A three-dimensional uniaxial mechanical stimulation bioreactor system is an ideal bioreactor for tenogenic-specific differentiation of tendon-derived stem cells and neo-tendon formation.
Tendinopathy is a common chronic tendon disease relating to inflammation and degeneration in an orthopaedic area. With high morbidity, limited self-repairing capacity and, most importantly, no definitive treatments, tendinopathy still influences patients’ life quality negatively. Tendon-derived stem cells (TDSCs), as primary precursor cells of tendon cells, play an essential role in both the development of tendinopathy, and functional and structural restoration after tendinopathy. Thus, a method that can in vitro mimic the in vivo differentiation of TDSCs into tendon cells would be useful. Here, the present protocol describes a method based on a three-dimensional (3D) uniaxial stretching system to stimulate the TDSCs to differentiate into tendon-like tissues. There are seven stages of the present protocol: isolation of mice TDSCs, culture and expansion of mice TDSCs, preparation of stimulation culture medium for cell sheet formation, cell sheet formation by culturing in stimulation medium, preparation of 3D tendon stem cell construct, assembly of the uniaxial-stretching mechanical stimulation complex, and evaluation of the mechanical stimulated in vitro tendon-like tissue. The effectiveness was demonstrated by histology. The entire procedure takes less than 3 weeks. To promote extracellular matrix deposition, 4.4 mg/mL ascorbic acid was used in the stimulation culture medium. A separated chamber with a linear motor provides accurate mechanical loading and is portable and easily adjusted, which is applied for the bioreactor. The loading regime in the present protocol was 6% strain, 0.25 Hz, 8 h, followed by 16 h rest for 6 days. This protocol could mimic cell differentiation in the tendon, which is helpful for the investigation of the pathological process of tendinopathy. Moreover, the tendon-like tissue is potentially used to promote tendon healing in tendon injury as an engineered autologous graft. To sum up, the present protocol is simple, economic, reproducible and valid.
Tendinopathy is one of the common sports injuries. It is mainly manifested by pain, local swelling, decreased muscle tension in the affected area, and dysfunction. The incidence of tendinopathy is high. The presence of Achilles tendinopathy is most common for middle- and long-distance runners (up to 29%), while the presence of patellar tendinopathy is also high in athletes of volleyball (45%), basketball (32%), track and field (23%), handball (15%), and soccer (13%)1,2,3,4,5. However, due to the limited self-healing ability of the tendon, and the lack of effective treatments, tendinopathy still influences patients’ life negatively6,7. Moreover, the pathogenesis of tendinopathy remains unclear. There have been many investigations about its pathogenesis, mainly including "inflammation theory", "degeneration theory", "overuse theory", and so forth8. At present, many researchers believed that tendinopathy was due to the failed self-repair to the micro-injuries caused by excessive mechanical loading the tendon experiences9,10.
Tendon-derived stem cells (TDSCs), as primary precursor cells of tendon cells, play an essential role in both development of tendinopathy and functional and structural restoration after tendinopathy11,12,13. It was reported that mechanical stress stimulation could cause the proliferation and differentiation of osteocytes, osteoblasts, smooth muscle cells, fibroblasts, mesenchymal stem cells and other force-sensitive cells14,15,16,17,18. Therefore, TDSCs, as one of the mechanosensitive and multipotent cells, can similarly be stimulated to differentiate by mechanical loading19,20.
However, different mechanical loading parameters (loading strength, loading frequency, loading type and loading period) can induce TDSCs to differentiate into different cells21. Thus, an effective and valid mechanical loading regime is very significant for tenogenesis. Furthermore, there are different kinds of bioreactors as stimulation systems currently used for providing mechanical loading to TDSCs. The principles of each kind of bioreactor are different, so the mechanical loading parameters corresponding to different bioreactors are also different. Therefore, a simple, economic, and reproducible stimulation protocol is in demand, including the type of bioreactor, the corresponding stimulation medium, and the mechanical loading regime.
The present article describes a method based on a three-dimensional (3D) uniaxial stretching system to stimulate the TDSCs to differentiate into tendon-like tissue. There are seven stages of the protocol: isolation of mice TDSCs, culture and expansion of mice TDSCs, preparation of stimulation culture medium for cell sheet formation, cell sheet formation by culturing in stimulation medium, preparation of 3D tendon stem cell construct, assembly of the uniaxial-stretching mechanical stimulation complex, and evaluation of the mechanical stimulated in vitro tendon-like tissue. The whole procedure takes less than 3 weeks to obtain the 3D cell construct, which is far less than some existing methods22,23. The present protocol has been proven to be able to induce TDSCs to differentiate into tendon tissue, and it is more reliable than the current commonly used two-dimensional (2D) stretching system21. The effectiveness was demonstrated by histology. In short, the present protocol is simple, economic, reproducible and valid.
The methods described were approved and performed in accordance with the guidelines and regulations of the University of Western Australia Animal Ethics Committee.
1. Isolation of mice TDSCs
2. Culture and expansion of mice TDSCs
NOTE: Conduct all steps in a sterile biosafety hood.
3. Preparation of stimulation culture medium for cell sheet formation
NOTE: Conduct all steps in a sterile biosafety hood.
4. Cell sheet formation by culturing in stimulation medium
NOTE: Conduct all steps in a sterile biosafety hood.
5. Preparation of 3D tendon stem cell construct
NOTE: Conduct all steps in a sterile biosafety hood.
6. Assembly of the uniaxial-stretching mechanical stimulation complex in unique designed bioreactor
NOTE: Conduct all steps in a sterile biosafety hood.
7. Evaluation of the mechanical stimulated in vitro tendon-like tissue
Before mechanical stimulation, TDSCs were grown to 100% confluence in complete medium and displayed a disorganized ultrastructural morphology (Figure 2A). After 6 days of uniaxial stretching mechanical loading, extracellular matrix (ECM) and cell alignments were well orientated (Figure 2B). Cells were well populated and well enveloped in ECM after mechanical loading. Cell morphology was presented to be elongated and was more similar to normal tendon cell compared to the one without stretching (Figure 2C). Cell density in cell construct with loading was higher than in the one without loading. QPCR results showed that the present method increased the expression of the tenogenic markers including Scleraxis, Mohawk, Tenomodulin, and COL1A1 (Figure 3) compared to the ones treated by static culture.
Figure 1: Assembly of three-dimensional (3D) cell construct over the hooks of the bioreactor. (A) General view of the 3D cell construct over the hooks. (B) The diagram to assemble the 3D cell construct over the hooks. Please click here to view a larger version of this figure.
Figure 2: Cell morphology before and after mechanical stimulation. (A) Tendon-derived stem cells were grown to 100% confluence in complete medium and displayed a disorganized ultrastructural morphology before mechanical stimulation. (B) Histologic images showed H&E staining of cell construct after mechanical stimulation. (C) Histologic images showed H&E staining of a control cell construct cultured in bioreactor for 6 days without mechanical stimulation. Please click here to view a larger version of this figure.
Figure 3: Expression level of tenogenesis markers. Individual gene-expression levels were first normalized against the internal control, 36B4, and then normalized against gene-expression levels from static cultures. Results from 3 experiments are shown. The primer sequences used for qPCR analysis are provided in Table 1. Please click here to view a larger version of this figure.
Figure 4: The three-dimensional uniaxial mechanical stimulation bioreactor system. Please click here to view a larger version of this figure.
Gene | Primer sequence | |
Forward 5’->3’ | Reverse 5’->3’ | |
COL1A1 | TGACTGGAAGAGCGGAGAGT | GTTCGGGCTGATGTACCAGT |
Scleraxis | CCCAAACAGATCTGCACCTT | GGCTCTCCGTGACTCTTCAG |
Mohawk | GTCCGGCAGCCAGATTTAAG | TCGCTGAGCTTTCCCCTTTA |
Tenomodulin | CCGCAGAAAAGCCTATTGAA | GACCACCCATTGCTCATTCT |
36B4 | CTTCCCACTTGCTGAAAAGG | CGAAGAGACCGAATCCCATA |
Table 1: Primer sequences used for qPCR analysis
The tendon is a mechanosensitive fibrous connective tissue. According to previous research, excess mechanical loading could lead to osteogenic differentiation of tendon stem cells, whereas insufficient loading would lead to disordered collagen fiber structure during tendon differentiation21.
A common view is that the key to an ideal bioreactor is the ability to simulate the in vitro cellular microenvironment that cells in vivo undergo. Therefore, mimicking the in vivo normal stress environment in vitro is the key of stimulating the single-lineage differentiation of TDSCs into tendon cells. In the present protocol, the width of the TDSC construct was 2 cm, and the movement range of the hook was 0.12 cm, which means the strain was 0.12/2 (%). In conclusion, TDSCs were mechanically stimulated in a bioreactor for 6 days (6%, 0.25 Hz, 8 h, followed by 16 h rest) in the present protocol. After evaluation, the mechanical loading parameters used in this protocol have been proven to induce TDSCs to generate tendon-like tissue. It should be noted that the bioreactor parameters should specifically match the corresponding type of stretching system. For example, the proper parameters for monolayered cell stretching are different from the present 3D cell sheet stretching26,27. A possible reason is the different force modes21. In 2D monolayer stretching system, cells attach to the culture substrate by focal adhesions at the bottom and connect to each other via cell–cell junctions. However, in a 3D cell sheet, there are also many more cell–ECM connections formed as a result of the 3D niche, which means the cells are under pressure in addition to stretching.
The effectiveness of the present protocol was demonstrated by morphology and the expression level of tenogenic markers. In terms of morphology, apart from histology, using confocal immunofluorescence microscopy to detect collagen I is a common way to characterize the collagen organization and then evaluate the ECM alignment. Previous study confirmed the well-aligned collagen type I bundle formation in the TDSC construct with 6% uniaxial mechanical stimulation for 6 days but not in the one without loading21. Tenogenic markers were used to identify tendon cells, including Scleraxis (SCX), Mohawk (MKX), Tenomodulin (TNMD) and COL1A1. Only TNMD was a non-transcription factor, and the rest of them are transcription factors28. They were all well recognized. SCX could regulate tendon development in the embryonic stage29, while MKX could regulate tendon differentiation and maturation in postnatal stage30. Moreover, the mechanical properties (max load and stiffness) of the tendon-like tissue have been evaluated in previous study as well, and it showed the mechanical properties of TDSC construct with loading were better than in the one without loading21.
The medium can affect cell growth and differentiation. In the present protocol, in order to form the cell sheet in a proper way, TDSCs were grown to 100% confluence in standard uncoated plastic flasks in complete medium, and then TDSCs were stimulated to promote ECM deposition by adding 4.4 mg/mL ascorbic acid for 6 d. Several growth factors, including insulin-like growth factor I, vascular endothelial growth factor, platelet-derived growth factor, basic fibroblast growth factor, transforming growth factor, and growth differentiation factor 5, played an important role in tendon formation and healing31,32,33,34. Additionally adding 25 ng/mL connective tissue growth factor in stimulation culture medium as Ni et al. reported could accelerate the whole growth and differentiation process35.
At present, the 2D cell sheet, also known as the monolayered cell, is the most common system used for mechanical investigations. Biaxial stretch provides multidirectional tension, both longitudinally and laterally, as the uniaxial stretch only provides longitudinal tension36. Thus, monolayered cell culture with biaxial stretch could mimic the growth environment of some types of cells, such as cardiomyocytes and epidermal cells. However, the 3D cell construct is more similar to the real shape of a tendon, and uniaxial stretch is more similar to the stress characteristics of tendon cells, compared with 2D cell sheet and biaxial stretch. Thus, the combination of the 3D cell construct and the uniaxial stretching is more competent for better understanding of the tendon and its mechanical micro-environment. This provides a theoretical basis for using a 3D uniaxial stretching system to stimulate the differentiation of TDSCs. Thus, the 2D cell sheet was finally rolled into a 3D cell construct and underwent a uniaxial stretch in the present protocol.
The bioreactor used in the present protocol consisted of actuator and culture chamber (Figure 4). The details of the present bioreactor are available in a previous study37. Currently, the most common actuators used for tendon included pneumatic actuators, linear motors, and step motorball screws38,39,40. Chambers included integrated and separated chambers41,42. Among them, a separated chamber with a linear motor provided accurate mechanical loading and was portable and easy to be adjusted43.
Except TDSCs, other types of stem cells might be a potential cell source to be used in the present method. Previous research has shown that other types of stem cells might have potential therapeutic ability and might improve tendon regeneration. Compared to injured equine tendons treated with conventional noncellular based management, the re‐injury rate of the tendons treated by BMSCs was lower44,45. Moreover, intratendinous injection of BMSCs into a tendinopathy model could effectively induce tendon regeneration46. Adipose derived stem cells could effectively treat equine tendinopathies leading to complete recovery and return to normal activity in horses47. Together, there was enough evidence to suggest that stem cells, except TDSCs, could treat tendon degeneration. However, as a cautionary note, transplantation of BMSCs into injured tendons has been shown to induce ectopic osteogenic differentiation in a rabbit model, suggesting that stem cells from a specific tissue might have a tendency to differentiate into undesired cells of their tissue of origin48. In previous research, loading-deprived treatment to TDSCs could result in osteogenesis as well21, which led to the proposal that the present method has the potential to induce tenogenesis of other stem cells and avoid osteogenesis with specific loading regime. Further research is necessary to explore these specific loading regimes for other types of stem cells. If this scenario holds, more cell source to treat tendinopathy will be available.
There are still some limitations to be acknowledged. First, although a noncorrosive and autoclavable material, stainless steel, was used to build the bioreactor system, the culturing conditions and the culture medium still corrode the chamber including the screw and the hook. Thus, routine inspection of the chamber and timely rust removal are necessary. Second, in order to make the present bioreactor economic and portable, there is not an environmental control and medium circulation system in it. Thus, the operator needs to transport the bioreactor and open the chamber for medium exchange every 3 days, which increases the risk of contamination. The operator must always pay attention to keep the TDSCs environment sterile .
For the treatment of tendinopathy, it is vital to clarify the pathological process from a non-surgical perspective. In terms of surgical treatment, an effective method is to use engineered autologous grafts. The process of stimulating TDSCs to mimic differentiation in vivo is helpful for the investigation of pathological process of tendinopathy. The engineered scaffold-free tendon tissue has the ability to promote tendon healing in a rat patellar tendon window injury model. Besides, previous work proved the mechanical loading could improve the mechanical properties of cultured tendon. Thus, this protocol provides a reproducible method for directed differentiation of TDSCs into tendon-like tissue so that it can be used simply and feasibly for potential engineered tendon culture.
The authors have nothing to disclose.
The research was carried out while the author was in receipt of “a University of Western Australia International Fee Scholarship and a University Postgraduate Award at The University of Western Australia”. This work was supported by National Natural Science Foundation of China (81802214).
Ascorbic acid | Sigma-aldrich | PHR1008-2G | |
Fetal bovine serum (FBS) | Gibcoä by Life Technologies | 1908361 | |
Histology processor | Leica | TP 1020 | |
Minimal Essential Medium (Alpha-MEM) | Gibcoä by Life Technologies | 2003802 | |
Mouse Tendon Derived Stem Cell | Isolated from Achilles tendons of 6- to 8-wk-old C57BL/6 mice. Then digested with type I collagenase (3 mg/ml; MilliporeSigma, Burlington, MA, USA) for 3 h and passed through a 70 mmcell strainer to yield single-cell suspensions. | ||
Paraformaldehyde | Sigma-aldrich | 441244 | |
Streptomycin and penicillin mixture | Gibcoä by Life Technologies | 15140122 | |
Three-dimensional Uniaxial Mechanical Stimulation Bioreactor System | Centre of Orthopaedic Translational Research, Medical School, University of Western Australia | Available from the corresponding author upon request. Or make it according to our design* *Wang T, Lin Z, Day RE, et al. Programmable mechanical stimulation influences tendon homeostasis in a bioreactor system. Biotechnol Bioeng. 2013;110(5):1495–1507. doi:10.1002/bit.24809 | |
Trypsin | Gibcoä by Life Technologies | 1858331 |