Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

CyanoGate Modüler Klonlama Araç Kiti Kullanılarak Konjugasyon ile Siyanobakterilerin Genetik Modifikasyonu

doi: 10.3791/60451 Published: October 31, 2019
* These authors contributed equally

Summary

Burada, i) CyanoGate modüler klonlama araç kiti kullanarak kendi kendini çoğaltan bir vektör monte etmek açıklayan bir protokol sokulması, ii) konjugasyon ile bir siyanobakteriyel konak içine vektör tanıtmak ve iii) transgenik siyanobakteri suşları karakterize bir plaka okuyucu veya akış sitometri.

Abstract

Siyanobakteriler, yararlı endüstriyel malların yenilenebilir üretimi için genetik olarak modifiye edilebilen çeşitli prokaryotik fotosentetik organizmalar grubudur. Sentetik biyolojideki son gelişmeler, sonraki dönüşüm veya konjuga transferiçin plazmid vektörleri oluşturmak için standart laştırılmış modüler klonlama sistemi olan CyanoGate gibi çeşitli klonlama araç kitlerinin geliştirilmesine yol açmıştır. Burada kendi kendini çoğaltan bir vektör (örneğin, floresan marker ekspresyon kaseti taşıyan) ve cyanobakteriyel suşları Synechocystis sp içine vektör konjugal transferi montajı için ayrıntılı bir yöntem anahat. uzun UTEX 2973. Buna ek olarak, bir plaka okuyucu veya akış sitometri kullanarak genetik bir parçanın (örneğin, bir organizatör) performansını karakterize etmek için nasıl anahat.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Siyanobakteriler doğal ve heterolog yüksek değerli metabolikürünleringeniş bir yelpazede biyosenteziçin kullanılabilir ototrofik bakteriler1,2,3,4,5, 6 . Birkaç engeller hala ticari canlılık genişletmek için aşılması gerekir, en önemlisi, heterotrofik biyo-platformlar (örneğin, Escherichia coli ve maya ile karşılaştırıldığında nispeten kötü verimleri)7. Mevcut genetik mühendislik araçlarının son genişleme ve siyanobakteriyel araştırmalarda sentetik biyoloji paradigmaalımı nın alımı bu tür zorlukların üstesinden gelmek ve daha verimli biyofabrikalar8olarak siyanobakteriler geliştirmek için yardımcı oluyor8 , 9,10.

DNA'nın siyanobakterilere dahil edilmesinde temel yaklaşımlar dönüşüm, konjugasyon ve elektroporasyonlardır. Dönüşüm veya elektroporasyon ile siyanobakterilere aktarılan vektörler "intihar" vektörleridir (yani homolog rekombinasyonları kolaylaştıran bütünleştirici vektörlerdir), kendi kendini çoğaltan vektörler ise siyanobakterilere dönüşüm, konjugasyon veya elektroporasyon. Eski için, bir protokol mühendislik modeli türler doğal dönüşüm11münasip için kullanılabilir. Daha yakın zamanda, siyanobakteriler için cyanogate adı verilen modüler bir klonlama (MoClo) araç seti, doğal dönüşüm, elektroporasyon veya konjugasyon kullanılarak mühendislik için standart bir Golden Gate vektör montaj yöntemi kullanan geliştirilmiştir12.

Golden Gate tipi montaj teknikleri son yıllarda giderek daha popüler hale gelmiştir ve montaj standartları ve parça kütüphaneleri artık çeşitli organizmalar için kullanılabilir13,14,15,16 ,17. Golden Gate tip IIS restriksiyon enzimleri (örneğin, BsaI, BpiI, BsmBI, BtgZI ve AarI) ve bir "tek pot" montaj reaksiyonunda birden fazla dizinin yönsel hiyerarşik montajını kolaylaştırmak için kabul eden ve benzersiz çıkıntılar kullanır. Tip IIS restriksiyon enzimleri benzersiz bir asimetrik dizi tanımak ve daha sonra sipariş DNA sürücü için istismar edilebilir bir şaşırtıcı, "yapışkan uç" kesim (genellikle 4 nükleotit [NT] çıkıntı) oluşturmak için tanıma sitelerinden tanımlanmış bir mesafe kesti montaj reaksiyonları15,18. Bu, PhytoBricks standardı19gibi ortak bir sözdizimi tarafından tanımlanan modüler Düzey 0 parçaların (örn. organizatörler, açık okuma çerçeveleri ve sonlandırıcılar) büyük kitaplıklarının geliştirilmesini kolaylaştırmıştır. Düzey 0 parçaları daha sonra kolayca Düzey 1 ifade kasetleri içine monte edilebilir, hangi daha karmaşık yüksek sipariş derlemeleri (örneğin, multigene ifade yapıları) seçim12,15bir kabul vektörü inşa edilebilir aşağıdaki . Golden Gate tipi montaj tekniklerinin önemli bir avantajı, dnadökümhaneleri 20,21gibi yüksek iş hacmi tesislerinde otomasyona olanak sağlamaktır, bu da karmaşık deneysel tasarımların test edilmesine olanak sağlar. kolayca el emeği ile elde edilemez.

CyanoGate kurulan Bitki MoClo sistemi12,15üzerine inşa eder. CyanoGate içine yeni bir parçası dahil etmek için, parça dizisi ilk evcilleştirilmiş olmalıdır, yani, BsaI ve BpiI için "yasadışı" tanıma siteleri kaldırılmalıdır. Açık okuma çerçevesi (yani bir kodlama dizisi, CDS) için kodlama yapan bir parça durumunda, tanıma siteleri dizideki eşanlamlı mutasyonlar oluşturarak bozulabilir (örneğin, bir kodonu aynı amino asit kalıntısını kodlayan bir alternatife değiştirerek). Bu yaklaşımlar çeşitli elde edilebilir, DNA sentezinden polimeraz zincir reaksiyonu arasında değişen (PCR) Gibson montaj22gibi amplifikasyon tabanlı stratejiler . Kullanılan ifade ana bilgisayarbağlı olarak, dikkat çeviri verimliliğini inhibe edebilecek nadir kodon giriş önlemek için alınmalıdır23. Tanıtım ve sonlandırıcı dizilerinde tanıma sitelerinin kaldırılması genellikle daha riskli bir çabadır, çünkü değişiklikler işlevi etkileyebilir ve parça beklendiği gibi performans göstermeyebilir. Örneğin, putatif transkripsiyon faktörü bağlama sitelerinde veya bir organizatör içindeki ribozom bağlama sitesinde yapılan değişiklikler, gücü ve yanıt verme yeteneğini indüksiyon/baskıya değiştirebilir. Aynı şekilde, anahtar terminatör yapısal özellikleri değişiklikler (örneğin, GC zengin kök, döngü ve poli-U kuyruk) sonlandırma verimliliği ve etkisi gen ekspresyonu 24 ,25değiştirebilirsiniz. Organizatör ve sonlandırıcı dizilerin etkinliğini tahmin etmek ve önerilen mutasyonunperformansıetkileyip etkilemeyeceğini bildirmek için çeşitli çevrimiçi kaynaklar mevcut olsada,bu araçlar genellikle kötü tahminbazlardır. siyanobakterilerde performans28,29,30. . Bu nedenle, değiştirilmiş parçaların in vivo karakterizasyonu yine de etkinliği onaylamak için önerilir. Rekalsitrant dizilerinin klonlanmasına yardımcı olmak için, CyanoGate BiyoTuğla vektör pSB4K512,16,31dayalı düşük kopya klonlama kabul vektörü içerir. Ayrıca, bir "Tasarım ve Yapı" portalı Edinburgh Genom Döküm aracılığıyla vektör tasarımı (dab.genomefoundry.org) ile yardımcı olmak için kullanılabilir. Son olarak, ve en önemlisi, CyanoGate intihar vektörleri kullanarak siyanobakteriler içine DNA tanıtmak için iki Seviye T alıcı vektör tasarımları (Düzey 2 alıcı vektörler eşdeğer)15 içerir, ya da kendini çoğaltma yeteneğine sahip geniş konak aralığı vektörler birkaç siyanobakteriyel türlerde 32,33,34.

Burada Seviye T kendi kendini çoğaltan vektörler ve Synechocystis PCC 6803 ve Synechococcus uzada UTEX 2973(Synechocystis PCC 6803 ve S. uzamı genetik modifikasyonu oluşturmak için bir protokol açıklayan üzerinde durulacak UTEX 2973 bundan sonra) konjugasyon (ayrıca üç ebeveynli miating olarak da bilinir). Bakteri hücreleri arasında DNA'nın konjugal transferi iyi tanımlanmış bir süreçtir ve daha önce mühendislik siyanobakteriyel türler için kullanılmıştır, özellikle doğal olarak yetkili olmayanlar, S. uzamış UTEX 297335gibi, 36,37,38,39,40,41. Kısacası, siyanobakteri kültürleri konjugasyon ("harekete geçirici" sağlamak için transfer edilecek vektörü ("kargo" vektörü) ve vektörleri (aynı E. coli suşlarında veya ek suşlarda) taşıyan bir E. coli suşu ile kuluçkaya yatırılır. ve "yardımcı" vektörler). Konjugal transferin gerçekleşmesi için dört temel koşul gereklidir: 1) DNA transferiile ilgili hücreler arasında doğrudan temas, 2) kargo vektörü konjugasyon sistemiyle uyumlu olmalıdır (yani, uygun bir aktarım menşei içermelidir(oriT), ayrıca bir bom (hareketlilik temeli) sitesi olarak da bilinir), 3) dna nicking protein (örneğin, mafya geni tarafından kodlanmış) bu cyanobacterium içine DNA tek iplikli transferi başlatmak için oriT dna nicks mevcut olmalı ve ifade ya kargo veya yardımcı vektörler, ve 4) transfer DNA alıcı siyanobacterium tahrip edilmemelidir (yani, örneğin, kısıtlama endokleaz aktivite)35,42. Kargo vektörünün devam edebilmesi için, çoğaltmanın kaynağının, kendi kendini çoğaltmave kız hücrelerine çoğalmasına izin vermek için alıcı siyanobakteri ile uyumlu olması gerekir. Koşullar 3 ve 4 ile yardımcı olmak için, çeşitli yardımcı vektörler Addgene ve mafya için kodlar diğer ticari kaynaklar aracılığıyla yanı sıra ev sahibi cyanobacterium43yerli enonukleazlar korumak için çeşitli metilazlar mevcuttur. Bu protokolde konjugasyon, sırasıyla pRK24 (www.addgeneorg/51950) ve pRL528 (www.addgene.org/58495) ile harekete geçirici ve yardımcı vektörleri taşıyan bir MC1061 E. coli süzme ile kolaylaştırılmıştır. Evlilik transferi için kullanılacak vektörleri seçerken dikkatli olunmalıdır. Örneğin, CyanoGate kitinde kendi kendini çoğaltıran kargo vektörü pPMQAK1-T bir Mobproteini 12için kodlar. Ancak, pSEVA421-T44değildir ve bu nedenle, mob uygun bir yardımcı vektör ifade edilmelidir. Kullanılan vektörler de hedef organizmaya uygun olmalıdır. Örneğin, Anabaena sp. PCC 7120'de verimli konjugal aktarım, harekete geçirici vektörünü sindirime karşı koruyan bir yardımcı vektör gerektirir (örneğin, pRL623, üç metilas AvaiM, Eco47iiM ve Ecot22iM)45, 46. yıl.

Bu protokolde, bir plaka okuyucu veya akış sitometresi kullanarak bir floresan marker ile parçaların (yani, organizatörler) performansını karakterize etmek için nasıl daha fazla anahat. Akış sitometreleri büyük bir popülasyon için floresanları tek bir hücre bazında ölçebilir. Ayrıca, akış sitometreleri kullanıcıların elde edilen verileri "kapı" ve arka plan gürültüsünü (örneğin, kültürdeki partikül maddeden veya kontaminasyondan) kaldırmalarına olanak sağlar. Buna karşılık, plaka okuyucular genellikle birkaç çoğaltma kuyularında, belirli bir kültür hacminin toplam floresan ölçümü elde. Plaka okuyucuların sitometrelere göre en önemli avantajları arasında daha düşük maliyet, daha yüksek kullanılabilirlik ve genellikle akış aşağı veri analizleri için uzman yazılımlara gerek yoktur. Plaka okuyucuların ana sakıncaları sitometrelere göre nispeten daha düşük hassasiyet ve ölçülen kültürlerin optik yoğunluğu ile potansiyel sorunlardır. Karşılaştırmalı analizler için, plaka okuyucu örnekleri her kuyu için normalleştirilmelidir (örn. kültür yoğunluğuölçümü için, genellikle 750 nm [OD750]'de optik yoğunlukta absorbans olarak alınan, bu da çok fazla örnek için yanlışlıklara yol açabilir. yoğun ve/veya iyi karışmaz (örn. toplama veya flokülasyona eğilimli olduğunda).

Genel bir bakış olarak, burada Seviye 0 parçaları oluşturma ilkelerini ayrıntılı olarak gösteriyoruz, ardından CyanoGate kitini kullanarak hiyerarşik montaj ve eş transferi için uygun bir vektöre klonlama. Daha sonra konjuge aktarım sürecini, floresan belirteç ifade eden axenic transkonjugant suşlarının seçimini ve bir akış sitometresi veya plaka okuyucu kullanarak floresan verilerin indensonra elde edinimi gösteriyoruz.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Bitki MoClo ve CyanoGate araç kitleri kullanılarak vektör montajı

NOT: Vektör montajı ile devam etmeden önce, kullanıcıların Bitki ve CyanoGate MoClo sistemlerinin vektör seviyesi yapıları12,15ile tanışmaları önemle tavsiye edilir.

  1. Seviye 0 parçalarının yapımı
    NOT: Düzey 0 parçaları tam vektörler veya Düzey 0 kabul edenlerle (örneğin, gBlocks, IDT) montaj için doğrusal diziler olarak sentezlenebilir. Alternatif olarak, diziler bir kaynak şablonundan (örneğin, vektör veya saf genomik DNA) yükseltilebilir. Burada, yükseltilmiş bir üründen yeni bir Seviye 0 parçasının nasıl üretilenle anlatıldığı açıklanmıştır. Seviye 0'dan Seviye T'ye Kadar Golden Gate montaj sürecine genel bir bakış,Şekil 1.
    1. Astarları tasarla.
      1. Hangi Seviye 0 modülümonte ve uygun 5 ' ve 3 ' çıkıntıları tanımlamak için karar verin (Tablo 1)12,15. BpiI veya BsaI kısıtlama sitelerinin varlığı için klonlamak için DNA dizisini kontrol edin.
        NOT: Bu sitelerden birini içeren bir dizi, kısıtlama sitesi dizisinde bir veya daha fazla NT değiştirilerek evcilleştirilmelidir. Golden Gate montaj kullanarak bunu yapmak için bir strateji Şekil 2'deözetlenmiştir.
      2. DNA dizisini yükseltmek için uygun bir ileri ve ters astar çifti tasarla. İleri astar için, DNA şablon dizisinin 5' ucuna tamamlayıcı 18−30 bp seçin. Ters astar için, DNA şablon dizisinin 3' ucuna tamamlayıcı 18−30 bp ters seçim seçin.
        NOT: Erime sıcaklığı 58−62 °C olan astarlar genellikle en tutarlı amplifikasyon sonuçlarını verir (Şekil 1A).
      3. İleri astar 5 ' sonuna aşağıdaki ekleyin: 1) BpiI sitenin 5 ' sonunda 4−6 NTs rasgele bir dize, 2) BpiI kısıtlama sitesi (GAAGAC), 3) iki rasgele NTs, ve 4) adım 1.1.1.1 seçilen 5 ' çıkıntı. Ters astar 5 ' sonuna aşağıdaki ekleyin: 1) BpiI sitenin 5 ' sonunda 4−6 NTs rasgele bir dize, 2) BpiI kısıtlama sitesi (GAAGAC), 3) iki rasgele NTs, ve 4) adım 1.1.1.1 seçilen 3 ' çıkıntı. Tamamlandığında, astar çiftleri sipariş edin.
        NOT: İleri ve geri astar çifti örneği için Şekil 1A'ya bakınız.
    2. Genomik DNA'dan dna dizisini yükseltin.
      1. Bölüm 5'te açıklandığı gibi genomik DNA ayıklayın. Ürünleri PCR ile yüksek kaliteli DNA polimeraz(Malzeme Tablosu)kullanarak yükseltin.
        NOT: Örnek olarak, pcr reaksiyonlarını (20−50 μL) üreticinin talimatlarına göre ayarlayın. Reaksiyon başına ~100 ng genomik DNA kullanın. 30 s için 98 °C'lik bir başlangıç denatürasyon adımından oluşan bir termal bisiklet programı kullanın, ardından 98 °C'de 10 s için en fazla 25 devir denatürasyon, 58 °C'de 15 s için 58 °C'de astarlama ve 72 °C'de 30 s için ürün uzantısı (ikincisini kullanılan DNA polimerazın ürün/tipinin boyutu), ardından 2 dk için 72 °C'lik son uzatma adımı.
      2. PCR ürün jel saflaştırılmış olacaksa, bölüm 6 açıklandığı gibi bir agarose jel üzerinde tüm PCR reaksiyonu çalıştırın. Agarose jel ilgi bandı kesip bir jel çıkarma kiti(Tablo Malzemeler)kullanarak arındırın.
      3. Adım 1.1.2.2'ye alternatif olarak, PCR ürünü jel saflaştırma olmadan kullanılacaksa, bir agarose jel üzerinde PCR reaksiyon örneğinin (~5 μL) bir aliquot'u çalıştırarak bant boyutunu doğrulayın. Jel sadece uygun bant ve astar dimers hiçbir kanıt gösterirse, BIR DNA arıtma kiti(Tablo Malzemeler)kullanarak PCR ürün arındırın.
      4. Yüksek DNA konsantrasyonu elde etmek için küçük bir hacimde (örn. 10 μL) elute saflaştırılmış DNA(>20 ng/μL tipik olarak yeterlidir).
    3. Yükseltilmiş DNA ürününü (veya ürünleri, şekil 2'yebakınız) Düzey 0'da birleştirin. BpiI (Şekil 1B)ile 20 μL'lik bir reaksiyon karışımı hazırlayın ve Tablo 2'deaçıklandığı gibi termal döngü programı ayarlayın. Monte edilen Seviye 0 reaksiyon karışımının 5 μL'sini kullanarak E. coli dönüşümüne devam edin (bölüm 2'de açıklandığı gibi).
  2. Seviye 1 montajlarının inşası
    1. Hangi Düzey 0 parçalarının monte edeceğine karar verin (Şekil 1C ve Tablo 1). Uygun bir Düzey 1 kabulvektörü 15seçin.
      NOT: Bu aşamada, Düzey 1 kabul vektörünün seçimini etkileyeceğinden, son vektör tasarımının T düzeyinde ne olacağını bilmek önemlidir. Düzey 1 pozisyonu 1 (İleri) kabul vektörü (pICH47732) hedef T düzeyinde tek bir Düzey 1 montaj (örneğin, bir gen ekspresyonu kaseti) sahip olmaksa varsayılan olarak kullanılabilir. Ancak, Iki veya daha fazla Düzey 1 derlemesi Seviye T'de bir araya getirilecekse, her Düzey 1 derlemesinin konumu ve yönü göz önünde bulundurulmalıdır. En fazla yedi Seviye 1 derlemesi,12uygun konumlara sahip Düzey 1 kabul vektörleri kullanılarak T düzeyi kabul vektörü içinde monte edilebilir.
    2. Düzey 1'deki Düzey 0 parçalarını birleştirin. BsaI ile 20 μL'lik bir reaksiyon karışımı hazırlayın ve Tablo 2'deaçıklandığı gibi termal döngü programı ayarlayın. Monte edilen Seviye 1 reaksiyon karışımının 5 μL'sini kullanarak E. coli dönüşümüne devam edin (bölüm 2'de açıklandığı gibi).
  3. Seviye T montajlarının yapımı
    1. Hangi Düzey 1 derlemelerinin monte edeceğine karar verin (Şekil 1D). Uygun bir Seviye T kabul vektörü seçin.
      NOT: pUC19A-T (ampisilin direnci) ve pUC19S-T (spectinomycin direnci) siyanobakterilerde çoğalamayan ve öncelikle genomik entegrasyon için kullanılan yüksek kopya numarası tümleştirici vektörlerdir (örn. genlerin knock-in veya knock-out)' u homolog rekombinasyon12. Bütünleştirici vektörlerin teslimi, münasip siyanobakteriyel türlerde doğal dönüşüm le devam edebilir11. pPMQAK1-T, eş transferi (bölüm 3) ile teslim edilen geniş bir ana bilgisayar aralığı, çoğaltıcı vektördür.
    2. Seviye Tomurga15son Düzey 1 montaj 3 ' sonunda ligate için uygun bir End-Link seçin.
      NOT: Gerekli Bitiş Bağlantısı, son bölümün konumuyla aynı sayıdır. Örneğin, yalnızca bir Düzey 1 pozisyonu 1 (ileri veya geri) parçası olan bir Seviye T vektörü, T düzeyi omurgasına ligasyon için End-Link 1 (pICH50872) gerektirir.
    3. Seviye T'de bir veya daha fazla Seviye 1 derlemesini bir araya getirin. BpiI ve gerekli End-Link vektörü ile bir reaksiyon karışımı hazırlayın ve Tablo 2'deaçıklandığı gibi termal döngü programı kurun. Monte edilen Seviye T reaksiyon karışımının 5 μL'sini kullanarak E. coli dönüşümüne devam edin (bölüm 2'de açıklandığı gibi).

2. E. coli dönüşümü ve vektör saflaştırma

  1. E. coli dönüşümü (gün 1)
    1. Kimyasal olarak yetkin E. coli hücrelerinin(Malzeme Tablosu)bir aliquot (~25 μL) ve hafifçe buz üzerinde 1,5 mL tüp içine pipet defrost. Montaj karışımının 5 μL'sini (Seviye 0, 1 veya T) ekleyin ve tüpü 30−60 dk daha buz üzerinde kuluçkaya yatırın.
    2. Isı şok hücreleri 30 s için 42 °C'de bir su banyosunda tüp kuluçka, sonra 2 dakika boyunca buz üzerinde tüp geri yerleştirin. Oda sıcaklığında ekleyin (RT) katabolit baskı ile süper optimal suyu (S.O.C.) orta (250 μL) tüp. Tüpü 37 °C'de 1 saat 225 rpm'de sallayarak bir kuluçka makinesinde kuluçkaya yatırın.
    3. Uygun son antibiyotik konsantrasyonu içeren bir LB agar plakasına kültürün 40 μL plakası (spectinomisin dihidroklorür pentahidrat için 100 μg/mL [Seviye 0], 100 μg/mL karbenicillin disodyum [Seviye 1]veya 50 μg/mL kanamisin sülhate [ T düzeyi), mavi-beyaz tarama için 1 mM izopropil-beta-D-tiogalactopyranoside (IPTG) ve 40 μg/mL 5-bromo-4-kloro-3-indolyl-β-D-galaktopiranoside (X-Gal). Plakayı bir gecede 37 °C'de kuluçkaya yatırın.
      NOT: Kaplamalı kültür miktarı, E. coli yetkili hücrelerinin etkinliğine ve ligasyon reaksiyonuna bağlı olarak çeşitli olabilir. Gece kuluçkadan sonra <10 koloniler gözlenirse daha büyük bir hacim koyun.
  2. Beyaz kolonilerin seçimi ve sıvı kültürlerin hazırlanması (gün 2)
    NOT: Montaj reaksiyonunun ve müteakip dönüşümün etkinliğine bağlı olarak LB agar plakaları koloni, mavi koloni veya beyaz koloni içermeyebilir(Şekil 3). Mavi koloniler kısıtlamaya girmemiş kabul edici vektörlerin göstergesidir (yani, lakZ'nin işlevsel bir kopyası hala mevcuttur). Beyaz koloniler lacZ ifade kasetinin kaybolduğunu ve bir parça/montaj la değiştirildiğini gösterir.
    1. İsteğe bağlı olarak, beyaz kolonilerin bölüm 7'de açıklandığı gibi PCR gerçekleştirerek beklenen vektörü içerdiğini doğrulayın.
    2. 10 μL uçlu tek beyaz kolonileri (veya PCR onaylı kolonileri) seçin ve LB orta (5 mL) ve uygun antibiyotik konsantrasyonları (adım 2.1.3) içeren 15 mL santrifüj tüpüne aktarın. Tüpleri bir gecede 37 °C'de 225 rpm'de sallayarak bir kuluçka makinesinde kuluçkaya yatırın.
  3. Plazmid vektör arınması (gün 3)
    1. İsteğe bağlı olarak, vektörlerin uzun vadeli kriyodepolama için gecelik E. coli kültürünün bir gliserol stok hazırlamak. -80 °C'de kriyodepolama için uygun bir 1,5−2.0 mL tüpte %50 (v/v) gliserol 500 μL'lik bakteri kültürü ekleyin. 5−10x ters çevirerek hafifçe karıştırın. Parlama-dondurma numuneleri sıvı nitrojende ve -80 °C'lik bir dondurucuda saklayın.
    2. 15 mL santrifüj tüplerinde 5−10 dk.'da 3.000 x g.'de kültürleri aşağı çevirin. Bir plazmid arıtma kiti(Malzeme Tablosu)kullanarak vektörü arındırın. 35 μL deiyonize suda elute saflaştırılmış vektör.
      NOT: Vektör konsantrasyonunu daha da artırmak için daha düşük elüsasyon hacimleri kullanın. Aynı eluent, artan verimler için iki kez arıtma sütununa konabilir.
    3. Bir spektrofotometre(Malzeme Tablosu)kullanarak elüent'teki vektörün konsantrasyonu ölçün.
      NOT: PUC19 gibi E. coli'dekiyüksek kopya-sayı vektörleri genellikle 50−300 ng/μL verim verir. PPMQAK1-T gibi düşük kopya sayısı vektörleri genellikle 15−60 ng/μL verim verir.
  4. Vektör doğrulama
    NOT: Vektörler kısıtlama sindirimi (adım 2.4.1) ve/veya sıralama (adım 2.4.2) ile doğrulanabilir.
    1. 0,5−1 μg vektörü uygun bir kondisyon enzimi(ler) ile kısıtlayın ve bölüm 6'da açıklandığı gibi beklenen bant boyutlarını doğrulayın(Şekil 4).
      NOT: Yanlış bant boyutları genellikle hatalı montaj gösterir, bu durumda daha fazla beyaz koloniler taranabilir veya derleme tekrarlanabilir. BsaI ve BpiI, sırasıyla Düzey 0 ve Düzey 1 derlemeleri için kesici uç sneyse doğru boyutunu doğrulamak için kullanılabilir. BsaI veya BpiI, sindirimi takiben ayrı bir bant kümesi oluşturmak için kesici uç ve/veya vektör omurgasını kesen ek, uyumlu bir restriksiyon enzimi ile birlikte kullanılabilir.
    2. Ticari sıralama tesisini kullanarak monte edilen bölgenin uygun bir astar yukarısını kullanarak vektörü Sanger sıralamaya göre sırala(Tablo 3).
      NOT: Tüm yeni Düzey 0 parçaları beklenen sırakimliğini onaylamak için sıralanmalıdır. Düzey 1 ve T vektörlerinin sıra doğrulaması, daha önce sıralanmış düzey 0 parçalarından bir araya getirildiğinde genellikle gerekli değildir.

3. Konjugasyon ile mutantların üretimi

NOT: Burada, synechocystis PCC 6803 veya S. uzadan UTEX 297311,47 içine kendi kendini çoğaltan bir kargo vektörü konjugal transferi için bir protokol açıklanmıştır. Bu protokol diğer model türler için geçerlidir (örneğin, S. elongatus PCC 7942 ve Synechococcus sp. PCC 7002). Siyanobakteriler (ve ilişkili tampon preparatları) ile tüm çalışmalar bir laminar akış kaputunda steril koşullar altında yapılmalıdır.

  1. Siyanobakteri kültürünün büyümesi (gün 1)
    1. Lea-Smith ve ark.11'egöre BG11 ortamını ve LB-BG11 ve BG11+Kan50 (bölüm 8) ile agar plakalarını hazırlayın.
    2. Synechocystis PCC 6803 veya S. uzalı UTEX 2973 taze BG11 orta (50 mL) bir axenic BG11 agar plaka kaynaklı hücreleri ile 100 mL konik şişe aşılayarak taze bir kültür kurmak. Synechocystis PCC 6803 kültürlerini 30 °C'de, 100 μmol fotonlar m-2s-1 100 rpm'de yetiştirin ve 40 °C'de S. uzaması utex 2973, m-2s-1 100 rpm'de büyütün. OD750 = 0,5−1,5 (genellikle 1−2 gün) kadar kültürleri büyütün.
      NOT: S. uzamış UTEX 2973 kültürleri yüksek ışık yoğunluklarında 40 °C'de yetiştirilebilir (örn. 2000 μmol fotonm-2s-1)48.
  2. Yardımcı ve kargo E. coli suşlarının büyümesi (gün 2)
    1. Ampisilin (son konsantrasyon 100 μg/mL) ve kloramfenikol (son konsantrasyon 25 g/mL) içeren inoculate LB orta vektörleri pRK24 ve pRL528 içeren bir MC1061 E. coli suşu (yani, yardımcı zorlanma) içeren ve 225 rpm gecede 37 °C'de büyümek sallayarak bir kuluçka makinesinde. Yeterli hacimde bir yardımcı gerinim kültürü yetiştirin, konjugasyon başına 1 mL kültür gerektiğini varsayarak.
    2. Yük vektörü taşıyan E. coli kültürü ile uygun antibiyotikler içeren LB orta (5 mL) aşılamak (yani, bir Seviye T vektörü). Bir sallayarak kuluçka 225 rpm gecede 37 °C'de kültürü büyütün.
  3. Eş transferi (üç ebeveynli miyeting) (gün 3)
    1. E. coli yardımcı ve kargo suşları hazırlayın. Oda sıcaklığında 10 dakika boyunca 3.000 x g'de yardımcı yı ve kargo E. coli'yi geceleme kültürlerini santrifüj edin. Hücre peletini bozmadan süpernatant'ı atın.
    2. Antibiyotik olmadan taze LB orta ekleyerek pelet yıkayın. İlk kültürle aynı ses düzeyini kullanın. Peleti yavaşça yukarı ve aşağı boruile tutarak yeniden askıya alın. Kültürü girdap etmeyin. Bu adımı 3x gecede kültürden kalan antibiyotik kaldırmak için tekrarlayın.
    3. Yeniden askıya alınan kültürü (adım 3.3.1'de olduğu gibi) santrifüj edin, ilk kültür hacminin LB ortamının yarısı kadar süpernatant atın ve yeniden askıya alın (örneğin, bir gecede kültür 5 mL ise 2,5 mL). 2 mL'lik bir tüpteki 450 μL'lik kargo gerilimi ile 450 μL'lik yardımcı gerilimi birleştirin ve 3.3.6 adıma kadar bir kenara koyun (RT'de bırakın).
    4. Siyanobakteri kültürünü hazırlayın. Her konjugasyon reaksiyonu için 1 mL siyanobakteriyel kültür (OD750 = 0.5−1.5) kullanın.
    5. RT'de 10 dakika boyunca 1.500 x g'de gerekli toplam siyanobakteriyel kültürü santrifüj edin, sonra hücre peletini bozmadan süpernatantı dikkatlice atın. Aynı ilk hacimde taze BG11 ortamı ekleyerek peleti yıkayın. Peleti yavaşça yukarı ve aşağı borular oluşturarak yeniden askıya alın, kültürü girdap etmeyin. Bu adımı 3x tekrarlayın ve yıkanmış kültürü bir kenara koyun.
    6. 2 mL'lik bir tüpte birleştirilmiş E. coli suşlarına (yardımcı ve kargo) (900 μL) yıkanmış siyanobakteriyel kültürden (900 μL) bir aliquot ekleyin. Kültürleri yavaşça yukarı ve aşağı borular oluşturarak karıştırın. Girdap etmeyin. Synechocystis PCC 6803 veya S. uzamış UTEX 2973 için 2 saat için 30 dakika boyunca RT'de karışımı kuluçkaya yatırın.
    7. Karışımı 1.500 x g'de 10 dk'da senttrifüjleyin. Kalan ~200 μL supernatant pelet resuspend. Antibiyotiksiz bir LB-BG11 agar plakası üzerine 0,45 μm membran filtre yerleştirin (bölüm 8). Dikkatle e. coli/ siyanobakteriyel kültür karışımı 200 μL steril bir yayıcı veya steril uçlu ile membran üzerinde yayıldı ve parafin film ile plaka mühür.
    8. LB-BG11 plakasını membranla 24 saat kuluçkaya yatırın. 150 μmol fotonm-2s-1'de40 °C'de S. uzaması UTEX 2973 kültürleri ile membranları koruyun.
  4. Membran transferi
    1. 24 saat sonra, dikkatle taze bir BG11 agar plaka uygun antibiyotikler (bölüm 8) kargo vektörü için seçmek için içeren alev sterilize forseps kullanarak membran aktarın. Plakayı parafin filmi ile kapatın.
    2. Koloniler ortaya çıkana kadar Synechocystis PCC 6803 veya S. uzatüs UTEX 2973 için yukarıda açıklandığı gibi, uygun büyüme koşulları altında BG11 agar plaka kuluçka.
      NOT: Koloniler genellikle Synechocystis PCC 6803 için 7−14 gün ve S. uzatüs UTEX 2973 için 3−7 gün sonra ortaya çıkar.
  5. Konjugat seçimi
    NOT: Sadece yük vektörünü taşıyan siyanobakteriyel koloniler membran üzerinde büyüyebilecektir (Şekil 5).
    1. Bir ısı steril döngü kullanarak, membran ve çizgi en az iki ayrı koloniler seçin yeni bir BG11 agar plaka uygun antibiyotikler içeren üzerine(Şekil 5C).
      NOT: Taze çizgili koloniler hala konjugasyon dan taşınan E. coli ile kontamine olabilir (yani, küçük beyaz koloniler plaka üzerinde belirgin ise), bu yüzden taze BG11 agar plakaları üzerine yeniden çizgili iki veya üç tur daha genellikle vardır bir baltanik siyanobakteriyel kültür elde etmek için gerekli.
    2. E. coli kontaminasyonunun, 5 mL LB orta içeren 15 mL'lik bir santrifüj tüpüne bir siyanobakteri kültürünü aşılayarak ve bir gece boyunca 37 °C'de 225 rpm'de sallayarak bir kuluçka makinesinde kuluçkaya yatarak E. coli kontaminasyonunun yokluğunu doğrulayın. Yeterli büyüme süresini (~7 gün) takiben, uzun süreli kriyodepolama veya sonraki deneyler için sıvı kültürleri kurmak için tek tek axenik koloniler seçin.
  6. Siyanobakteriyel suşların kriyodepolanması
    1. OD750 = 1.5−3.0'a kadar BG11'de (bölüm 3.1'de açıklandığı gibi) siyanobakteriyel sıvı kültürü yetiştirin. 1.500 x g10 dakika kültür santrifüj 10 mL , supernatant kaldırmak ve taze BG11 orta 5 mL hücreleri resuspend.
    2. 3.5 mL otoklav ekleyin sterilize 50% (v / v) gliserol son gliserol konsantrasyonu için ~ 20% (v / v)49. Bu yaklaşım Synechocystis PCC 6803 için iyi çalışır. Alternatif olarak, %16 (v/v) dimetil sülfoksit (DMSO) içeren 5 mL filtre sterilize BG11 ekleyin ve son DMSO konsantrasyonu için ~8 %(v/v)50. Bu yaklaşım, S. uzatüs UTEX 2973 de dahil olmak üzere çoğu suş için tavsiye edilir.
      DİkKAT: DMSO toksiktir ve uygun koruma ile ele alınmalıdır.
    3. 5−10x ters çevirerek hafifçe karıştırın. Subaliquot ~ 1 mL kültür ayrı kriyodepolama uyumlu 1.5 mL vida-kap tüpleri (Malzeme Tablosu). Dondurucu depolama için tüpleri -80 °C'lik bir dondurucuya yerleştirin. Sıvı nitrojen donma yanıp söner etmeyin.
      NOT: Her su için en az üç hisse senedi önerilir.
    4. Geri kazanım için, -80 °C'lik dondurucudan bir tüp çıkarın ve 35 °C'lik bir su banyosunda kültürü eritin ve yavaşça karıştırarak. Çözülmüş kültürü 50 mL taze BG11 ortamına ekleyin ve sıvı bir kültür olarak büyüyün (bölüm 3.1'de açıklandığı gibi).
      NOT: Alternatif olarak, kültür çizgili ve taze bir BG11 agar plaka üzerinde yetiştirilen olabilir. Seçim belirteçleri taşıyan transgenik kültürler başlangıçta ANTIBIYOTIKolmadan BG11 agar plakaları üzerinde yeniden canlandırılmalı ve daha sonra uygun antibiyotiklerle BG11 agar plakalarına restreaked.

4. Organizatör karakterizasyonu

NOT: Burada standart bir yaklaşım bir plaka okuyucu veya akış sitometre12kullanarak bir 72 h büyüme dönemi aşağıdaki bir floresan marker (eYFP) ifade düzeylerini ölçerek bir organizatör parçasının gücünü analiz etmek için açıklanmıştır.

  1. Kültür büyümesi
    1. Floresan marker ekspresyon kasetini taşıyan transgenik siyanobakteriyel suş tek bir koloni ile uygun antibiyotikler içeren 10 mL BG11 ortamı aşılayarak tohum kültürleri kurmak. Ayrıca uygun negatif kontrol suşları için tohum kültürleri hazırlamak (örneğin, yabani bir tür zorlanma ve / veya aynı vektör omurga taşıyan bir transgenik suşu ama floresan marker ifade kaseti yoksun).
      NOT: En az dört biyolojik kopya önerilir.
    2. 48 saat veya OD750 = 1−1.5'e kadar tohum kültürlerini, türler için uygun büyüme koşullarında büyütün.
    3. Organizatör ifadesini zaman içinde izlemek için, önce her tohum kültürünün OD750'sini ölçün. Her kültürü başlangıç OD750 = 0,2'ye getirmek için seyreltme gereksinimlerini hesaplayın. Seyreltilmiş deneysel kültür örneklerini (2 mL toplam hacim) düz alt 24 kuyuluk bir plakaya(Malzeme Tablosu)yerleştirin.
    4. Uygun büyüme koşulları altında beyaz LED ışıkları(Malzeme Tablosu)ile sallayarak bir kuluçka makinesinde plaka kuluçka. Ölçü kültür büyüme yoğunluğu (OD750) ve gelişmiş sarı floresan protein (eYFP) floresan ya bir plaka okuyucu (bölüm 4.2) veya bir akış sitometre (bölüm 4.3) kullanarak.
      NOT: Synechocystis PCC 6803 ve S. uzamış UTEX 2973 kültürleri adım 3.1.2 olarak yetiştirilebilir. Plakanın yüksek nem altında muhafaza edilmesi şiddetle tavsiye edilir (%95). kültür örneklerinin buharlaşmasını önlemek için.
  2. Plaka okuyucu
    1. Kısaca 24-iyi plaka (adım 4.1.4) nazik pipetleme ile kültürleri karıştırın. Her kültürün bir alt örneğini siyah düz alt 96 kuyulu bir plakaya(Malzeme Tablosu) aktarın. Gerekirse seyreltin (100°L son hacim). Bu ölçüm doğruluğu ile engelleyebilir gibi kabarcıklar oluşumunu önlemek.
      NOT: Tüm ölçümlerin 0.2−1.0 od750 aralığındaki numuneler üzerinde yapılması önerilir. 24 kuyudaki kültürlerin yoğunluğu zaman içinde artacağı için, standart büyüme koşullarında beklenen artışlara göre aşağıdaki seyreltmeler tavsiye edilir: 0 saat, 1:4 24 saat, 1:10 48 saat ve 1:10 72 saat. Örneğin, 24 saat hasat 25 μL kültür ve 75 μL BG11 orta ile karıştırın.
    2. 96 kuyulu plakaya iki boş kuyu (yani 100 μL BG11 orta) ekleyin. Bir tabak okuyucu(Tablo Malzemeler)içine 96-iyi plaka koyun. Kuyuları karıştırmak için plaka okuyucuorbital shaker kullanarak 500 rpm 60 s için plaka sallayın.
      NOT: Siyanobakteri kültürleri biraraya gelebilir ve/veya flocculate yapabilir, bu nedenle doğru ölçümler için okumadan önce iyi karıştırma çok önemlidir.
    3. 485 nm/520 nm'de uyarma/emisyon dalga boylarıyla OD750 ve eYFP floresanını ölçün.
    4. Siyanobakteri kültürünü içeren her bir numunenin OD750 ölçümünden iki boş kuyunun OD750 ölçümlerinin ortalamasını çıkarın.
    5. EYFP floresan ölçümü (adım 4.2.3) tarafından kültürün ayarlanmış OD750 'ye (adım 4.2.4) bölünerek her kültür örneğinin floresan değerlerini normalleştirin. Daha sonra, eYFP ekspresyonu kasetini taşıyan transgenik suşların uygun bir negatif kontrol geriliminin biyolojik kopyalarının ortalama normalleştirilmiş eYFP floresan değerini (eYFP floresan/OD750)çıkarın.
      NOT: Siyanobakteriler klorofil ve fikobiliproteinler gibi pigmentlerin varlığı nedeniyle doğal floresan.
    6. Zaman içinde kültür büyümesini(Şekil 6A)ve her deneysel kültürün istenilen zaman noktalarındaki ortalama normalleştirilmiş eYFP floresan değerleri (örn. 72 saat; Şekil 6B).
  3. Akış sitometresi
    1. Akış sitometre sıvı işleme sistemi için uyumlu bir plaka seçin. Örneğin, bu protokolde kullanılan akış sitometresi(Malzeme Tablosu)ile yuvarlak alt 96 kuyulu bir plaka(Malzeme Tablosu)kullanın.
    2. Kısaca 24-iyi plaka (adım 4.1.4) nazik pipetleme ile kültürleri karıştırın. Sıvı işleme sisteminde ki meme tıkanıklıklarını önlemek için kültürleri OD750 = 0,1−0,2'ye seyreltin. 96 kuyulu plakaya uygun bir kültür numunesi ekleyin ve filtre sterilize edilmiş 1x fosfat tamponlu salin (PBS) ile 250 μL'lik son bir hacme getirin. 60 μL BG11 ve 190 μL 1x PBS içeren plakaya orta çözelti için boş bir kuyu ekleyin.
      NOT: Numuneleri yeniden çalıştırmaya ihtiyaç duyulması durumunda bu birim önerilir. Her kuyunun maksimum hacmi 300 μL olduğundan 250 μL'den yüksek hacimler önerilmez.
    3. Akış sitometresi kullanıma hazır olduğunda, 96 kuyulu plakayı kültür örnekleriyle birlikte sıvı taşıma istasyonuna yerleştirin. 10.000 ayrı olayın (örn. hücreler) ölçümlerini toplamak için akış sitometresi için yazılım protokolünü ayarlayın. 488 nm/515−545 nm uyarma/emisyon dalga boyları ile eYFP floresanını ölçün. Önce boş kuyudan(Şekil 7A)okumayı ölçün ve kontrol edin, sonra örnekleri çalıştırın.
    4. Boş okumayla ortak bölgeler hariç olmak üzere, ileri ve yan dağılım veri kümelerindeki siyanobakteri hücrelerinin popülasyonuna geçit (Şekil 7B). EYFP ekspresyonu kasetini taşıyan transgenik suşlardan uygun bir negatif kontrol geriliminin biyolojik kopyalarının ortalama eYFP floresan değerlerini çıkartın (Şekil 7C,D). İstenilen zaman noktalarında (örn. 72 saat; Şekil 7E).

5. Siyanobakterilerden genomik DNA çıkarma

NOT: Aşağıdaki protokolde ticari DNA ekstraksiyon kiti(Malzeme Tablosu)kullanılır.

  1. OD750 = 1.5−3.0'a kadar BG11'de (bölüm 3.1'de açıklandığı gibi) siyanobakteriyel sıvı kültürü yetiştirin. 10 dk için 3.000 x g kültür 10 mL aşağı spin ve supernatant atın. Tüpleri -20 °C'de 30 dk kuluçkaya yatarak peleti dondurun.
  2. 400 μL lysis tampon (tampon AP1) ve 400 μL ribonükleaz çözeltisi (RNase A) ve %50 (w/v) cam boncuk (0,5 mm çap) ekleyin. 30 Hz 'de (yani 1.800 salınım/dak eşdeğer) bir boncuk değirmeni(Malzeme Tablosu)kullanarak numuneleri 6 dakika boyunca bozun.
  3. Numuneyi 5 dk için 17.000 x g'da döndürün ve süpernatantı dikkatlice yeni bir tüpe aktarın ve peleti atın. Üreticinin talimatlarına göre devam edin(Malzeme Tablosu).

6. Agarose jel elektroforez

  1. %0.02 (v/v) ethidyum bromür içeren %1 (w/v) agarose jel ilerler. Yük örnekleri ve uygun bir DNA merdiveni referansı.
  2. Numuneleri 125 V'de 50 dakika çalıştırın.
    NOT: Çalışma süresi ve agarose jel yüzdesi beklenen bant boyutuna uyacak şekilde değiştirilebilir. Örneğin, daha yüksek bir yüzde agarose jel ve daha uzun çalışma süresi bant çözünürlüğü ve DNA ürünleri <500 bp ayrılması artırabilir.

7. Koloni PCR

  1. Standart bir kit(Malzeme Tablosu)ve uygun bir astar kombinasyonu (örneğin, montaj bölgesini çevreleyen veya montaj bölgesi içindeki dizilere özgü astarlar (Tablo 3)kullanarak bir PCR reaksiyon karışımı ayarlayın. Pipet 10 μL PCR tüp içine.
  2. Steril kürdan veya 10 μL pipet ucu ile tek bir beyaz koloninin tepesine hafifçe dokunun ve PCR reaksiyon karışımı içeren bir PCR tüpünü aşılama. Koloniyi işaretlemeye ve belirli PCR tüpüyle eşleşmeye özen. E. coli hücrelerinin çözeltiye dökülmesini sağlamak için reaksiyon karışımını yavaşça karıştırın.
  3. PCR ile ürünleri artırın. 60 s için 95 °C, 15 s için 95 °C'de 30 tur, 15 s için 58 °C (astarların Tm değerlerinin birkaç derece altında) için 72 °C,30 s (30 s/kb kesici uç) için 72 °C'lik bir başlangıç denatürasyon adımından oluşan bir program kullanın. , 5 dakika boyunca 72 °C'lik son uzatma adımı nı takip edin.

8. BG11 orta ve plakaların hazırlanması

  1. Lea-Smith ve ark.11'egöre 100x BG11 orta, demir (amonyum ferrik sitrat), eser elementler, fosfat (K2HPO4),Na2CO3 ve TES tamponunun stok çözeltilerini hazırlayın. Otoklav fosfat ve Na2CO3 stokları. TES tampon (pH 8.2) ve NaHCO3 stok çözümlerini sterilize etmek için 0,2 μm filtreler kullanın.
  2. 1 L BG11 orta hazırlayın. 10 mL 100x BG11, 1 mL eser element ve 1 mL demir stoğu karıştırın ve çözeltiyi 976 mL su ile karıştırın. Çözelti RT'ye soğuduktan sonra 1 mL fosfat stoku, 1 mL Na2CO3 stok ve 10 mL NaHCO3ekleyin ve 1 M HCl ile pH 7,6−7,8'e ayarlayın.
  3. LB-BG11 agar plakaları (1.5% [w/v])
    1. 700 mL deiyonize su ve 15 g agar'ı cam bir şişede birleştirin. İkinci bir şişede 186 mL su, 10 mL 100x BG11, 1 mL eser eleman ve 1 mL demir stoğu ekleyin. Otoklav her iki çözüm.
    2. Çözeltiler yaklaşık 60 °C'ye kadar soğuduktan sonra, bunları birleştirip 1 mL fosfat stoğu, 1 mL Na2CO3 stok, 10 mL NaHCO3 stok ve 50 mL LB steril orta, 25 ile son bir hacim vermelidir LB-BG11 agar orta mL.
  4. BG11+Kan50 agar plakaları (%1.5 [w/v])
    1. 700 mL deiyonize su ve 15 g agar'ı cam bir şişede birleştirin. İkinci bir şişede 3 g sodyum tiyosülfat (Na2S2O3),226 mL su, 10 mL 100x BG11 stok, 1 mL eser element ve 1 mL demir stoğu ekleyin. Otoklav her iki çözüm.
    2. Çözeltiler yaklaşık 60 °C'ye kadar soğuduktan sonra, bunları birleştirip 1 mL fosfat stoğu, 1 mL Na2CO3 stok, 10 mL TES tampon stok ve 10 mL NaHCO3 stoku ekleyip, son hacmi ni vermelidir 1 L. Kanamisin sülfat ekleyin. 50 μg/mL'lik son konsantrasyona ve 35 mL orta ile Petri kapları dökmeye.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Golden Gate montaj iş akışını göstermek için, aşağıdaki Seviye 0 parçalarını içeren Düzey 1 pozisyonu 1 (İleri) alıcı vektöründe (pICH47732) bir ifade kaseti monte edildi: C-phycocyanin operon Pcpc560'ın organizatörü (pC0.005), eYFP (pC0.008) ve çift terminatör TrrnB (pC0.082)12için kodlama sırası. Montaj reaksiyonunun dönüşümünden sonra, E. coli kolonilerinin standart mavi-beyaz taraması kullanılarak başarılı derlemeler tespit edilmiştir(Şekil 3). Düzey 1 vektörü ndeki EYFP ifade kaseti ve End-Link 1 vektörü (pICH50872) daha sonra t-pppBA-eYFP vektörünü vermek için T düzeyi alıcı vektörü (pPMQAK1-T) içine monte edilmiştir (Şekil 4A). Monte edilmiş cpcBA-eYFP vektörü kısıtlama sindirimi ile doğrulandı (Şekil 4B).

CpcBA-eYFP veya boş pPMQAK1-T vektörünün başarılı çekim transferi (yani, eYFP ifade kasetinden yoksun negatif bir kontrol) Synechocystis PCC 6803 için membranda birkaç yüz koloninin büyümesine neden oldu ve S. uzatüs UTEX 2973 sonra 7−14 gün ve 3−7 gün, sırasıyla (Şekil 5). Bireysel koloniler taze BG11+Kan50 agar plakaları üzerine seçilmiş ve çizgili; Axenik kültürler oluşturmak için 2−3 yeniden çizgi ye ihtiyaç vardı.

Güçlü Pcpc560 promotör51için beklendiği gibi, plaka okuyucuve akış sitometreden hücre başına eYFP floresansı normalleştirilmiş eYFP floresaniçin değerler negatif kontrole göre yüksekti (Şekil 6 ve Şekil 7). Floresan değerleri S. uzatuu UTEX 2973'te Synechocystis PCC 680312'yegöre daha yüksekti.

Figure 1
Şekil 1: CyanoGate'teki Golden Gate montaj sürecine genel bakış. Bir gen ekspresyonu kasetinin montajı, şablon DNA'dan T düzeyinde bir vektörde montaja kadar bir ilgi dizisinin amplifikasyonundan başlayarak gösterilir (parçalar ölçekle çizilmez). (A) Şablon DNA'dan (örn. genomik veya plazmid DNA) CDS1 parçasının amplifikasyonu için ileri ve geri astar tasarımı. BpiI kısıtlama sitelerinin konumları ve kabul vektörü (yani, 5' ve 3' şablon dizisinin) eklenmesi için gerekli olan çıkıntılar sırasıyla kırmızı ve mavi renkte vurgulanır. "n" harfi, herhangi bir NT'nin bu konumda kullanılabileceğini belirtir. DNA şablonu ve önerilen erime sıcaklıkları (Tm)ile astarların annealing bölgeleri belirtilir. (B) PCR ürününün Seviye 0 CDS1 alıcı vektörpICH41308'e montajı. BpiI tarafından çıkarılacak ve kabul edici vektöre bağlanan dizi mavi ile vurgulanır. (C) Seviye 1, BsaI kullanılarak Seviye 1 pozisyonu 1 (ileri) kabul vektörpICH47732'ye üç Seviye 0 parça (Pro + 5U, CDS1 ve 3U + Ter) içeren bir gen ekspresyonu kasetinin 1. (D) Seviye 1 montaj ve End-Link 1 (pICH50872, "Seviye M End-link 1" Engler ve ark.15)bir Seviye T kabul vektörü (örneğin, pPMQAK1-T) BpiI kullanarak olarak adlandırılan Düzey T montaj. (E) Son monte edilen T düzeyi vektörü. Kısaltmalar: AmpR, ampisilin direnç kaseti; CarbR, carbenicillin direnç kaseti; CDS1, Düzey 0 sözdizimi15kodlama sırası ; EL1, End-Link 1 parçası; KanR, kanamisin direnç kaseti; lacZα, β-galaktosidaz ifade kaseti; SpecR, spectinomisin direnç kaseti. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 2
Şekil 2: Yasadışı bir Tip IIS kısıtlama sitesinin kaldırılması için PCR tabanlı bir evcilleşme stratejisi. (A) Bir BpiI sitesini (GAAGAC) GAGGAC'a dönüştürmek için iki astar çiftini (sırasıyla yeşil ve turuncu olarak) gösteren şematik diyagram, CDS1 Düzey 0 alıcı vektörüne (pICH41308) montajı amaçlanan bir protein kodlama DNA dizisiiçinde. Modifikasyon glutamik asit için kodonu koruduğunu unutmayın (Glu) (yani, GAA GAG için). BpiI sitesi başlangıç kodonu yla çerçeve içinde gösterilmiş olsa da, site çerçeveiçinde olmasa bile bu yaklaşım çalışır (örn. site bozulduve protein dizisi korunduğu sürece). BpiI kısıtlama sitelerinin konumları ve astarlarda çıkıntılar sırasıyla kırmızı ve mavi renkte vurgulanır. DNA şablonu ve çevrilen protein dizisi sarı renkte vurgulanır. DNA şablonu ve önerilen erime sıcaklıkları (Tm)ile astarların annealing bölgeleri belirtilir. Turuncu çifti overhangs AATG ve TGAA (parça 1) ile dizinin 5 ' sonu yükseltmek için kullanılır, yeşil çifti çıkıntıları TGAA ve GCTT (parça 2) ile 3 ' ucunu yükseltmek için kullanılır. Astarları sipariş etmeden önce, Fragman 1 ve 2 için TGAA füzyon çıkıntısının doğruluğu52'yidikkatle kontrol etti. Kötü tasarlanmış füzyon çıkıntıları montaj hatasına yol açabilir (örneğin, dönüşümü izleyen koloniler yok; Şekil 5) veya yanlış pozitif (örneğin, kesilmiş veya hatalı derlemeler). İkincisi doğru monte edilmiş bir yapı tanımlamak için beyaz koloniler daha fazla sayıda tarama olarak çözülebilir. (B) Golden Gate montajı sırasında BpiI ile sınırlanındıktan sonra 1 ve 2'lik parçaların amfikonları. (C) Evcilleştirilmiş sıra, Düzey 0 CDS1 kabul vektörüne monte edilmiştir. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 3
Şekil 3: Golden Gate montajını takiben E. coli transformantlarının mavi-beyaz koloni taraması. Gösterilen plakalar LB agar içerir (1% [w / v]) X-Gal ile takviye, IPTG ve antibiyotikler uygun konsantrasyonlarda. (A) Başarısız bir montaj reaksiyonu ve/veya E. coli dönüşümü öneren koloni yok. (B) Çoğunlukla mavi koloniler, başarılı bir montaj gösteren, ancak montaj reaksiyonu kullanılan restriksiyon enziminin verimliliği düşüktü. (C) Çoğunlukla beyaz koloniler, tipik, başarılı bir montaj reaksiyonu göstergesidir. (D) Çok verimli bir montaj gösteren mavi koloniler yok. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 4
Şekil 4: Birleştirilmiş T düzeyi vektörünün kısıtlama sindirimi ile doğrulanması. Vektörler HindIII ve BamHI ile sindirilmiştir. (A) Boş pPMQAK1-T alıcı vektörü (CT.0) ve Seviye T tertibatının(cpcBA-eYFP) eYFP ifade kasetinin bileşenlerini gösteren sıralı haritası (Pcpc560-eYFP-TrrnB). HindIII ve BamHI için kısıtlama sitelerinin konumları belirtilmiştir. Çift sindirimden sonra, DNA parçalarının öngörülen boyutları gösterilir: (1) 5,847 bp, (2) 2.004 bp, (3) 30 bp, (4) 374 bp, (5) 1.820 bp, (6) 1.289 bp, ve (7) 156 bp.(B)Bir agarose jel (0.8% [w/v]) 125 V 60 dk sindirilmiş Seviye ile yüklü çalıştırın T montaj(cpcBA-eYFP) bantları gösteren 1, 5 ve 6, sindirilmiş boş pPMQAK1-T alıcı vektörü (CT.0) bantları gösteren 1 ve 2 ve DNA merdiveni(Tablo Malzemeler). 3, 4 ve 7 bantlarının jelüzerinde görselleştirilemeyecek kadar küçük olduğunu unutmayın. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 5
Şekil 5: Transgenik Synechocystis PCC 6803 kolonilerinin başarılı konjugasyon sonrası büyümesi. BG11+Kan50 agar plakalarında kuluçka sonrası membran örnekleri gösterilmiştir. (A) Çok verimli konjugasyon-Synechocystis PCC 6803 kolonileri aşağıdaki overgrowth bireysel koloniler ile bir çim haline gelmiştir. (B) 12 gün sonra birkaç yüz ayrı kolonigösteren iyi bir çekim verimliliği. (C) Taze bir BG11 + Kan50 agar plaka üzerine yeniden çizgili birkaç tur aşağıdaki 14 gün sonra bir axenic gerginlik büyüme. Bakteriyel kontaminasyonun olmaması Synechocystis PCC 6803 transkonjugantunun axenik olduğunu gösterdi. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 6
Şekil 6: Temsili büyüme verileri ve normalleştirilmiş eYFP floresan değerleri bir plaka okuyucu kullanarak. (A) Synechocystis PCC 6803 ve S. uzayan UTEX 2973'te cpcBA-eYFP veya boş pPMQAK1-T vektörü (CT.0, negatif kontrol) taşıyan suşların büyüme karşılaştırması. Değerler, ± SE'nin dört biyolojik kopyadan elde edilen araçlardır. Synechocystis PCC 6803 ve S. uzalı UTEX 2973, sırasıyla 30 °C'de 72 saat boyunca sürekli ışık (100 μmol foton m-2s-1)ve 40 °C 300 μmol foton m-2s-1ile kültüre alındı. (B) Synechocystis PCC 6803 veya S. uzamış UTEX 2973 için normalleştirilmiş eYFP floresan değerleri 72 h. Değerler de cpcBA-eYFP ile konjuge dört biyolojik çoğaltmadan ± SE anlamına gelir. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 7
Şekil 7: Bir akış sitometresi kullanarak temsili eYFP floresan değerleri. (A)Forward (FSC-H) ve yan (SSC-H) dağılım çizimi "boş" orta çözeltiden (BG11 ve PBS). (B) Synechocystis PCC 6803 örneği için dağılım çizimi (sağda). Daire, örnek sinyalin geri kalanından siyanobakteri popülasyonuna bakan seçili bölgeyi gösterir. (C) Boş pPMQAK1-T vektörünü taşıyan bir gerilme için kapılı bölgenin histogramı (CT.0, negatif kontrol). (D) Kapılı bölgenin histogramı cpcBA-eYFP taşıyan bir gerginlik için. (E) eYFP floresans değerleri Synechocystis PCC 6803 ve S. uzamış UTEX 2973 72 h. Negatif kontrolden floresan çıkarılır. Değerler, ± SE'nin dört biyolojik kopyadan elde edilen araçlardır. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

№. Vektör Kimliği Adı Açıklama 5' çıkıntı 3' çıkıntı
1 pICH41233 Pro Organizatörü GGAG Nezaket
2 pICH41295 Pro + 5U Organizatör ve 50 çevrilmemiş bölge GGAG AATG
3 pAGM1251 Pro + 5U (f) N terminal füzyonları için promotör ve 50 çevrilmemiş sıra GGAG CCAT
4 pICH41246 5u 5ˈ çevrilmemiş bölge Nezaket CCAT
5 pAGM1263 5U (f) N terminal füzyonları için 5' çevrilmemiş sıra Nezaket CCAT
6 pICH41246 5U + NT1 5ˈ çevrilmemiş bölge ve N terminal kodlama bölgesi Nezaket CCAT
7 pAGM1276 NT1 N terminal etiketi veya yerelleştirme sinyali CCAT AATG
8 pICH41258 Sp Sinyal peptid AATG AGGT
9 pICH41258 NT2 N terminal etiketi veya yerelleştirme sinyali AATG AGGT
10 pAGM1287 CDS1 ns Stop kodonu olmadan kodlama bölgesi AATG TTCG
11 pICH41308 CDS1 durağı Stop kodonu ile kodlama bölgesi AATG GCTT
12 pAGM1299 CDS2 ns Kodlama bölgesi - kodon başlatma ve durdurma olmadan AGGT TTCG
13 pICH41264 CDS2 durağı Kodlama bölgesi - başlangıçsız ve stop kodonu ile AGGT GCTT
14 pAGM1301 Ct C terminal etiketi veya yerelleştirme sinyali TTCG GCTT
15 pICH53388 3U 3ˈ çevrilmemiş bölge GCTT GGTA
16 pICH53399 Ter Sonlandırıcı GGTA CGCT
17 pICH41276 3U + Ter 3ˈ çevrilmemiş bölge ve terminatör GCTT CGCT
18 pICH41331 Cgm Komple gen kasetleri için kabul GGAG CGCT
19 pCA0.002 Pro (düşük kopya) Organizatör, düşük kopya numarası alıcısı (pSC101 ori) GGAG Nezaket
20 pCA0.001 Profesyonel TSS Transkripsiyon başlangıç sitesine kesilen organizatör GGAG TAGC
21 Doğrudan Düzey 1'e srRNA Küçük düzenleyici RNA (çevirisusturma için) TAGC GTTT
22 Doğrudan Düzey 1'e sgRNA Tek kılavuz RNA (CRISPRi için) TAGC GTTT
23 pICH41295 UP KANADı Hedef homolog rekombinasyon alanının yukarı doğru yan sırası GGAG AATG
24 pICH41276 ALT KANRISI Hedef homolog rekombinasyon bölgesinin yan dizilimi GCTT CGCT

Tablo 1: Kullanılabilir Düzey 0 kabul vektörleri ve çıkıntıların listesi. Vektörler 1−18 Bitki MoClokiti 15'tendir. Vektörler 19−22 CyanoGate kiti12'den. srRNA ve sgRNA parçaları için sentezlenmiş diziler veya PCR ürünleri doğrudan Düzey 1 alıcı vektörlerine monte edilir. Vektörler 23−24, CyanoGate kiti kullanılarak homolog rekombinasyon ile dönüşüm için yeniden tasarlanmış Olan Bitki MoClo kitinden alınmıştır.

BpiI montaj bileşenleri (Düzey 0, T) BsaI montaj bileşenleri (Düzey 1)
50−100 ng kabul vektörü 50−100 ng kabul vektörü
Eklemek için her vektör/parça için, kesici uç 2:1 oranı kullanın: kabul eden vektör. Eklemek için her vektör/parça için, kesici uç 2:1 oranı kullanın: kabul eden vektör.
2 μL 10 mM ATP (Malzeme Tablosu) 2 μL 10 mM ATP (Malzeme Tablosu)
2 μL arabellek G (BpiI/BsaI için tampon) 2 μL arabellek G (BpiI/BsaI için tampon)
2 μL BSA (10x) (Malzeme Tablosu) 2 μL BSA (10x) (Malzeme Tablosu)
10 adet BpiI (1 μL10 U/μL BpiI, Malzeme Tablosu) 10 adet BsaI (1 μL 10 U/μL BsaI, Malzeme Tablosu)
dH2O ile 20 μL'ye getirin. dH2O ile 20 μL'ye getirin.
200 adet T4 DNA ligaz (1 μL 200 U/μL, Malzeme Tablosu) 200 adet T4 DNA ligaz (1 μL 200 U/μL, Malzeme Tablosu)
Termocycler protokolü (Seviye 0, T) Thermocycler protokolü (Seviye 1)
10 dk için 37 °C döngü x 5 10 dk için 37 °C döngü x 5
10 dk için 16 °C 10 dk için 16 °C
20 dk için 37 °C 20 dk için 37 °C
10 dk için 65 °C 10 dk için 65 °C
16 °C (bekleme) 16 °C (bekleme)

Tablo 2: 0, 1 ve T seviyelerinde Altın Kapı montajları için protokoller. Düzey 0 ve Seviye T kabul vektörlerinde montaj, restriksiyon enzimi BpiI (solda) kullanır. Seviye 1 kabul veya vektörlerde montaj restriksiyon enzimi BsaI (sağda) kullanır. Bu tablo Vasudevan ve ark.12'denuyarlanmıştır.

Astar No Sıra (5'-3') Uzunluk (bp) Açıklama
L0T ileri GTCTCATGAGCGGATACATA
TTTGAATG
28 Seviye 0 ve Seviye T'den amplifikasyon için
L1 ters GAACCCTGTGGTTGGCATGC
ACATAC
26 Düzey 1'den amplifikasyon için
L1 ileri CTGGTGGCAGGATATGT
GGTG
24 Düzey 1'den amplifikasyon için
L0T ters TTGAGTGAGCTGATACCGCT 20 Seviye 0 ve Seviye T'den amplifikasyon için

Tablo 3: Düzey 0, 1 ve T vektörlerinin PCR doğrulaması veya dizilimi için astarlistesi.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Golden Gate montaj ölçeklenebilirlik açısından özellikle diğer vektör montaj yöntemleri ile karşılaştırıldığında çeşitli avantajları vardır20,21. Bununla birlikte, Golden Gate sistemini bir laboratuvarda kurmak, çeşitli parçalar ve kabul vektör kitaplıkları ve genel montaj süreçleri ile ilgili bir aşinalık geliştirmek için zaman gerektirir. Daha karmaşık derlemeler için veya çok sayıda karmaşık derlemeyi paralel olarak gerçekleştirirken (örneğin, birden fazla gen ekspresyonu kaseti içeren T düzeyinde vektörler paketi yapmak) dikkatli planlama gereklidir. Önce gerekli tüm gen ekspresyonu kaset kombinasyonlarını listelemenizi ve daha sonra iş akışını 0'dan Seviye T'ye silico olarak eşleştirmenizi öneririz. Bu işlem sırasında, kullanıcılar Seviye 1 "Kukla" parçaları Seviye T (örneğin, Seviye 1 pozisyon 1 ve pozisyon 3 vektörleri "Dummy" parçası ile birlikte monte edilebilir) sıralı olmayan Düzey 1 vektörlerin montajı için izin Bitki MoClo kiti mevcut dikkate almalıdır Seviye 1 pozisyon 2), montaj reaksiyonları ve klonlama adımları toplam sayısını azaltabilir15.

DNA sentezi genellikle yeni Seviye 0 parçaları oluşturmak için en basit yöntemdir. Ancak, klonlama gerektiğinde (örn. plazmidlerden veya genomik DNA'dan), amplifikasyon için kullanılan astarların tasarımının optimize edilmesi sonraki Seviye 0 vektör montajının verimliliğini en üst düzeye çıkarmak için önemlidir. Astar tasarımında en kritik iki adım şunlardır: 1) doğru çıkıntıların dahil edilip, ileri ve geri astarlar için uygun yönde olup olmadığını kontrol etmek(Şekil 1 ve Tablo 1), ve 2) astar uzunluğunun şablona anneals yeterince uzun (18−30 bp) ve bu dizi için Tm değeri (ideal olarak 58−62 °C) astar çifti için benzer(Şekil 1A)sırası. Bir dizi evcilleştirinimi gerektiriyorsa, çeşitli stratejiler kullanılabilir. Kısa sekmeler için (örn. <200 bp), bir çift uzun ileri ve ters astar, 3' ün birbirine çift etekli olarak bittiği (yani,>20 bp'nin çakışması) ve amplifikasyon dan sonra çift iplikli bir dizi oluşturacak şekilde tasarlanabilir. Daha uzun diziler için, sıranın ayrı parçaları, yasa dışı kısıtlama sitelerini ortadan kaldıran ve daha sonra Altın Kapı montaj yaklaşımı kullanılarak monte edilen ayrı parçalar yükseltilebilir(Şekil 2). PCR ürünleriyle montaj verimliliği düşükse, Düzey 0 dizisinin tek tek parçaları Düzey 1 evrensel alıcı vektörüne (pAGM1311) klonlanabilir, doğrulanabilir ve daha sonra uygun Düzey 0 alıcıvektör15'tebir araya getirilebilir. 2:1 kesici uç:koruyucu vektör molar oranı verimli Golden Gate montajı için önerilir. Ancak, sadece 2-3 vektör (örneğin, iki Düzey 0 parça ve bir Seviye 1 kabul vektörü) derlemeleri için, her birinin ~100 ng'sini biraraya getirmek genellikle başarılı derlemelerle sonuçlanır. Reaksiyon başına kullanılan vektör lerin sayısı arttıkça montajların verimliliği azalma eğilimindedir ve dönüşümden sonra beyaz kolonilerin toplam sayılarının azalmasına neden olur(Şekil 3).

Konjugasyondan önce, kesinleşmiş T düzeyi vektörlerinin kısıtlama özeti ve PCR ile doğrulanması önerilir. Konjugal DNA transferi siyanobakteriyel suşları için iyi bıçaklanan bir tekniktir, doğal olarak dönüştürülebilir olmayanlar da dahil olmak üzere41,45. Konjugasyon protokolünde önemli adımlar şunlardır: 1) yardımcı E. coli suşu nun gece büyümesini takiben dikkatli bir şekilde kullanılması (örneğin, girdaplardan kaçınmak)35, 2) yardımcı büyümek için kullanılan antibiyotiklerin izlerini tamamen kaldırmaya özen göstermektedir ve kargo E. coli suşları, 3) kargo ve yardımcı suşları ve siyanobakterilerin karışımı için uygun bir kuluçka dönemi (örneğin, daha uzun bir kuluçka süresi S. uzauv UTEX 2973 için kritikti) ve 4) hücrenin ilk transfer dönemi LB-BG11 agar plakaları membranlar üzerinde karışımı 24 saat için antibiyotik yoksun.

Synechocystis PCC 6803 ve S. uzamış UTEX 2973 için iki hafta içinde membranda izole siyanobakteriyel koloniler oluşmalıdır, aksi takdirde konjugasyonun başarısız olması muhtemeldir. Daha yüksek başlangıç yoğunluğuna sahip siyanobakteriyel kültür (örneğin, OD750 = 1,5−2) kullanılarak protokolde yapılan çeşitli değişiklikler test edilebilir; 2) membrana transfer edilmeden önce kuluçka süresini artırmak; ve 3) membran üzerindeki ilk kuluçka süresini 24 saatten 48 h'ye kadar uzatmak (yani, transfer vektörü üzerindeki antibiyotik direnç geninin ekspresyonuna daha fazla zaman tanımak için). Konjugasyon hala başarısız olursa, elektroporasyon gibi alternatif yöntemler denenebilir53. Transgenik siyanobakteriyel bir suş teyit axenic daha fazla deney öncesinde önemlidir. Son olarak, transgenik siyanobakteriyel suş heterolog vektör boyutunu onaylamak için iyi bir uygulamadır. İkincisi DNA ekstraksiyonu (bölüm 5), E. coli ve seçime (bölüm 2.1) ve vektör doğrulaması (bölüm 2.4) dönüştürmeyi gerektirir.

Ana hatlarıyla anahatlarıyla yapılan promoter karakterizasyon protokolü, yüksek iş hacmi tarama metodolojisi elde etmek için küçük kültür hacimlerini (örneğin, 2 mL) kullanır. Daha büyük hacimler mevcut fotobiyoreaktör alanı bağlı olarak kullanılabilir, hangi kültür buharlaşma sorunları azaltmak için yardımcı olacaktır. Küçük kültür hacimli yüksek iş hacmi taraması gerekiyorsa, buharlaşmayı engellemek için büyüme odası içinde yüksek neme sahip olmak esastır. Bir büyüme deneyi sırasında buharlaşma, numune ölçümlerinin doğruluğuna ve geçerliliğine zarar verebilir. Ne kadar buharlaşma meydana geldiğini doğrulamak için deney sırasında ve sonrasında kültür hacimlerini kontrol edin.

Plaka okuyucu ölçümleri için, güvenilir ve tekrarlanabilir büyüme ve floresan verilerinin elde edilmesini sağlamak için ideal olarak OD750 < 1 olmak üzere düşük yoğunluktaki kültürleri ölçmek önemlidir. Hücre sayısı ile OD750 arasındaki doğrusal ilişki sadece belirli bir aralık54içinde gözlenir. Bu aralığı oluşturmak için, eYFP floresanının doğrulandığı bilinen bir transformant kullanarak seri seyreltme (örneğin, OD750 = 0.1−1.0)'den bir seri seyreltme gerçekleştirmenizi öneririz. Normalleştirilmiş floresansa (eYFP floresan/OD750)karşı mutlak floresan çizmek, kültür yoğunluklarının doğrusal çalışma aralığının belirlenmesine yardımcı olacaktır. Birkaç plaka okuyucular floresan dedektörü hassasiyetini değiştirmek için bir "kazanç" özelliği içerir. Bu durumda, kazanç değeri denemeye başlamadan önce uygun bir düzeye ayarlanmalı ve farklı deneme çalıştırmaları arasında değiştirilmemelidir veya veriler doğrudan karşılaştırılabilir olmayacaktır.

Farklı akış sitometrelerinin çalışması üreticiler arasında farklılık gösterse de, herhangi bir arka plan sinyalinden hedef siyanobakteriyel popülasyonun tanımlanmasını ve gating in i (Şekil7A,B). Bunu takiben, negatif kontrol numunesinin floresan değerinin (örn. yabani bir tür türün) çıkarılması, yerel otofloresansın çıkarılmasına yardımcı olacaktır(Şekil 7C,D). Akış sitometresindeki fotoçarpan tüpü (PMT) gerilim parametresi, bir plaka okuyucudaki kazançla benzer bir fonksiyona sahiptir, yani dedektörün floresan sinyalinin yoğunluğuna olan hassasiyetini artırır veya azaltır. Plaka okuyucuda olduğu gibi, PMT gerilimi deneye başlamadan önce uygun bir seviyeye ayarlanmalıdır55. Ayarlandıktan sonra, PMT voltaj değeri farklı deneysel çalıştırmalar arasında tutulmalıdır veya veriler doğrudan karşılaştırılabilir olmayacaktır.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarların açıklayacak bir şeyi yok.

Acknowledgments

Yazarlar PHYCONET Biyoteknoloji ve Biyolojik Bilimler Araştırma Konseyi (BBSRC) Network Endüstriyel Biyoteknoloji ve Biyoenerji (NIBB) ve Endüstriyel Biyoteknoloji Yenilik Merkezi (IBioIC) mali destek için müteşekkiriz. GARG, AASO ve AP BBSRC EASTBIO CASE Doktora programı (hibe numarası BB/M010996/1), Consejo Nacional de Ciencia y Tecnología (CONACYT) Doktora programı ve IBioIC-BBSRC İşbirlikçi Eğitim Ortaklığı (CTP) Doktora programı, Sıra -sıyla. Conrad Mullineaux (Londra Queen Mary Üniversitesi) ve Poul Eric Jensen ve Julie Annemarie Zita Zedler'e (Kopenhag Üniversitesi) plazmid vektörü ve protokol katkıları ve tavsiyeleri için teşekkür ederiz.

Materials

Name Company Catalog Number Comments
5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal) Thermo Fisher Scientific R0404 Used in 2.1.3.
Adenosine 5′-triphosphate (ATP) disodium salt Sigma-Aldrich A2383 Used in Table 2.
Agar (microbiology tested) Sigma-Aldrich A1296-500g Used in 8.3.
Agarose Bioline BIO-41026 Used in 6.
Attune NxT Flow Cytometer Thermo Fisher Scientific - Used in 4.3.1.
Bovine Serum Albumin (BSA) Sigma-Aldrich A2153 Used in Table 2.
BpiI (BbsI) Thermo Fisher Scientific ER1011 Used in Table 2.
BsaI (Eco31I) Thermo Fisher Scientific ER0291 Used in Table 2.
Carbenicillin disodium VWR International A1491.0005 Used in 2.1.3.
Corning Costar TC-Treated flat-bottom 24 well plates Sigma-Aldrich CLS3527 Used in 4.1.3.
Dimethyl Sulfoxide (DMSO) Thermo Fisher Scientific BP231-100 Used in 3.6.2.
DNeasy Plant Mini Kit Qiagen 69104 DNA extraction kit. Used in 5.
FLUOstar Omega Microplate reader BMG Labtech - Used in 4.2.2.
GeneJET Plasmid Miniprep Kit Thermo Fisher Scientific K0503 Plasmid purification kit. Used in step 2.3.2.
Glass beads (0.5 mm diameter) BioSpec Products 11079105 Used in 5.2.
Glycerol Thermo Fisher Scientific 10021083 Used in 2.3.1, 3.6.2.
Isopropyl-beta-D-thiogalactopyranoside (IPTG) Thermo Fisher Scientific 10356553 Used in 2.1.3.
Kanamycin sulphate (Gibco) Thermo Fisher Scientific 11815-024 Used in 2.1.3.
Membrane filters (0.45 μm) MF-Millipore HAWP02500 Used in 3.3.7
Microplates, 96-well, flat-bottom (Chimney Well) µCLEAR Greiner Bio-One 655096 Used in 4.2.1.
Monarch DNA Gel Extraction Kit New England Biolabs T1020S Used in 1.1.2.2.
Monarch PCR DNA Cleanup Kit New England Biolabs T1030 DNA purification kit. Used in 1.1.2.3.
Multitron Pro incubator with LEDs Infors HT - Shaking incubator with white LED lights. Used in 4.1.4.
MyTaq DNA Polymerase Bioline BIO-21108 Used in 7.1.
NanoDrop One Thermo Fisher Scientific ND-ONE-W Used in 2.3.3.
One Shot TOP10 chemically competent E. coli Thermo Fisher Scientific C404010 Used in 2.1.1.
Phosphate buffer saline (PBS) solution (10X concentrate) VWR International K813 Used in 4.3.2.
Q5High-Fidelity DNA Polymerase New England Biolabs M0491S Used in 1.1.2.1.
Quick-Load 1 kb DNA Ladder New England Biolabs N0468S Used in Figure 4.
Screw-cap tubes (1.5 ml) Starstedt 72.692.210 Used in 3.6.3
Spectinomycin dihydrochloride pentahydrate VWR International J61820.06 Used in 2.1.3.
Sterilin Clear Microtiter round-bottom 96-well plates Thermo Fisher Scientific 612U96 Used in 4.3.1.
T4 DNA ligase Thermo Fisher Scientific EL0011 Used in Table 2.
TissueLyser II Qiagen 85300 Bead mill. Used in 5.2.

DOWNLOAD MATERIALS LIST

References

  1. Luan, G., Lu, X. Tailoring cyanobacterial cell factory for improved industrial properties. Biotechnology Advances. 36, (2), 430-442 (2018).
  2. Madsen, M. A., Semerdzhiev, S., Amtmann, A., Tonon, T. Engineering mannitol biosynthesis in Escherichia coli and Synechococcus sp. PCC 7002 using a green algal fusion protein. ACS Synthetic Biology. 7, (12), 2833-2840 (2018).
  3. Menin, B., et al. Non-endogenous ketocarotenoid accumulation in engineered Synechocystis sp. PCC 6803. Physiologia Plantarum. 166, (1), 403-412 (2019).
  4. Varman, A. M., Yu, Y., You, L., Tang, Y. J. Photoautotrophic production of D-lactic acid in an engineered cyanobacterium. Microbial Cell Factories. 12, (1), 1-8 (2013).
  5. Vavitsas, K., et al. Responses of Synechocystis sp. PCC 6803 to heterologous biosynthetic pathways. Microbial Cell Factories. 16, 140 (2017).
  6. Yang, G., et al. Photosynthetic production of sunscreen shinorine using an engineered cyanobacterium. ACS Synthetic Biology. 7, (2), 664-671 (2018).
  7. Nielsen, A. Z., et al. Extending the biosynthetic repertoires of cyanobacteria and chloroplasts. Plant Journal. 87, (1), 87-102 (2016).
  8. Nielsen, J., Keasling, J. D. Engineering cellular metabolism. Cell. 164, (6), 1185-1197 (2016).
  9. Stensjö, K., Vavitsas, K., Tyystjärvi, T. Harnessing transcription for bioproduction in cyanobacteria. Physiologia Plantarum. 162, (2), 148-155 (2018).
  10. Santos-Merino, M., Singh, A. K., Ducat, D. C. New applications of synthetic biology tools for cyanobacterial metabolic engineering. Frontiers in Bioengineering and Biotechnology. 7, 1-24 (2019).
  11. Lea-Smith, D. J., Vasudevan, R., Howe, C. J. Generation of marked and markerless mutants in model cyanobacterial species. Journal of Visualized Experiments. 111, e54001 (2016).
  12. Vasudevan, R., et al. CyanoGate: A modular cloning suite for engineering cyanobacteria based on the plant MoClo syntax. Plant Physiology. 180, (1), 39-55 (2019).
  13. Andreou, A. I., Nakayama, N. Mobius assembly: A versatile golden-gate framework towards universal DNA assembly. PLoS ONE. 13, (1), 1-18 (2018).
  14. Crozet, P., et al. Birth of a Photosynthetic Chassis: A MoClo toolkit enabling synthetic biology in the microalga Chlamydomonas reinhardtii. ACS Synthetic Biology. 7, (9), 2074-2086 (2018).
  15. Engler, C., et al. A Golden Gate modular cloning toolbox for plants. ACS Synthetic Biology. 3, (11), 839-843 (2014).
  16. Moore, S. J., et al. EcoFlex: A multifunctional MoClo kit for E. coli synthetic biology. ACS Synthetic Biology. 5, (10), 1059-1069 (2016).
  17. Pollak, B., et al. Loop assembly: a simple and open system for recursive fabrication of DNA circuits. New Phytologist. 222, (1), 628-640 (2019).
  18. Werner, S., Engler, C., Weber, E., Gruetzner, R., Marillonnet, S. Fast track assembly of multigene constructs using golden gate cloning and the MoClo system. Bioengineered Bugs. 3, (1), 38-43 (2012).
  19. Patron, N. J., et al. Standards for plant synthetic biology: a common syntax for exchange of DNA parts. New Phytologist. 208, (1), 13-19 (2015).
  20. Chao, R., Mishra, S., Si, T., Zhao, H. Engineering biological systems using automated biofoundries. Metabolic Engineering. 42, 98-108 (2017).
  21. Chambers, S., Kitney, R., Freemont, P. The Foundry: the DNA synthesis and construction Foundry at Imperial College. Biochemical Society Transactions. 44, (3), 687-688 (2016).
  22. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  23. Rosano, G. L., Ceccarelli, E. A. Rare codon content affects the solubility of recombinant proteins in a codon bias-adjusted Escherichia coli strain. Microbial Cell Factories. 8, 1-9 (2009).
  24. Cambray, G., et al. Measurement and modeling of intrinsic transcription terminators. Nucleic Acids Research. 41, (9), 5139-5148 (2013).
  25. Chen, Y. J., et al. Characterization of 582 natural and synthetic terminators and quantification of their design constraints. Nature Methods. 10, (7), 659-664 (2013).
  26. Münch, R., et al. Virtual Footprint and PRODORIC: An integrative framework for regulon prediction in prokaryotes. Bioinformatics. 21, (22), 4187-4189 (2005).
  27. Salis, H. M., Mirsky, E. A., Voigt, C. A. Automated design of synthetic ribosome binding sites to control protein expression. Nature Biotechnology. 27, (10), 946-950 (2009).
  28. Englund, E., Liang, F., Lindberg, P. Evaluation of promoters and ribosome binding sites for biotechnological applications in the unicellular cyanobacterium Synechocystis sp. PCC 6803. Scientific Reports. 6, 36640 (2016).
  29. Heidorn, T., et al. Synthetic biology in cyanobacteria engineering and analyzing novel functions. Methods in Enzymology. 497, 539-579 (2011).
  30. Thiel, K., et al. Translation efficiency of heterologous proteins is significantly affected by the genetic context of RBS sequences in engineered cyanobacterium Synechocystis sp. PCC 6803. Microbial Cell Factories. 17, 34 (2018).
  31. Liu, Q., Schumacher, J., Wan, X., Lou, C., Wang, B. Orthogonality and burdens of heterologous and gate gene circuits in E. coli. ACS Synthetic Biology. 7, (2), 553-564 (2018).
  32. Ferreira, E. A., et al. Expanding the toolbox for Synechocystis sp. PCC 6803: Validation of replicative vectors and characterization of a novel set of promoters. Synthetic Biology. (August), 1-39 (2018).
  33. Liang, F., Lindblad, P. Synechocystis PCC 6803 overexpressing RuBisCO grow faster with increased photosynthesis. Metabolic Engineering Communications. 4, 29-36 (2017).
  34. Taton, A., et al. Broad-host-range vector system for synthetic biology and biotechnology in cyanobacteria. Nucleic Acids Research. 42, (17), e136 (2014).
  35. Elhai, J., Wolk, C. P. Conjugal transfer of DNA to cyanobacteria. Methods in Enzymology. 167, (1984), 747-754 (1988).
  36. Gormley, E. P., Davies, J. Transfer of plasmid RSF1010 by conjugation from Escherichia coli to Streptomyces lividans and Mycobacterium smegmatis. Journal of Bacteriology. 173, (21), 6705-6708 (1991).
  37. Huang, H. H., Camsund, D., Lindblad, P., Heidorn, T. Design and characterization of molecular tools for a synthetic biology approach towards developing cyanobacterial biotechnology. Nucleic Acids Research. 38, (8), 2577-2593 (2010).
  38. Huang, H. H., Lindblad, P. Wide-dynamic-range promoters engineered for cyanobacteria. Journal of Biological Engineering. 7, 10 (2013).
  39. Li, S., Sun, T., Xu, C., Chen, L., Zhang, W. Development and optimization of genetic toolboxes for a fast-growing cyanobacterium Synechococcus elongatus UTEX 2973. Metabolic Engineering. 48, 163-174 (2018).
  40. Pansegrau, W., Balzer, D., Kruft, V., Lurz, R., Lanka, E. In vitro assembly of relaxosomes at the transfer origin of plasmid RP4. Proceedings of the National Academy of Sciences, USA. 87, (17), 6555-6559 (1990).
  41. Song, K., Tan, X., Liang, Y., Lu, X. The potential of Synechococcus elongatus UTEX 2973 for sugar feedstock production. Applied Microbiology and Biotechnology. 100, (18), 7865-7875 (2016).
  42. Waters, V. L., Guiney, D. G. Processes at the nick region link conjugation, T-DNA transfer and rolling circle replication. Molecular Microbiology. 9, (6), 1123-1130 (1993).
  43. Elhai, J., Vepritskiy, A., Muro-Pastor, A. M., Flores, E., Wolk, C. P. Reduction of conjugal transfer efficiency by three restriction activities of Anabaena sp. strain PCC 7120. Journal of Bacteriology. 179, (6), 1998-2005 (1997).
  44. Silva-Rocha, R., et al. The Standard European Vector Architecture (SEVA): A coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research. 41, (D1), D666-D675 (2013).
  45. Mandakovic, D., et al. CyDiv, a conserved and novel filamentous cyanobacterial cell division protein involved in septum localization. Frontiers in Microbiology. 7, (FEB), 1-11 (2016).
  46. Masukawa, H., Inoue, K., Sakurai, H., Wolk, C. P., Hausinger, R. P. Site-directed mutagenesis of the Anabaena sp. strain PCC 7120 nitrogenase active site to increase photobiological hydrogen production. Applied and Environmental Microbiology. 76, (20), 6741-6750 (2010).
  47. Yu, J., et al. Synechococcus elongatus UTEX 2973, a fast growing cyanobacterial chassis for biosynthesis using light and CO2. Scientific Reports. 5, (1), 8132 (2015).
  48. Ungerer, J., Wendt, K. E., Hendry, J. I., Maranas, C. D., Pakrasi, H. B. Comparative genomics reveals the molecular determinants of rapid growth of the cyanobacterium Synechococcus elongatus UTEX 2973. Proceedings of the National Academy of Sciences, USA. 115, (50), E11761-E11770 (2018).
  49. Lepesteur, M., Martin, J. M., Fleury, A. A comparative study of different preservation methods for phytoplankton cell analysis by flow cytometry. Marine Ecology Progress Series. 93, (1-2), 55-63 (1993).
  50. Day, J. G. Cryopreservation of cyanobacteria. Cyanobacteria: An Economic perspective. Wiley Blackwell. New York. 319-327 (2014).
  51. Zhou, J., et al. Discovery of a super-strong promoter enables efficient production of heterologous proteins in cyanobacteria. Scientific Reports. 4, 4500 (2014).
  52. Potapov, V., et al. Comprehensive profiling of four base overhang ligation fidelity by T4 DNA ligase and application to DNA assembly. ACS Synthetic Biology. 7, (11), 2665-2674 (2018).
  53. Ravindran, C. R. M., Suguna, S., Shanmugasundaram, S. Electroporation as a tool to transfer the plasmid pRL489 in Oscillatoria MKU 277. Journal of Microbiological Methods. 66, 174-176 (2006).
  54. Stevenson, K., McVey, A. F., Clark, I. B. N., Swain, P. S., Pilizota, T. General calibration of microbial growth in microplate readers. Scientific Reports. 6, 38828 (2016).
  55. Maecker, H. T., Trotter, J. Flow cytometry controls, instrument setup, and the determination of positivity. Cytometry Part A. 69, (9), 1037-1042 (2006).
CyanoGate Modüler Klonlama Araç Kiti Kullanılarak Konjugasyon ile Siyanobakterilerin Genetik Modifikasyonu
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Gale, G. A. R., Schiavon Osorio, A. A., Puzorjov, A., Wang, B., McCormick, A. J. Genetic Modification of Cyanobacteria by Conjugation Using the CyanoGate Modular Cloning Toolkit. J. Vis. Exp. (152), e60451, doi:10.3791/60451 (2019).More

Gale, G. A. R., Schiavon Osorio, A. A., Puzorjov, A., Wang, B., McCormick, A. J. Genetic Modification of Cyanobacteria by Conjugation Using the CyanoGate Modular Cloning Toolkit. J. Vis. Exp. (152), e60451, doi:10.3791/60451 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter