значения являются средствами sE от четырех биологических репликатов. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Нет. Идентификатор векторного Имя Описание 5' свес 3' свес
1 pICH41233 Pro Промоутер GGAG Такт
2 pICH41295 Про 5U Промоутер и 5-й непереведенный регион GGAG ААТГ
3 pAGM1251 Pro 5U (f) Промоутер и 5-х непереведенная последовательность для синтезов N терминалов GGAG CCAT
4 pICH41246 5U 5 "непереведенный регион Такт CCAT
5 pAGM1263 5U (f) 5 "непереведенная последовательность для N терминала слияний Такт CCAT
6 pICH41246 5U и NT1 5 -е непереведенный регион и N терминальный кодирование региона Такт CCAT
7 pAGM1276 NT1 N терминал тегов или сигнал акселерации CCAT ААТГ
8 pICH41258 Sp Сигнальный пептид ААТГ АГГГТ
9 pICH41258 NT2 N терминал тегов или сигнал акселерации ААТГ АГГГТ
10 pAGM1287 CDS1 нс Регион кодирования без остановки кодон ААТГ TTCG
11 pICH41308 Остановка CDS1 Регион кодирования с стоп-кодоном ААТГ GCTT
12 pAGM1299 CDS2 нс Регион кодирования - без старта и остановки кодон АГГГТ TTCG
13 pICH41264 Остановка CDS2 Регион кодирования - без старта и с стоп-кодоном АГГГТ GCTT
14 pAGM1301 Ct C-терминал тегов или сигнал локализации TTCG GCTT
15 pICH53388 3u 3 "непереведенный регион GCTT GGTA
16 pICH53399 Тер Терминатор GGTA CGCT
17 pICH41276 3U и Тер 3 "непереведенный регион и терминатор GCTT CGCT
18 pICH41331 Cgm Прием для полных генных кассет GGAG CGCT
19 pCA0.002 Pro (низкая копия) Промоутер, низкий прием копий (pSC101 ori) GGAG Такт
20 pCA0.001 Pro TSS Промоутер усечен к сайту старта транскрипции GGAG TAGC
21 Прямо на уровень 1 srRNA Малая регулятивная РНК (для трансляционного глушиния) TAGC GTTT
22 Прямо на уровень 1 sgRNA Однонаправная РНК (для CRISPRi) TAGC GTTT
23 pICH41295 ВВЕРХ ПО ФЛАНГУ Фланкинг последовательность вверх по течению цели гомологичные рекомбинации сайта GGAG ААТГ
24 pICH41276 ВНИЗ ПО ФЛАНГУ Фланкинг последовательность вниз по течению целевой гомологичные рекомбинации сайта GCTT CGCT

Таблица 1: Список доступных векторов и свесов уровня 0. Векторы 1-18 из комплекта Завода MoClo15. Векторы 19–22 — из комплекта CyanoGate12. Для частей srRNA и sgRNA синтезированные последовательности или продукты ПЦР собираются непосредственно в вектор евокатора уровня 1. Векторы 23–24 — из комплекта Plant MoClo, которые были перепрофилированы для преобразования с помощью гомологичной рекомбинации с помощью комплекта CyanoGate.

Компоненты сборки BpiI (уровень 0, T) Компоненты сборки BsaI (уровень 1)
50-100 нг вектора принятия 50-100 нг вектора принятия
Для каждого вектора/части для вставки используйте соотношение вставки 2:1: вектор принимает. Для каждого вектора/части для вставки используйте соотношение вставки 2:1: вектор принимает.
2 Л 10 мМ АТП(Таблица материалов) 2 Л 10 мМ АТП(Таблица материалов)
2 буфера G (буфер для BpiI/BsaI) 2 буфера G (буфер для BpiI/BsaI)
2 Л BSA (10x)(Таблица материалов) 2 Л BSA (10x)(Таблица материалов)
10 единиц BpiI (1 l10 U / L BpiI, Таблица материалов) 10 единиц BsaI (1 Л. 10 U / L BsaI, Таблица материалов)
Доведите до 20 л с dH2O. Доведите до 20 л с dH2O.
200 единиц T4 ДНК лигаза (1 Л 200 U / Л, Таблица материалов) 200 единиц T4 ДНК лигаза (1 Л 200 U / Л, Таблица материалов)
Протокол термоциклоза (уровень 0, T) Протокол термоциклоза (уровень 1)
37 кв. c в течение 10 мин цикл x 5 37 кв. c в течение 10 мин цикл x 5
16 кв. м в течение 10 мин 16 кв. м в течение 10 мин
37 кк с течением 20 мин 37 кк с течением 20 мин
65 кк в течение 10 мин 65 кк в течение 10 мин
16 кК (держать) 16 кК (держать)

Таблица 2: Протоколы для сборок Золотых ворот в уровнях 0, 1 и T. Сборка в уровне 0 и векторе принимает сятворщика уровня T использует фермент ограничения BpiI (слева). Сборка в векторах 1 уровня использует фермент ограничения BsaI (справа). Эта таблица была адаптирована из Vasudevan и др.12.

Номер праймера Последовательность (5'-3') Длина (bp) Описание
L0T вперед ГТККККАТГАГАГАТАКАТААТААТА
ТТГГААТГ
28 Для усиления с уровня 0 и уровня T
L1 обратный ГААКККТГТГТГТГККК
ACATAC
26 Для усиления с уровня 1
L1 вперед CTGGTGGCAGGATATATGTGT
GGTG
24 Для усиления с уровня 1
L0T обратный TTGAGTGAGCTGATACCGCT 20 Для усиления с уровня 0 и уровня T

Таблица 3: Список праймеров для проверки ПЦР или секвенирования векторов уровня 0, 1 и T.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Сборка Золотых ворот имеет ряд преимуществ по сравнению с другими методами векторной сборки, особенно с точки зрения масштабируемости20,21. Тем не менее, настройка системы «Золотые ворота» в лаборатории требует времени для того, чтобы ознакомиться с различными частями и векторными библиотеками и общими процессами сборки. Тщательное планирование часто необходимо для более сложных сборок или при параллельном выполнении большого количества сложных сборок (например, создание набора векторов уровня Т, содержащих несколько кассет экспрессии генов). Мы рекомендуем сначала перечислить все требуемые комбинации экспрессии генов, а затем отображение рабочего процесса с уровня 0 на уровень Т в силико. В ходе этого процесса, пользователи должны рассмотреть уровень 1 "Dummy" части, доступные в комплекте завод MoClo, которые позволяют для сборки непоследовательных векторов уровня 1 в уровне T (например, уровень 1 позиция 1 и положение 3 векторы могут быть собраны вместе с "Dummy" часть Позиция уровня 1 2), которая может уменьшить общее количество реакций сборки и шагов клонированиятребуется 15.

Синтез ДНК, как правило, самый простой метод для создания новых частей уровня 0. Однако, когда клонирование требуется (например, из плазмиды или геномной ДНК), оптимизация конструкции праймеров, используемых для усиления, важна для максимизации эффективности последующей векторной сборки уровня 0. Два наиболее важных шага в дизайне грунтовки: 1) проверка того, что правильные свесы включены и находятся в соответствующей ориентации для передних и обратных грунтовок(рисунок 1 и таблица 1),и 2) гарантируя, что длина грунтовки последовательность, что anneals к шаблону достаточно долго (18-30 bp) и что значение Tm для этой последовательности (в идеале 58'62 "C) аналогично для грунтовой пары (Рисунок 1A). Если последовательность требует одомашнивания, имеется несколько стратегий. Для коротких последовательностей (например, lt;200 bp), пара длинных вперед и обратного грунтовки могут быть разработаны, в которых 3 "заканчивается anneal друг к другу (т.е. перекрытие йgt;20 bp) и образуют двойную последовательность мель после усиления. Для более длинных последовательностей, отдельные фрагменты последовательности могут быть усилены, которые удаляют незаконные места ограничения, а затем собраны с помощью подхода сборки Золотые ворота (Рисунок 2). Если эффективность сборки с продуктами ПЦР является низкой, отдельные фрагменты последовательности уровня 0 могут быть клонированы в вектор универсального приемора уровня 1 (pAGM1311), проверены, а затем собраны вместе в соответствующий вектор приемного уровня 015. Для эффективной сборки Золотых ворот рекомендуется вставка 2:1:приемное векторное молярное соотношение. Однако для сборок только 2-3 векторов (например, двух частей уровня 0 и вектор приемного уровня 1), объединение 100 нг каждого регулярно обычно приводит к успешным сборкам. Эффективность сборки, как правило, снижается по мере увеличения числа векторов на реакцию, что приводит к сокращению общего числа белых колоний после трансформации(рисунок 3).

Перед спряжением рекомендуется валидировать завершенные векторы уровня Т путем ограничения дайджеста и ПЦР. Супружеская передача ДНК является хорошо stablished метод для цианобактериальных штаммов, в том числе те, которые не являются естественнымтранскаки41,45. Важные шаги в протоколе спряжения включают в себя: 1) тщательное обращение с штаммом сослуживца Кишечной палочки после ночного роста (например, избежать вихря)35, 2) заботясь о полном удалении следов антибиотиков, используемых для роста помощника и груз E. coli штаммов, 3) соответствующий инкубационный период для смеси грузовых и помощник штаммов и цианобактерий (например, более длительный инкубационный период имеет решающее значение для S. elongatus UTEX 2973), и 4) начальный период передачи клетки смесь на мембранах в агарных пластинах LB-BG11 не хватает антибиотиков на 24 ч.

Изолированные цианобактериальные колонии должны развиваться на мембране в течение двух недель для Synechocystis PCC 6803 и S. elongatus UTEX 2973, в противном случае вполне вероятно, что спряжение не удалось. Затем можно было бы протестировать несколько изменений в протоколе, в том числе 1) с использованием цианобактериальной культуры с более высокой начальной плотностью (например, OD750 и 1,5-2); 2) увеличение инкубационного периода перед переносом на мембрану; и 3) продление первоначального инкубационного периода на мембране с 24 ч до 48 ч (т.е. дать больше времени для выражения гена устойчивости к антибиотикам на переносимый вектор). Если спряжение все еще терпит неудачу, то альтернативные методы such as электропорация смогли быть опробованы53. Подтверждение трансгенного цианобактериального штамма является топором имеет важное значение до дальнейших экспериментов. Наконец, это хорошая практика, чтобы подтвердить размер гетерологического переносчика в трансгенных цианобактериальных штаммов. Последний требует экстракции ДНК (раздел 5), преобразования в кишечную палочку и выделение (раздел 2.1) и проверки вектора (раздел 2.4).

В изложенном протоколе характеристики промоутеров используются небольшие объемы культуры (т.е. 2 мл) в качестве средства достижения высокой пропускной методики скрининга. Большие объемы могут быть использованы в зависимости от имеющихся площадей фотобиореактора, что поможет смягчить проблемы испарения культуры. Если требуется скрининг высокой пропускной способностью с небольшими объемами культуры, необходимо иметь высокую влажность в камере роста, чтобы препятствовать испарению. Испарение в ходе эксперимента по росту может отрицательно сказаться на точности и достоверности выборочных измерений. Проверьте объемы культуры во время и после эксперимента, чтобы подтвердить, сколько испарения произошло.

Для измерений считывателя пластин важно измерять культуры при низкой плотности, в идеале OD750 qlt; 1, чтобы обеспечить получение надежных и воспроизводимых данных о росте и флуоресценции. Линейное отношение между номером ячейки и OD750 наблюдается только в определенном диапазоне54. Чтобы установить этот диапазон, мы рекомендуем выполнять последовательное разбавление (например, от OD750 и 0,1'1.0) с использованием известного трансформанса, где была подтверждена флуоресценция eYFP. Прокладка абсолютной флуоресценции против нормализованной флуоресценции (eYFP флуоресценция/OD750) поможет определить линейный рабочий диапазон плотности культуры. Несколько считывателей пластин включают функцию «получить» для изменения чувствительности детектора флуоресценции. В этом случае значение выигрыша должно быть установлено на соответствующем уровне до начала эксперимента и не изменяться между различными экспериментальными запусками или данные не будут непосредственно сопоставимы.

Хотя работа различных цитометров потока будет варьироваться между производителями, важно принять пустое чтение среднего решения для облегчения идентификации и gating целевой цианобактериальной популяции от любого фонового сигнала в среде(рисунок 7A,B). После этого вычитание значения флуоресценции отрицательного контрольного образца (например, деформации дикого типа) поможет удалить отечественный автофлюоресценции(рисунок 7C,D). Параметр напряжения фотомультипликатора (PMT) в цитометре потока имеет аналогичную функцию сточки зрения считывателя пластин, т.е. увеличение или уменьшение чувствительности детектора к интенсивности сигнала флуоресценции. Как и в случае с считывателем пластин, напряжение PMT должно быть установлено на соответствующем уровне перед началом эксперимента55. После установки значение напряжения PMT должно поддерживаться между различными экспериментальными пробегами или данные не будут непосредственно сопоставимы.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторам нечего раскрывать.

Acknowledgments

Авторы признательны Сети БИОтехнологии и биологических наук PHYCONET (BBSRC) в области промышленной биотехнологии и биоэнергетики (NIBB) и Центру инноваций в области промышленной биотехнологии (IBioIC) за финансовую поддержку. GARG, AASO и AP признают финансовую поддержку программы BBSRC EASTBIO CASE PhD (грант bb/M010996/1), Consejo Nacional de Ciencia y Tecnologa (CONACYT) PhD программы, а также программы совместного обучения IBioIC-BBSRC (CTP) Соответственно. Мы благодарим Конрада Маллино (Лондонский университет Королевы Марии) и Поула Эрика Дженсена и Джули Аннемари Зита Зедлер (Копенгагенский университет) за плазмидный вектор и протокольные вклады и советы.

Materials

Name Company Catalog Number Comments
5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal) Thermo Fisher Scientific R0404 Used in 2.1.3.
Adenosine 5′-triphosphate (ATP) disodium salt Sigma-Aldrich A2383 Used in Table 2.
Agar (microbiology tested) Sigma-Aldrich A1296-500g Used in 8.3.
Agarose Bioline BIO-41026 Used in 6.
Attune NxT Flow Cytometer Thermo Fisher Scientific - Used in 4.3.1.
Bovine Serum Albumin (BSA) Sigma-Aldrich A2153 Used in Table 2.
BpiI (BbsI) Thermo Fisher Scientific ER1011 Used in Table 2.
BsaI (Eco31I) Thermo Fisher Scientific ER0291 Used in Table 2.
Carbenicillin disodium VWR International A1491.0005 Used in 2.1.3.
Corning Costar TC-Treated flat-bottom 24 well plates Sigma-Aldrich CLS3527 Used in 4.1.3.
Dimethyl Sulfoxide (DMSO) Thermo Fisher Scientific BP231-100 Used in 3.6.2.
DNeasy Plant Mini Kit Qiagen 69104 DNA extraction kit. Used in 5.
FLUOstar Omega Microplate reader BMG Labtech - Used in 4.2.2.
GeneJET Plasmid Miniprep Kit Thermo Fisher Scientific K0503 Plasmid purification kit. Used in step 2.3.2.
Glass beads (0.5 mm diameter) BioSpec Products 11079105 Used in 5.2.
Glycerol Thermo Fisher Scientific 10021083 Used in 2.3.1, 3.6.2.
Isopropyl-beta-D-thiogalactopyranoside (IPTG) Thermo Fisher Scientific 10356553 Used in 2.1.3.
Kanamycin sulphate (Gibco) Thermo Fisher Scientific 11815-024 Used in 2.1.3.
Membrane filters (0.45 μm) MF-Millipore HAWP02500 Used in 3.3.7
Microplates, 96-well, flat-bottom (Chimney Well) µCLEAR Greiner Bio-One 655096 Used in 4.2.1.
Monarch DNA Gel Extraction Kit New England Biolabs T1020S Used in 1.1.2.2.
Monarch PCR DNA Cleanup Kit New England Biolabs T1030 DNA purification kit. Used in 1.1.2.3.
Multitron Pro incubator with LEDs Infors HT - Shaking incubator with white LED lights. Used in 4.1.4.
MyTaq DNA Polymerase Bioline BIO-21108 Used in 7.1.
NanoDrop One Thermo Fisher Scientific ND-ONE-W Used in 2.3.3.
One Shot TOP10 chemically competent E. coli Thermo Fisher Scientific C404010 Used in 2.1.1.
Phosphate buffer saline (PBS) solution (10X concentrate) VWR International K813 Used in 4.3.2.
Q5High-Fidelity DNA Polymerase New England Biolabs M0491S Used in 1.1.2.1.
Quick-Load 1 kb DNA Ladder New England Biolabs N0468S Used in Figure 4.
Screw-cap tubes (1.5 ml) Starstedt 72.692.210 Used in 3.6.3
Spectinomycin dihydrochloride pentahydrate VWR International J61820.06 Used in 2.1.3.
Sterilin Clear Microtiter round-bottom 96-well plates Thermo Fisher Scientific 612U96 Used in 4.3.1.
T4 DNA ligase Thermo Fisher Scientific EL0011 Used in Table 2.
TissueLyser II Qiagen 85300 Bead mill. Used in 5.2.

DOWNLOAD MATERIALS LIST

References

  1. Luan, G., Lu, X. Tailoring cyanobacterial cell factory for improved industrial properties. Biotechnology Advances. 36, (2), 430-442 (2018).
  2. Madsen, M. A., Semerdzhiev, S., Amtmann, A., Tonon, T. Engineering mannitol biosynthesis in Escherichia coli and Synechococcus sp. PCC 7002 using a green algal fusion protein. ACS Synthetic Biology. 7, (12), 2833-2840 (2018).
  3. Menin, B., et al. Non-endogenous ketocarotenoid accumulation in engineered Synechocystis sp. PCC 6803. Physiologia Plantarum. 166, (1), 403-412 (2019).
  4. Varman, A. M., Yu, Y., You, L., Tang, Y. J. Photoautotrophic production of D-lactic acid in an engineered cyanobacterium. Microbial Cell Factories. 12, (1), 1-8 (2013).
  5. Vavitsas, K., et al. Responses of Synechocystis sp. PCC 6803 to heterologous biosynthetic pathways. Microbial Cell Factories. 16, 140 (2017).
  6. Yang, G., et al. Photosynthetic production of sunscreen shinorine using an engineered cyanobacterium. ACS Synthetic Biology. 7, (2), 664-671 (2018).
  7. Nielsen, A. Z., et al. Extending the biosynthetic repertoires of cyanobacteria and chloroplasts. Plant Journal. 87, (1), 87-102 (2016).
  8. Nielsen, J., Keasling, J. D. Engineering cellular metabolism. Cell. 164, (6), 1185-1197 (2016).
  9. Stensjö, K., Vavitsas, K., Tyystjärvi, T. Harnessing transcription for bioproduction in cyanobacteria. Physiologia Plantarum. 162, (2), 148-155 (2018).
  10. Santos-Merino, M., Singh, A. K., Ducat, D. C. New applications of synthetic biology tools for cyanobacterial metabolic engineering. Frontiers in Bioengineering and Biotechnology. 7, 1-24 (2019).
  11. Lea-Smith, D. J., Vasudevan, R., Howe, C. J. Generation of marked and markerless mutants in model cyanobacterial species. Journal of Visualized Experiments. 111, e54001 (2016).
  12. Vasudevan, R., et al. CyanoGate: A modular cloning suite for engineering cyanobacteria based on the plant MoClo syntax. Plant Physiology. 180, (1), 39-55 (2019).
  13. Andreou, A. I., Nakayama, N. Mobius assembly: A versatile golden-gate framework towards universal DNA assembly. PLoS ONE. 13, (1), 1-18 (2018).
  14. Crozet, P., et al. Birth of a Photosynthetic Chassis: A MoClo toolkit enabling synthetic biology in the microalga Chlamydomonas reinhardtii. ACS Synthetic Biology. 7, (9), 2074-2086 (2018).
  15. Engler, C., et al. A Golden Gate modular cloning toolbox for plants. ACS Synthetic Biology. 3, (11), 839-843 (2014).
  16. Moore, S. J., et al. EcoFlex: A multifunctional MoClo kit for E. coli synthetic biology. ACS Synthetic Biology. 5, (10), 1059-1069 (2016).
  17. Pollak, B., et al. Loop assembly: a simple and open system for recursive fabrication of DNA circuits. New Phytologist. 222, (1), 628-640 (2019).
  18. Werner, S., Engler, C., Weber, E., Gruetzner, R., Marillonnet, S. Fast track assembly of multigene constructs using golden gate cloning and the MoClo system. Bioengineered Bugs. 3, (1), 38-43 (2012).
  19. Patron, N. J., et al. Standards for plant synthetic biology: a common syntax for exchange of DNA parts. New Phytologist. 208, (1), 13-19 (2015).
  20. Chao, R., Mishra, S., Si, T., Zhao, H. Engineering biological systems using automated biofoundries. Metabolic Engineering. 42, 98-108 (2017).
  21. Chambers, S., Kitney, R., Freemont, P. The Foundry: the DNA synthesis and construction Foundry at Imperial College. Biochemical Society Transactions. 44, (3), 687-688 (2016).
  22. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  23. Rosano, G. L., Ceccarelli, E. A. Rare codon content affects the solubility of recombinant proteins in a codon bias-adjusted Escherichia coli strain. Microbial Cell Factories. 8, 1-9 (2009).
  24. Cambray, G., et al. Measurement and modeling of intrinsic transcription terminators. Nucleic Acids Research. 41, (9), 5139-5148 (2013).
  25. Chen, Y. J., et al. Characterization of 582 natural and synthetic terminators and quantification of their design constraints. Nature Methods. 10, (7), 659-664 (2013).
  26. Münch, R., et al. Virtual Footprint and PRODORIC: An integrative framework for regulon prediction in prokaryotes. Bioinformatics. 21, (22), 4187-4189 (2005).
  27. Salis, H. M., Mirsky, E. A., Voigt, C. A. Automated design of synthetic ribosome binding sites to control protein expression. Nature Biotechnology. 27, (10), 946-950 (2009).
  28. Englund, E., Liang, F., Lindberg, P. Evaluation of promoters and ribosome binding sites for biotechnological applications in the unicellular cyanobacterium Synechocystis sp. PCC 6803. Scientific Reports. 6, 36640 (2016).
  29. Heidorn, T., et al. Synthetic biology in cyanobacteria engineering and analyzing novel functions. Methods in Enzymology. 497, 539-579 (2011).
  30. Thiel, K., et al. Translation efficiency of heterologous proteins is significantly affected by the genetic context of RBS sequences in engineered cyanobacterium Synechocystis sp. PCC 6803. Microbial Cell Factories. 17, 34 (2018).
  31. Liu, Q., Schumacher, J., Wan, X., Lou, C., Wang, B. Orthogonality and burdens of heterologous and gate gene circuits in E. coli. ACS Synthetic Biology. 7, (2), 553-564 (2018).
  32. Ferreira, E. A., et al. Expanding the toolbox for Synechocystis sp. PCC 6803: Validation of replicative vectors and characterization of a novel set of promoters. Synthetic Biology. (August), 1-39 (2018).
  33. Liang, F., Lindblad, P. Synechocystis PCC 6803 overexpressing RuBisCO grow faster with increased photosynthesis. Metabolic Engineering Communications. 4, 29-36 (2017).
  34. Taton, A., et al. Broad-host-range vector system for synthetic biology and biotechnology in cyanobacteria. Nucleic Acids Research. 42, (17), e136 (2014).
  35. Elhai, J., Wolk, C. P. Conjugal transfer of DNA to cyanobacteria. Methods in Enzymology. 167, (1984), 747-754 (1988).
  36. Gormley, E. P., Davies, J. Transfer of plasmid RSF1010 by conjugation from Escherichia coli to Streptomyces lividans and Mycobacterium smegmatis. Journal of Bacteriology. 173, (21), 6705-6708 (1991).
  37. Huang, H. H., Camsund, D., Lindblad, P., Heidorn, T. Design and characterization of molecular tools for a synthetic biology approach towards developing cyanobacterial biotechnology. Nucleic Acids Research. 38, (8), 2577-2593 (2010).
  38. Huang, H. H., Lindblad, P. Wide-dynamic-range promoters engineered for cyanobacteria. Journal of Biological Engineering. 7, 10 (2013).
  39. Li, S., Sun, T., Xu, C., Chen, L., Zhang, W. Development and optimization of genetic toolboxes for a fast-growing cyanobacterium Synechococcus elongatus UTEX 2973. Metabolic Engineering. 48, 163-174 (2018).
  40. Pansegrau, W., Balzer, D., Kruft, V., Lurz, R., Lanka, E. In vitro assembly of relaxosomes at the transfer origin of plasmid RP4. Proceedings of the National Academy of Sciences, USA. 87, (17), 6555-6559 (1990).
  41. Song, K., Tan, X., Liang, Y., Lu, X. The potential of Synechococcus elongatus UTEX 2973 for sugar feedstock production. Applied Microbiology and Biotechnology. 100, (18), 7865-7875 (2016).
  42. Waters, V. L., Guiney, D. G. Processes at the nick region link conjugation, T-DNA transfer and rolling circle replication. Molecular Microbiology. 9, (6), 1123-1130 (1993).
  43. Elhai, J., Vepritskiy, A., Muro-Pastor, A. M., Flores, E., Wolk, C. P. Reduction of conjugal transfer efficiency by three restriction activities of Anabaena sp. strain PCC 7120. Journal of Bacteriology. 179, (6), 1998-2005 (1997).
  44. Silva-Rocha, R., et al. The Standard European Vector Architecture (SEVA): A coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research. 41, (D1), D666-D675 (2013).
  45. Mandakovic, D., et al. CyDiv, a conserved and novel filamentous cyanobacterial cell division protein involved in septum localization. Frontiers in Microbiology. 7, (FEB), 1-11 (2016).
  46. Masukawa, H., Inoue, K., Sakurai, H., Wolk, C. P., Hausinger, R. P. Site-directed mutagenesis of the Anabaena sp. strain PCC 7120 nitrogenase active site to increase photobiological hydrogen production. Applied and Environmental Microbiology. 76, (20), 6741-6750 (2010).
  47. Yu, J., et al. Synechococcus elongatus UTEX 2973, a fast growing cyanobacterial chassis for biosynthesis using light and CO2. Scientific Reports. 5, (1), 8132 (2015).
  48. Ungerer, J., Wendt, K. E., Hendry, J. I., Maranas, C. D., Pakrasi, H. B. Comparative genomics reveals the molecular determinants of rapid growth of the cyanobacterium Synechococcus elongatus UTEX 2973. Proceedings of the National Academy of Sciences, USA. 115, (50), E11761-E11770 (2018).
  49. Lepesteur, M., Martin, J. M., Fleury, A. A comparative study of different preservation methods for phytoplankton cell analysis by flow cytometry. Marine Ecology Progress Series. 93, (1-2), 55-63 (1993).
  50. Day, J. G. Cryopreservation of cyanobacteria. Cyanobacteria: An Economic perspective. Wiley Blackwell. New York. 319-327 (2014).
  51. Zhou, J., et al. Discovery of a super-strong promoter enables efficient production of heterologous proteins in cyanobacteria. Scientific Reports. 4, 4500 (2014).
  52. Potapov, V., et al. Comprehensive profiling of four base overhang ligation fidelity by T4 DNA ligase and application to DNA assembly. ACS Synthetic Biology. 7, (11), 2665-2674 (2018).
  53. Ravindran, C. R. M., Suguna, S., Shanmugasundaram, S. Electroporation as a tool to transfer the plasmid pRL489 in Oscillatoria MKU 277. Journal of Microbiological Methods. 66, 174-176 (2006).
  54. Stevenson, K., McVey, A. F., Clark, I. B. N., Swain, P. S., Pilizota, T. General calibration of microbial growth in microplate readers. Scientific Reports. 6, 38828 (2016).
  55. Maecker, H. T., Trotter, J. Flow cytometry controls, instrument setup, and the determination of positivity. Cytometry Part A. 69, (9), 1037-1042 (2006).
Генетическая модификация цианобактерий путем конъюгации с помощью цианогейтмодульного клонирования Toolkit
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Gale, G. A. R., Schiavon Osorio, A. A., Puzorjov, A., Wang, B., McCormick, A. J. Genetic Modification of Cyanobacteria by Conjugation Using the CyanoGate Modular Cloning Toolkit. J. Vis. Exp. (152), e60451, doi:10.3791/60451 (2019).More

Gale, G. A. R., Schiavon Osorio, A. A., Puzorjov, A., Wang, B., McCormick, A. J. Genetic Modification of Cyanobacteria by Conjugation Using the CyanoGate Modular Cloning Toolkit. J. Vis. Exp. (152), e60451, doi:10.3791/60451 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter