Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

Применение трехмерной uniaxial механической системы стимуляции биореактора, чтобы вызвать теногенную дифференциацию стволовых клеток, полученных из тендрионов

doi: 10.3791/61278 Published: August 1, 2020
* These authors contributed equally

Summary

Трехмерная одноаксиальная механическая система стимуляции биореактора является идеальным биореактором для теногенной специфической дифференциации стволовых клеток, полученных из сухожилия, и формирования неопалендров.

Abstract

Тендинопатия является распространенным хроническим заболеванием сухожилий, связанных с воспалением и дегенерацией в ортопедической области. При высокой заболеваемости, ограниченных самовостимывающихся мощностях и, самое главное, отсутствии окончательного лечения, тендинопатия по-прежнему негативно влияет на качество жизни пациентов. Стволовые клетки, полученные из тендона (TDSCs), как первичные клетки-предшественники клеток сухожилий, играют важную роль как в развитии тендинопатии, так и в функциональном и структурном восстановлении после тендинопатии. Таким образом, метод, который может in vitro имитировать in vivo дифференциации TDSCs в сухожилия клеток было бы полезно. Здесь, настоящий протокол описывает метод, основанный на трехмерной (3D) uniaxial растяжения системы для стимулирования TDSCs дифференцировать в сухожилия, как ткани. Есть семь этапов настоящего протокола: изоляция мышей TDSCs, культура и расширение мышей TDSCs, подготовка среды культуры стимуляции для формирования клеточного листа, формирование клеточных листов путем культивирования в среде стимуляции, подготовка 3D сухожилия стволовых клеток построить, сборка одноасстекциального растяжения механического стимуляции комплекса, и оценка механических стимулировали в пробирке сухожилия, как ткань. Эффективность продемонстрировала гистология. Вся процедура занимает менее 3 недель. Для содействия внеклеточной матричной о осаждении, 4,4 мг/мл аскорбиновой кислоты был использован в среде культуры стимуляции. Отделенная камера с линейным двигателем обеспечивает точную механическую нагрузку и является портативной и легко регулируется, что применяется для биореактора. Режим загрузки в настоящем протоколе составил 6% напряжения, 0,25 Гц, 8 ч, а затем 16 ч отдыха в течение 6 дней. Этот протокол может имитировать дифференциацию клеток в сухожилии, что полезно для исследования патологического процесса тендинопатии. Кроме того, сухожилия, как ткань потенциально используется для содействия заживлению сухожилий в сухожилия травмы, как инженерии аутологичный трансплантат. Подводя итог, можно сказать, что нынешний протокол прост, экономизен, воспроизводен и действителен.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Тендинопатия является одним из распространенных спортивных травм. Это в основном проявляется боль, местные отеки, снижение мышечного напряжения в пораженной области, и дисфункции. Заболеваемость тендинопатией высока. Присутствие ахиллесовой тендинопатии наиболее распространено у бегунов средней и дальнего следования (до 29%), в то время как наличие у спортсменов волейбола (45%), баскетбола (32%), легкой атлетики (23%), гандбола (15%) и футбола(13%) 1,,2,,3,,4,,5. Однако, из-за ограниченной самовосстановления способности сухожилия, и отсутствие эффективных методов лечения, тендинопатия по-прежнему влияет на жизнь пациентов негативно6,7. Кроме того, патогенез тендинопатии остается неясным. Там было много исследований о его патогенеза, в основном в том числе "теория воспаления", "теория дегенерации", "теория чрезмерного использования", и такдалее 8. В настоящее время многие исследователи считают, что тендинопатия была из-за неудачного саморемонта микро-травм, вызванных чрезмерной механической нагрузкой сухожилия опытом9,10.

Тендоновые стволовые клетки (TDSCs), как основные клетки-предшественники клеток сухожилий, играют важную роль как в развитии тендинопатии, так и в функциональном и структурном восстановлении после тендинопатии11,,12,13. Сообщалось, что механическая стимуляция стресса может вызвать пролиферацию и дифференциацию остеоцитов, остеобластов, гладких мышечных клеток, фибробластов, мезенхимальных стволовых клеток и других чувствительных к силе клеток14,,15,,16,17,18. Таким образом, TDSCs, как один из механосчувствительных и многопотентных клеток, также может быть стимулирован, чтобы дифференцировать по механической нагрузке19,20.

Однако различные параметры механической загрузки (сила загрузки, частота погрузки, тип погрузки и период загрузки) могут вызвать дифференцирование TDSCs в различные ячейки21. Таким образом, эффективный и действительный механический режим загрузки очень важен для теномеза. Кроме того, существуют различные виды биореакторов в качестве систем стимуляции, которые в настоящее время используются для обеспечения механической нагрузки на ТДК. Принципы каждого вида биореактора различны, поэтому параметры механической загрузки, соответствующие различным биореакторам, также отличаются. Поэтому спросом пользуется простой, экономичный и воспроизводимый протокол стимуляции, включающий тип биореактора, соответствующую стимулирую среду и механический режим загрузки.

В настоящей статье описывается метод, основанный на трехмерной (3D) униасивной системы растяжения, чтобы стимулировать TDSCs дифференцировать в сухожилия, как ткани. Есть семь этапов протокола: изоляция мышей TDSCs, культура и расширение мышей TDSCs, подготовка среды культуры стимуляции для формирования клеточного листа, формирование клеточных листов путем культивирования в стимуляции среды, подготовка 3D сухожилия стволовых клеток построить, сборка uniaxial-растяжения механического стимуляции комплекса, и оценка механических стимулировали в пробирке сухожилия, как ткань. Вся процедура занимает менее 3 недель, чтобы получить 3D-клеточную конструкцию, которая намного меньше, чем некоторые существующие методы22,23. Настоящий протокол был доказан, чтобы быть в состоянии побудить TDSCs дифференцировать в сухожилия ткани, и это более надежным, чем в настоящее время обычно используется двумерная (2D) протягивающая система21. Эффективность продемонстрировала гистология. Короче говоря, нынешний протокол прост, экономистителен, воспроизводим и действителен.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Описанные методы были утверждены и осуществлены в соответствии с руководящими принципами и правилами Комитета по этике животных Университета Западной Австралии.

1. Изоляция мышей TDSCs

  1. Euthanize 6-8-недельных C57BL/6 мышей путем вывиха шейки матки.
  2. Урожай коленных сухожилий24 и ахиллово сухожилие25.
  3. Дайджест сухожилий от одного с 6 мЛ коллагеназы I типа (3 мг/мл) на 3 ч.
    ПРИМЕЧАНИЕ: Поскольку размер сухожилия в мыши мал, все сухожилия, собранные из одной мыши, должны быть использованы в этом шаге.
  4. Соберите клетки и культуру в полном минимальном существенном средстве (Альфа-MEM), содержащем 10% сыворотки крупного рогатого скота плода (FBS) и 1% стрептомицина и пенициллина в течение 7 дней.
  5. Определить TDSCs с помощью флуоресценции активированной клеточной сортировки по цитометрии потока (выражение маркеров поверхности клеток, включая CD44, CD90 и Sca-1; отсутствие выражения CD34 и CD45).
  6. Проходные и замораживаем ячейки (для дальнейших шагов будут использоваться 4 ячейки).

2. Культура и расширение мышей TDSCs

ПРИМЕЧАНИЕ: Проведите все шаги в стерильной биобезопасности капот.

  1. Возьмите разогретые клетки (мышей TDSCs, 1 миллион клеток, прохождение 4, до 37 градусов по Цельсию).
  2. Медленно добавляйте дополнительные 4-5 мл полного минимального основного среднего (Альфа-MEM).
  3. Перенесите смесь в центрифугную трубку 15 мл с пипеткой.
  4. Пополнить со средним до 8 мл всего с пипеткой.
    1. Пресельная среда в инкубаторе духовки 37 градусов по Цельсию.
  5. Поместите трубку в центрифугу и балансируйте.
  6. Центрифуги и гранулы клетки на 347 х г в течение 5 мин.
  7. Вынуть после центрифуги и проверить гранулы на дне.
  8. Декант замораживающую среду и резуспенированные клетки мягко в 1-2 мл полной среды (избегайте создания слишком большого количества пузырьков).
  9. Передача повторной зависимости в колбу Т-75 пипеткой.
  10. Используйте пипетки, чтобы добавить полный Альфа-MEM Medium в колбу, чтобы достичь общего объема 10 мл с окончательной концентрацией 13000 клеток / см2.
  11. Поместите колбу в инкубатор и культуру при 37 градусов по Цельсию с 5% CO2.
  12. Меняйте среду каждые 3 дня.
  13. Наблюдайте и следите за клетками под микроскопом при изменении среды до тех пор, пока клетки не будут культивируться до 100% слияния (около 40 000 клеток/см2).

3. Подготовка среды культуры стимуляции для формирования клеточных листов

ПРИМЕЧАНИЕ: Проведите все шаги в стерильной биобезопасности капот.

  1. Налейте 15 мл полной альфа-MEM среды в 15 мл стерильной трубки.
  2. Добавьте 6 мл аскорбиновой кислоты (11 мг/мл) в 15 мл среды для конечной концентрации 4,4 мкг/мл.
    ПРИМЕЧАНИЕ: Дополнительно добавление 25 нг/mL фактора роста соединительной ткани в среде культуры стимуляции может ускорить весь процесс роста и дифференциации.
  3. Смешайте осторожно, инвертируя вверх и вниз.

4. Формирование клеточных листов путем культивирования в среде стимуляции

ПРИМЕЧАНИЕ: Проведите все шаги в стерильной биобезопасности капот.

  1. Откажитесь от нормальной полной альфа-MEM среды тщательно, и избежать прикосновения к клеткам, прикрепленным к нижней части колбы.
  2. Добавить 10 мл стимуляции среды медленно и избежать вызывая какие-либо нарушения полностью сливаются клетки.
  3. Культура клеток в среде стимуляции в течение 9 дней (изменить среду каждые 3 дня), чтобы достаточно генерировать клеточный лист при 37 градусов по Цельсию с 5% CO2.
    ПРИМЕЧАНИЕ: Внеклеточная матрица станет толстой и присутствует, чтобы быть облачным, когда наблюдается со дна колбы после стимулируется аскорбиновой кислотой, что означает, что лист клеток достаточно генерируется.

5. Подготовка 3D сухожилия стволовых клеток построить

ПРИМЕЧАНИЕ: Проведите все шаги в стерильной биобезопасности капот.

  1. Вынимь колбу из инкубатора.
  2. Откажитесь от среды стимуляции полностью.
  3. Вымойте лист однослойной ячейки с фосфатным буферным солевым раствором (PBS) путем закрученного колбы.
  4. Откажитесь от PBS полностью.
  5. Используйте пипетки, чтобы добавить 1 мл 0,25% трипсина в угол колбы.
  6. Нажмите на угол колбы, чтобы де-прикрепить монослойный лист ячейки до тех пор, пока угол листа ячейки не будет от нижней части колбы.
  7. Немедленно добавьте 9 мл полной среды Alpha-MEM, чтобы остановить трипсинизацию.
  8. Продолжить закрученного колбу, чтобы снять монослойный лист ячейки полностью.
  9. Налейте общий де-прикрепленный лист ячейки в чашку Петри со средним.
  10. Используйте стерильный пинцет, чтобы забрать один угол листа клетки и повернуть в направлении по часовой стрелке в течение 15 раз.
  11. Возьмите еще один конец листа клетки и повернуть в направлении против часовой стрелки в течение 10 раз твердо генерировать сухожилия, как в пробирке(Рисунок 1A).

6. Сборка униаксиарного комплекса механической стимуляции в уникально разработанном биореакторе

ПРИМЕЧАНИЕ: Проведите все шаги в стерильной биобезопасности капот.

  1. Подключите крючки с помощью разъема и приспособитесь к нужному расстоянию (2 см) между двумя крючками.
  2. Аккуратно ветер 3D TDSCs построить на собранном крючке в течение 3 раз на каждом крючке (Рисунок 1B).
  3. Закрепите крючки с клеточной конструкцией на камеру биореактора, затягивая винты на двух концах.
    ПРИМЕЧАНИЕ: Вся камера, включая винты и крючки, стерильна (автоклав на 1,5 ч при 134 градусах Цельсия и ультрафиолетовые лучи (УФ) подвергаются в течение 24 часов до использования). Для металлического держателя камер УФ-излучение подвергает в течение 48 часов перед использованием.
  4. Заполните камеру с полной альфа-MEM среды.
  5. Подключите привод к камере культуры по кабелю.
  6. Вырезать крючки разъем стерильных ножниц.
  7. Включите питание и соответствующий контроллер канала, чтобы начать механическую стимуляцию.
  8. Положи крышку на камеру.
  9. Проверьте индикатор фары и убедитесь, что биореактор может функционировать должным образом.
  10. Положите биореактор в инкубатор и подвергнуть конструкцию 3D-клетки механическому растяжению в течение 6 дней (6% растяжения, 0,25 Гц, 8 ч, а затем 16 ч отдыха).

7. Оценка механической стимулированных в пробирке сухожилия, как ткань

  1. Ослабить винты отверткой и снять сборку тщательно.
  2. Положите сухожилия, как ткань в 4% параформальдегида для фиксации в течение 15 мин.
  3. Поместите фиксированное сухожилие, как ткань в биопсии кассеты с биопсией пены колодки.
  4. Процесс обезвоживания образца и, наконец, оценить по Гистологическому окрашивания H и E.
  5. Повторите весь протокол и извлеките РНК из сухожилия, как ткань для оценки экспрессии теногенных маркеров количественной ПЦР (qPCR). Праймеры для выбранных генов перечислены в таблице 1.
    ПРИМЕЧАНИЕ: Гистологический протокол и протокол qPCR являются стандартными и после предыдущего исследования21.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

До механической стимуляции, TDSCs были выращены до 100% слияния в полной среде и отображается дезорганизованной ультраструктурной морфологии (Рисунок 2A). После 6 дней одноаксиальной растяжения механической нагрузки, внеклеточная матрица (ECM) и выравнивание клеток были хорошо ориентированы(рисунок 2B). Клетки были хорошо заселены и хорошо окутаны ECM после механической загрузки. Морфология клеток была представлена, чтобы быть удлиненной и был больше похож на нормальную клетку сухожилия по сравнению с той, без растяжения (Рисунок 2C). Плотность ячейки в клеточной конструкции с загрузкой была выше, чем в той, которая без нагрузки. Результаты ПКР показали, что нынешний метод увеличил экспрессию теногенных маркеров, включая Scleraxis, Mohawk, Tenomodulin и COL1A1(Рисунок 3)по сравнению с теми, которые обрабатываются статической культурой.

Figure 1
Рисунок 1: Сборка трехмерных (3D) клеток построить над крючками биореактора. (A) Общий вид 3D-кельы построить над крючками. (B) Диаграмма для сборки 3D-ячейки построить над крючками. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой фигуры.

Figure 2
Рисунок 2: Морфология клеток до и после механической стимуляции. ()Тендон-производные стволовые клетки были выращены до 100% слияния в полной среде и отображается дезорганизованной ультраструктурной морфологии до механической стимуляции. (B) Гистологические изображения показали Н И E окрашивания клеточной конструкции после механической стимуляции. (C) Гистологические изображения показали Н И E окрашивания конструкции контрольной клетки культивируется в биореактор в течение 6 дней без механической стимуляции. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой фигуры.

Figure 3
Рисунок 3: Уровень экспрессии маркеров теномеза. Индивидуальные уровни экспрессии генов сначала нормализовались против внутреннего контроля, 36B4, а затем нормализовались против уровней экспрессии генов из статических культур. Показаны результаты 3 экспериментов. В таблице 1приведены последовательность грунтовки, используемые для анализа qPCR. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой фигуры.

Figure 4
Рисунок 4: Трехмерная одноаксиальная механическая система стимуляции биореактора. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой фигуры.

Ген Праймер последовательность
Вперед 5'-'gt;3' Обратный 5'-'gt;3'
COL1A1 ТГАКТГГАААГАГГАГГАГТ GTTCGGGCTGATGTACCAGT
Склераксис СКАААКАГАТКККАТТ GGCTCGTGTACTCTTCAG
Mohawk ГТККАГКАГАТТАГТЯГТЯГТЯГТЯГ. TCGCTGAGCTTTCTTTA
Теномодулин CCGCAGAAAAGCCTATTGAA ГАКККККАТКАТТЕКТЧКЧЕТК
36B4 CTTCCCACTTGCTGAAAAGG КГААГАГКААТКАТА

Таблица 1: Праймер последовательности, используемые для анализа qPCR

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Сухожилие является механосенцитивной волокнистой соединительной тканью. Согласно предыдущим исследованиям, избыточная механическая нагрузка может привести к остеогенной дифференциации стволовых клеток сухожилий, в то время как недостаточная загрузка приведет к неупорядоченной структуре коллагенового волокна во время дифференциации сухожилий21.

Общее мнение заключается в том, что ключом к идеальному биореактору является способность имитировать в пробирке клеточной микроокружения, что клетки in vivo пройти. Таким образом, имитация in vivo нормальной среды стресса in vitro является ключом стимулирования однолинейной дифференциации TDSCs в сухожилия клеток. В настоящем протоколе ширина конструкции TDSC составляла 2 см, а диапазон движения крючка - 0,12 см, что означает, что напряжение составило 0,12/2 (%). В заключение, TDSCs были механически стимулировали в биореактор в течение 6 дней (6%, 0,25 Гц, 8 ч, а затем 16 ч отдыха) в настоящем протоколе. После оценки, механические параметры нагрузки, используемые в этом протоколе, как было доказано, чтобы вызвать TDSCs для генерации сухожилия, как ткани. Следует отметить, что параметры биореактора должны конкретно соответствовать соответствующему типу системы растяжения. Например, правильные параметры для однослойного растяжения клеток отличаются от нынешнего 3D-клеточного листа, растянующегосяна 26,,27. Возможной причиной является различные режимы силы21. В 2D монослойной системе растяжения клетки прикрепляются к культурному субстрату с помощью фокусных спаек внизу и соединяются друг с другом через клеточные узлы. Тем не менее, в 3D-листе ячейки, Есть также гораздо больше ячейки-ECM соединения, образованные в результате 3D нишу, что означает, что клетки находятся под давлением в дополнение к растяжения.

Эффективность настоящего протокола продемонстрировала морфология и уровень экспрессии теногенных маркеров. С точки зрения морфологии, помимо гистологии, с использованием конфокальной иммунофлуоресценции микроскопии для обнаружения коллагена я является распространенным способом, чтобы охарактеризовать организацию коллагена, а затем оценить выравнивание ECM. Предыдущее исследование подтвердило хорошо выровненный коллаген типа I расслоение формирования в TDSC построить с 6% одноаксиальной механической стимуляции в течение 6 дней, но не в одном без загрузки21. Теногенные маркеры были использованы для идентификации клеток сухожилий, включая Scleraxis (SCX), Mohawk (MKX), Tenomodulin (TNMD) и COL1A1. Только TNMD был нетранскриционный фактор, а остальные из них транскрипциифакторов 28. Все они были хорошо признаны. SCX может регулировать развитие сухожилий в эмбриональной стадии29, в то время как MKX может регулировать дифференциацию сухожилий и созревания в послеродовой стадии30. Кроме того, механические свойства (максимальная нагрузка и жесткость) сухожилия, как ткань были оценены в предыдущем исследовании, а также, и он показал механические свойства TDSC построить с загрузкой были лучше, чем в одном без загрузки21.

Среда может повлиять на рост и дифференциацию клеток. В настоящем протоколе, для того, чтобы сформировать клеточный лист надлежащим образом, TDSCs были выращены до 100% слияния в стандартных неокрашенных пластиковых колб в полной среде, а затем TDSCs были стимулированы для содействия осаждения ECM путем добавления 4,4 мг/ мЛ аскорбиновой кислоты для 6 d. Несколько факторов роста, в том числе инсулиноподобный фактор роста I, сосудистый эндотелиальный фактор роста, фактор роста, полученный из тромбоцитов, основной фактор роста фибробластов, преобразующий фактор роста и фактор роста 5, сыграли важную роль в формировании сухожилий и заживлении31,,32,33,,34. Дополнительно добавление 25 нг/mL коэффициента роста соединительной ткани в среде культуры стимуляции, как Ni et al. сообщили может ускорить весь рост и процесс дифференциации35.

В настоящее время 2D-клеточный лист, также известный как монослойная ячейка, является наиболее распространенной системой, используемой для механических исследований. Биаксиальный стрейч обеспечивает многонаправленное напряжение, как продольное, так и властно, так как одноаксиальный участок обеспечивает только продольную напряженность36. Таким образом, монослойная клеточная культура с биаксиальной растяжкой может имитировать среду роста некоторых типов клеток, таких как кардиомиоциты и эпидермальные клетки. Тем не менее, конструкция 3D-клеток больше похожа на реальную форму сухожилия, а одноаксиальная растяжка больше похожа на стрессовые характеристики клеток сухожилий, по сравнению с 2D-клеточным листом и биаксиальным растяжением. Таким образом, сочетание конструкции 3D-клеток и одноаксиального растяжения является более компетентным для лучшего понимания сухожилия и его механической микро-среды. Это обеспечивает теоретическую основу для использования 3D униасийской системы растяжения для стимулирования дифференциации TDSCs. Таким образом, 2D-клеточный лист был, наконец, свернут в конструкцию 3D-ячейки и прошел одноаксиальный отрезок в настоящем протоколе.

Биореактор, используемый в настоящем протоколе, состоял из привода и камеры культуры(рисунок 4). Подробная информация о настоящем биореакторе доступна в предыдущем исследовании37. В настоящее время наиболее распространенными приводами, используемыми для сухожилий, являются пневматические приводы, линейные двигатели и степные мотобоуки38,,39,,40. Камеры включали интегрированные и разделенные камеры41,42. Среди них, отделенная камера с линейным двигателем при условии точной механической загрузки и был портативным и легко регулируется43.

За исключением TDSCs, другие типы стволовых клеток могут быть потенциальным источником клеток, которые будут использоваться в настоящем методе. Предыдущие исследования показали, что другие типы стволовых клеток могут иметь потенциальную терапевтическую способность и может улучшить регенерацию сухожилий. По сравнению с поврежденными сухожилиями лошади, обработанными обычным неклеточным управлением, скорость повторной травмы сухожилий, обработанных BMSCs, была ниже44,,45. Кроме того, интратендиновые инъекции BMSCs в модель тендинопатии может эффективно вызвать регенерацию сухожилий46. Адипоза полученных стволовых клеток может эффективно лечить лошадиные тендинопатии, ведущие к полному восстановлению и вернуться к нормальной деятельности у лошадей47. Вместе, было достаточно доказательств, чтобы предположить, что стволовые клетки, за исключением TDSCs, может лечить дегенерацию сухожилий. Однако, как предостережение к сведению, трансплантация BMSCs в поврежденных сухожилий было показано, чтобы вызвать эктопическую остеогенную дифференциацию в модели кролика, предполагая, что стволовые клетки из конкретной ткани могут иметь тенденцию дифференцировать в нежелательные клетки их ткани происхождения48. В предыдущих исследованиях, загрузка лишен лечения TDSCs может привести к остеогенезу, а также21, что привело к предложению, что нынешний метод имеет потенциал, чтобы вызвать теногенез других стволовых клеток и избежать остеогенеза с конкретным режимом загрузки. Необходимы дальнейшие исследования для изучения этих специфических режимов загрузки для других типов стволовых клеток. Если этот сценарий имеет место, больше источника клеток для лечения тендинопатии будут доступны.

Есть еще некоторые ограничения, которые должны быть признаны. Во-первых, хотя некоррозионный и автоклавамируемый материал, нержавеющая сталь, был использован для создания системы биореактора, культовые условия и культура среды по-прежнему разъедают камеру, включая винт и крюк. Таким образом, необходим плановый осмотр камеры и своевременное удаление ржавчины. Во-вторых, для того, чтобы сделать нынешний биореактор экономично и портативно, в нем нет системы экологического контроля и средней циркуляции. Таким образом, оператор должен транспортировать биореактор и открывать камеру для среднего обмена каждые 3 дня, что повышает риск заражения. Оператор должен всегда обращать внимание на сохранение среды TDSCs стерильной.

Для лечения тендинопатии крайне важно прояснить патологический процесс с нехирургического зрения. С точки зрения хирургического лечения, эффективным методом является использование инженерии аутологичный трансплантатов. Процесс стимулирования TDSCs имитировать дифференциацию in vivo полезен для исследования патологического процесса тендинопатии. Инженерии эшафот свободной сухожилия ткани имеет возможность содействовать заживлению сухожилий в крысином patellar сухожилия окно травмы модели. Кроме того, предыдущие работы доказали, что механическая нагрузка может улучшить механические свойства культивируемого сухожилия. Таким образом, этот протокол обеспечивает воспроизводимый метод для направленной дифференциации TDSCs в сухожилия, как ткани, так что он может быть использован просто и осуществимо для потенциальной инженерии сухожилия культуры.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторам нечего раскрывать.

Acknowledgments

Исследование проводилось в то время, когда автор получил "Международную стипендию Университета Западной Австралии и премию аспиранта университета в Университете Западной Австралии". Эта работа была поддержана Национальным фондом естественных наук Китая (81802214).

Materials

Name Company Catalog Number Comments
Ascorbic acid Sigma-aldrich PHR1008-2G
Fetal bovine serum (FBS) Gibcoä by Life Technologies 1908361
Histology processor Leica TP 1020
Minimal Essential Medium (Alpha-MEM) Gibcoä by Life Technologies 2003802
Mouse Tendon Derived Stem Cell Isolated from Achilles tendons of 6- to 8-wk-old C57BL/6 mice. Then digested with type I collagenase (3 mg/ml; MilliporeSigma, Burlington, MA, USA) for 3 h and passed through a 70 mmcell strainer to yield single-cell suspensions.
Paraformaldehyde Sigma-aldrich 441244
Streptomycin and penicillin mixture Gibcoä by Life Technologies 15140122
Three-dimensional Uniaxial Mechanical Stimulation Bioreactor System Centre of Orthopaedic Translational Research, Medical School, University of Western Australia Available from the corresponding author upon request. Or make it according to our design* *Wang T, Lin Z, Day RE, et al. Programmable mechanical stimulation influences tendon homeostasis in a bioreactor system. Biotechnol Bioeng. 2013;110(5):1495–1507. doi:10.1002/bit.24809
Trypsin Gibcoä by Life Technologies 1858331

DOWNLOAD MATERIALS LIST

References

  1. Knobloch, K., Yoon, U., Vogt, P. M. Acute and overuse injuries correlated to hours of training in master running athletes. Foot & Ankle International. 29, (7), 671-676 (2008).
  2. Kujala, U. M., Sarna, S., Kaprio, J. Cumulative incidence of achilles tendon rupture and tendinopathy in male former elite athletes. Clinical Journal of Sport Medicine. 15, (3), 133-135 (2005).
  3. Lian, O. B., Engebretsen, L., Bahr, R. Prevalence of jumper's knee among elite athletes from different sports: a cross-sectional study. The American Journal of Sports Medicine. 33, (4), 561-567 (2005).
  4. Zwerver, J., Bredeweg, S. W., vanden Akker-Scheek, I. Prevalence of Jumper's knee among nonelite athletes from different sports: a cross-sectional survey. The American Journal of Sports Medicine. 39, (9), 1984-1988 (2011).
  5. van der Worp, H., et al. Risk factors for patellar tendinopathy: a systematic review of the literature. British Journal of Sports Medicine. 45, (5), 446-452 (2011).
  6. Lopez, R. G. L., Jung, H. -G. Achilles tendinosis: treatment options. Clinics in Orthopedic Surgery. 7, (1), 1-7 (2015).
  7. Wren, T. A., Yerby, S. A., Beaupré, G. S., Carter, D. R. Mechanical properties of the human achilles tendon. Clinical Biomechanics. 16, (3), Bristol, Avon. 245-251 (2001).
  8. Rees, J. D., Wilson, A. M., Wolman, R. L. Current concepts in the management of tendon disorders. Rheumatology. 45, (5), Oxford, England. 508-521 (2006).
  9. Magnan, B., Bondi, M., Pierantoni, S., Samaila, E. The pathogenesis of Achilles tendinopathy: a systematic review. Foot and Ankle Surgery. 20, (3), 154-159 (2014).
  10. Riley, G. The pathogenesis of tendinopathy. A molecular perspective. Rheumatology. 43, (2), Oxford, England. 131-142 (2004).
  11. Bi, Y., et al. Identification of tendon stem/progenitor cells and the role of the extracellular matrix in their niche. Nature Medicine. 13, (10), 1219-1227 (2007).
  12. Zhang, J., Wang, J. H. C. BMP-2 mediates PGE(2) -induced reduction of proliferation and osteogenic differentiation of human tendon stem cells. Journal of Orthopaedic Research. 30, (2), 47-52 (2012).
  13. Chen, L., et al. Synergy of tendon stem cells and platelet-rich plasma in tendon healing. Journal of Orthopaedic Research. 30, (6), 991-997 (2012).
  14. Wang, J., et al. Mechanical stimulation orchestrates the osteogenic differentiation of human bone marrow stromal cells by regulating HDAC1. Cell Death & Disease. 7, (5), 2221 (2016).
  15. Parvizi, M., Bolhuis-Versteeg, L. A. M., Poot, A. A., Harmsen, M. C. Efficient generation of smooth muscle cells from adipose-derived stromal cells by 3D mechanical stimulation can substitute the use of growth factors in vascular Tissue Engineeringineering. Biotechnology Journal. 11, (7), 932-944 (2016).
  16. Sun, L., et al. Effects of Mechanical Stretch on Cell Proliferation and Matrix Formation of Mesenchymal Stem Cell and Anterior Cruciate Ligament Fibroblast. Stem Cells International. 2016, 9842075 (2016).
  17. Lin, X., Shi, Y., Cao, Y., Liu, W. Recent progress in stem cell differentiation directed by material and mechanical cues. Biomedical Materials. 11, (1), Bristol, England. 014109 (2016).
  18. Li, R., et al. Mechanical strain regulates osteogenic and adipogenic differentiation of bone marrow mesenchymal stem cells. Biomed Research International. 2015, 873251 (2015).
  19. Zhang, J., Wang, J. H. C. Characterization of differential properties of rabbit tendon stem cells and tenocytes. BMC Musculoskeletal Disorders. 11, 10-10 (2010).
  20. Liu, X., Chen, W., Zhou, Y., Tang, K., Zhang, J. Mechanical Tension Promotes the Osteogenic Differentiation of Rat Tendon-derived Stem Cells Through the Wnt5a/Wnt5b/JNK Signaling Pathway. Cellular Physiology and Biochemistry. 36, (2), 517-530 (2015).
  21. Wang, T., et al. 3D uniaxial mechanical stimulation induces tenogenic differentiation of tendon-derived stem cells through a PI3K/AKT signaling pathway. FASEB Journal. 32, (9), 4804-4814 (2018).
  22. Calve, S., et al. Engineering of functional tendon. Tissue Engineering. 10, (5-6), 755-761 (2004).
  23. Kostrominova, T. Y., Calve, S., Arruda, E. M., Larkin, L. M. Ultrastructure of myotendinous junctions in tendon-skeletal muscle constructs engineered in vitro. Histology & Histopathology. 24, (5), 541-550 (2009).
  24. Wagner, J. R., Taguchi, T., Cho, J. Y., Charavaryamath, C., Griffon, D. J. Evaluation of Stem Cell Therapies in a Bilateral Patellar Tendon Injury Model in Rats. Journal of Visualized Experiments. (133), e56810 (2018).
  25. Kurtaliaj, I., Golman, M., Abraham, A. C., Thomopoulos, S. Biomechanical Testing of Murine Tendons. Journal of Visualized Experiments. (152), e60280 (2019).
  26. Hsiao, M. Y., et al. The Effect of the Repression of Oxidative Stress on Tenocyte Differentiation: A Preliminary Study of a Rat Cell Model Using a Novel Differential Tensile Strain Bioreactor. International Journal of Molecular Sciences. 20, (14), (2019).
  27. Morita, Y., et al. The optimal mechanical condition in stem cell-to-tenocyte differentiation determined with the homogeneous strain distributions and the cellular orientation control. Biology Open. 8, (5), 0339164 (2019).
  28. Shukunami, C., Oshima, Y., Hiraki, Y. Molecular cloning of tenomodulin, a novel chondromodulin-I related gene. Biochemical and Biophysical Research Communications. 280, (5), 1323-1327 (2001).
  29. Murchison, N. D., et al. Regulation of tendon differentiation by scleraxis distinguishes force-transmitting tendons from muscle-anchoring tendons. Development. 134, (14), Cambridge, England. 2697-2708 (2007).
  30. Liu, W., et al. The atypical homeodomain transcription factor Mohawk controls tendon morphogenesis. Molecular and Cellular Biology. 30, (20), 4797-4807 (2010).
  31. Chang, J., Thunder, R., Most, D., Longaker, M. T., Lineaweaver, W. C. Studies in flexor tendon wound healing: neutralizing antibody to TGF-beta1 increases postoperative range of motion. Plastic and Reconstructive Surgery. 105, (1), 148-155 (2000).
  32. Bennett, N. T., Schultz, G. S. Growth factors and wound healing: biochemical properties of growth factors and their receptors. American Journal of Surgery. 165, (6), 728-737 (1993).
  33. Wòjciak, B., Crossan, J. F. The effects of T cells and their products on in vitro healing of epitenon cell microwounds. Immunology. 83, (1), 93-98 (1994).
  34. Marui, T., et al. Effect of growth factors on matrix synthesis by ligament fibroblasts. Journal of Orthopaedic Research. 15, (1), 18-23 (1997).
  35. Ni, M., et al. Engineered scaffold-free tendon tissue produced by tendon-derived stem cells. Biomaterials. 34, (8), 2024-2037 (2013).
  36. Trumbull, A., Subramanian, G., Yildirim-Ayan, E. Mechanoresponsive musculoskeletal tissue differentiation of adipose-derived stem cells. Biomedical Engineering Online. 15, 43 (2016).
  37. Wang, T., et al. Programmable mechanical stimulation influences tendon homeostasis in a bioreactor system. Biotechnology and Bioengineering. 110, (5), 1495-1507 (2013).
  38. Nirmalanandhan, V. S., et al. Effect of scaffold material, construct length and mechanical stimulation on the in vitro stiffness of the engineered tendon construct. Journal of Biomechanics. 41, (4), 822-828 (2008).
  39. Doroski, D. M., Levenston, M. E., Temenoff, J. S. Cyclic tensile culture promotes fibroblastic differentiation of marrow stromal cells encapsulated in poly(ethylene glycol)-based hydrogels. Tissue Engineeringineering. Part A. 16, (11), 3457-3466 (2010).
  40. Altman, G. H., et al. Advanced bioreactor with controlled application of multi-dimensional strain for Tissue Engineeringineering. Journal of Biomechanical Engineering. 124, (6), 742-749 (2002).
  41. Webb, K., et al. Cyclic strain increases fibroblast proliferation, matrix accumulation, and elastic modulus of fibroblast-seeded polyurethane constructs. Journal of Biomechanics. 39, (6), 1136-1144 (2006).
  42. Parent, G., Huppé, N., Langelier, E. Low stress tendon fatigue is a relatively rapid process in the context of overuse injuries. Annals of Biomedical Engineering. 39, (5), 1535-1545 (2011).
  43. Wang, T., et al. Bioreactor design for tendon/ligament engineering. Tissue Engineeringineering. Part B, Reviews. 19, (2), 133-146 (2013).
  44. Smith, R. K. Mesenchymal stem cell therapy for equine tendinopathy. Disability and Rehabilitation. 30, (20-22), 1752-1758 (2008).
  45. Godwin, E. E., Young, N. J., Dudhia, J., Beamish, I. C., Smith, R. K. Implantation of bone marrow-derived mesenchymal stem cells demonstrates improved outcome in horses with overstrain injury of the superficial digital flexor tendon. Journal of Equine Veterinary Science. 44, (1), 25-32 (2012).
  46. Lacitignola, L., Crovace, A., Rossi, G., Francioso, E. Cell therapy for tendinitis, experimental and clinical report. Veterinary Research Communications. 32, Suppl 1 33-38 (2008).
  47. Del Bue, M., et al. Equine adipose-tissue derived mesenchymal stem cells and platelet concentrates: their association in vitro and in vivo. Veterinary Research Communications. 32, Suppl 1 51-55 (2008).
  48. Awad, H. A., et al. Repair of patellar tendon injuries using a cell-collagen composite. Journal of Orthopaedic Research. 21, (3), 420-431 (2003).
Применение трехмерной uniaxial механической системы стимуляции биореактора, чтобы вызвать теногенную дифференциацию стволовых клеток, полученных из тендрионов
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Chen, Z., Chen, P., Ruan, R., Chen, L., Yuan, J., Wood, D., Wang, T., Zheng, M. H. Applying a Three-dimensional Uniaxial Mechanical Stimulation Bioreactor System to Induce Tenogenic Differentiation of Tendon-Derived Stem Cells. J. Vis. Exp. (162), e61278, doi:10.3791/61278 (2020).More

Chen, Z., Chen, P., Ruan, R., Chen, L., Yuan, J., Wood, D., Wang, T., Zheng, M. H. Applying a Three-dimensional Uniaxial Mechanical Stimulation Bioreactor System to Induce Tenogenic Differentiation of Tendon-Derived Stem Cells. J. Vis. Exp. (162), e61278, doi:10.3791/61278 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter