This protocol describes an application of single-molecule fluorescence in situ hybridization (smFISH) to measure the in vivo kinetics of mRNA synthesis and degradation.
Method Article
This protocol describes an application of single-molecule fluorescence in situ hybridization (smFISH) to measure the in vivo kinetics of mRNA synthesis and degradation.
Single-molecule fluorescence in situ hybridization (smFISH) allows for counting the absolute number of mRNAs in individual cells. Here, we describe an application of smFISH to measure the rates of transcription and mRNA degradation in Escherichia coli. As smFISH is based on fixed cells, we perform smFISH at multiple time points during a time-course experiment, i.e., when cells are undergoing synchronized changes upon induction or repression of gene expression. At each time point, sub-regions of an mRNA are spectrally distinguished to probe transcription elongation and premature termination. The outcome of this protocol also allows for analyzing intracellular localization of mRNAs and heterogeneity in mRNA copy numbers among cells. Using this protocol many samples (~50) can be processed within 8 h, like the amount of time needed for just a few samples. We discuss how to apply this protocol to study the transcription and degradation kinetics of different mRNAs in bacterial cells.
The flow of genetic information from DNA to mRNA and protein is one of the most fundamental cellular processes, whose regulation is important for cellular fitness1. The number of mRNAs in a cell is determined by two dynamic processes, transcription, and mRNA degradation. However, how transcription and mRNA degradation are regulated in time and space of a single cell remains not completely understood, largely due to the shortage of experimental methods to quantitatively measure their kinetics in vivo.
Methods based on total mRNAs extracted from a population of cells, such as Northern blot, RT-PCR, RNA sequencing, and gene expression microarrays, can measure the relative difference in mRNA levels and have been widely used to analyze the rate of transcription elongation2,3,4,5 or the rate of mRNA degradation6,7. However, they do not provide the absolute number of mRNAs per cell, and hence, they are not suitable for probing the rate of transcription initiation8. Also, because mRNAs are extracted from a population of cells, the spatial distribution of mRNAs within a single cell and the variability of mRNA copy numbers among cells cannot be measured.
Next-generation RNA sequencing on individual cells (scRNAseq) can quantify the number of mRNAs per cell in a genomic scale9. However, it remains difficult to use this technique to measure transcription kinetics, due to challenges with sample preparation and high cost. In particular, the application of scRNAseq to bacteria has been technically difficult due to low mRNA abundance10,11.
Single-molecule fluorescence in situ hybridization (smFISH) is based on the hybridization of fluorescently-labeled single-stranded probes whose sequences are complementary to the target mRNA of interest12,13. The concept of sequence-specific hybridization is similar to that used in Northern blot or RT-PCR, but the hybridization is done in situ within fixed cells, to preserve the native localization of mRNAs. The signal of a single mRNA is amplified using many probes, ~20 nucleotides (nt) in length, hybridizing to different parts of an mRNA (Figure 1A)13. In this “tiling” probe approach, the number of probes needed to detect a single mRNA sets a lower limit on the length of mRNA that can be assayed. Alternatively, the mRNA of interest may be transcriptionally fused to a non-coding array of tandem Lac operator sequences, such that multiple copies of a fluorescently labeled lacO probe hybridize to a single mRNA (Figure 1B)14.
smFISH has been used to quantify the number of mRNAs per cell at steady state (i.e., when synthesis and decay are in balance) and to analyze the mean and variability of mRNAs among bacterial cells15,16,17. Recently, smFISH has been applied to quantify mRNA numbers at non-steady state, right after induction or repression of gene expression in E. coli18,19,20. The temporal changes in the absolute mRNA copy numbers were then used to calculate the rate of transcription initiation, elongation, and termination, as well as the rate of mRNA degradation. For this application, conventional smFISH procedures can be cumbersome because there are many samples, each representing one time point, that need to go through multiple buffer exchange steps (i.e., centrifugation and washing). Here, we describe an smFISH protocol, in which the sample handling steps are dramatically simplified by having cells adhered to the surface of a coverslip and by aspirating liquids with a vacuum filtration system14,19. Using the expression of lacZ in E. coli as an example, the full workflow (Figure 2) is demonstrated, including image analysis (Figure 3) yielding the in vivo kinetics of transcription (initiation, elongation, and termination) and mRNA degradation, cell-to-cell variability in mRNA expression, and mRNA localization. We anticipate that the protocol is widely applicable to probe in vivo kinetics and localization of other mRNAs in various bacteria species.
1. Preparation of smFISH probes
NOTE: To label smFISH probes with a single fluorophore, follow a standard protocol for labeling nucleic acid oligonucleotides based on NHS ester chemistry21.



2. Preparation of solutions
3. Preparation of coverslips and glass slides
4. Time-course experiment and sample fixation
5. Permeabilization of cell membranes
6. Probe hybridization
7. Post-hybridization wash and preparation for imaging
8. Imaging
9. Image analysis
NOTE: Matlab code used in this step is available in the following GitHub website: https://github.com/sjkimlab/Code_Publication/tree/master/JoVE_2020. The GitHub folder contains everything needed for the image analysis, including parameter values for cell segmentation and spot identification. The procedure in this step is further explained in the master script, called “FISHworkflow.m”.
Figure 3 shows representative images from this smFISH protocol. A full field of view (86.7 μm x 66.0 μm using our microscopy setup detailed in Table of Materials) shows ~500 E. coli cells dispersed throughout the field (Figure 3A). If the density of cells is much higher than what is shown in this image, automatic cell segmentation becomes difficult as segmentation algorithms do not reliably identify individual cells when cells touch each other. One needs to adjust the concentration of cells and incubation time used for surface adherence (Step 5.1) to achieve the optimal density of cells in the field of view.
The morphology of cells in the phase contrast images should remain comparable to that of live cells for segmentation purposes (Figure 3A-C). If cells are over-permeabilized, the cell morphology changes (like “ghosts”; Supplementary Figure 1). In that case, one may reduce the duration of 70% ethanol treatment in Step 5.3.
Before induction the average lacZ expression level was ~0.03 mRNAs per cell, consistent with previous reports15,30. Also, the distribution of lacZ mRNA spot intensities before induction did not fit well with a normal distribution or a Poisson distribution due to the presence of spots with high intensities (Figure 3D,E). This suggests that most of the spots detected under the repressed state represent a single lacZ mRNA, but a small population of spots contains more than one lacZ mRNA. To isolate the population with a single lacZ mRNA, we used a Gaussian mixture model with two mixture components (insets in Figure 3D,E). Then, the mean of the first Gaussian was taken as the mean intensity of a single mRNA spot (e.g., the peak of the black curve in Figure 3D) and used to convert the spot intensity to the number of mRNAs, for any spots detected in the time-course experiment. To calculate the total number of mRNAs within a cell, the normalized spot intensities were summed in each cell (Figure 3F)19.
When the expression level of lacZ mRNA is low, there are one or two diffraction-limited lacZ mRNA spots spatially separated within a cell. Hence, the images of these spots can be analyzed by 2D Gaussian fitting for their intensity and localization.
When the expression level is high, such that spots overlap with each other within a cell, 2D Gaussian fitting does not do reliable quantification. In that case, the mRNA level should be calculated by dividing the total, background-subtracted fluorescence signal within a cell with the mean intensity of a single mRNA19.
When the expression of lacZ is induced, the signal of 5’ lacZ mRNA increases first and that of 3’ lacZ mRNA increases later (Figure 4B). If the expression of lacZ is repressed, both 5’ and 3’ lacZ mRNA signals decrease with some delay in between (Figure 4B). To obtain the rate of transcription elongation, the rise of 5’ and 3’ signals are first fit with lines (Figure 4B), and the difference in x-intercepts are taken as the time for RNAPs to travel the distance between two probe regions (2,000 nt). The rate of transcription elongation can be measured from each time-course experiment and standard deviations can be calculated from experimental duplicates. The average rate of transcription elongation was 15-30 nt/s under our experimental conditions19.
Additionally, the rate of mRNA degradation (inverse of the mean mRNA lifetime) was obtained by fitting the decay region with an exponential function (Figure 4B). Our time-course data contains mRNA degradation during and after transcription31. We fit the time points after 3’ mRNA started to decay (t > 6 min) to probe the degradation of released mRNAs. We obtained ~90 s as an average lifetime of either 5’ or 3’ lacZ mRNA19.
The rate of transcription initiation can be calculated from the slope of 5’ signal increase after induction (Figure 4B, blue), or from the average mRNA number at steady state (which is the initiation rate divided by the degradation rate). Furthermore, the probability of premature transcription termination can be estimated, either by taking the ratio between the slope of 3’ signal increase vs that of 5’ signal increase32 or between the steady-state levels of 3’ and 5’ mRNA regions19.
Because smFISH is a single-cell technique, we can analyze cell-to-cell variability in transcription. For example, one can analyze the percentage of cells expressing lacZ mRNA after IPTG is added (Figure 4C). One can also address whether mRNA localization changes after induction. We observed that 5’ and 3’ lacZ mRNA spots move slightly outward, away from the center of the cell (Figure 4D,E), consistent with a previous report33.
Lastly, analysis of co-localization between 5’ and 3’ mRNA spots can be informative (Figure 5A). For example, in the repressed state (time zero), about 25% of 5’ mRNA spots are co-localized with a 3’ mRNA spot. At t = 1 min, as many gene loci have 5’ mRNA synthesis, but not yet 3’ mRNA synthesis, most of the 5’ mRNA spots are by themselves without 3’ mRNA signal (i.e., low probability of co-localization). However, when the 3’ mRNA appears (i.e., t = 2 min), the probability of co-localization increases (purple arrow in Figure 5A,B). This time point, when the co-localization becomes frequent, depends on the rate of transcription elongation. The 2-D density plot of 5’ and 3’ lacZ mRNA numbers within each co-localization spot detected at this time point can be used to infer the density of RNAPs on the lacZ gene (Figure 5C). As previously reported19, the 5’ mRNA numbers in this plot indicate that most of the lacZ loci have less than 10 RNAPs on the DNA when lacZ expression is induced by 1 mM IPTG. Additionally, the 3’ mRNA numbers in this plot is related to the clustering of RNAPs34. The fact that the number of 3’ mRNA is close to one means that roughly only one RNAP enters the 3’ probe region. This suggests that RNAPs on the lacZ gene are spatially separated, instead of forming a cluster (or “convoy”).

Figure 1: Design of smFISH probes for an mRNA of interest. (A) A tiling method. Sequences of short DNA oligonucleotides (~20 bp in length) are chosen so that they can cover the mRNA of interest. The oligonucleotide probes are labeled with a fluorescent dye molecule. (B) An array method. A non-coding array of tandem sequences (e.g., “lacO array”) is transcriptionally fused to the mRNA of interest. Fluorescently labeled probe complementary to the repeat unit (e.g., lacO probe of 17 bp in length) is used to amplify the signal of an mRNA. Please click here to view a larger version of this figure.

Figure 2: Schematic of smFISH experimental procedure and time duration of each step. Please click here to view a larger version of this figure.

Figure 3: smFISH image analysis. (A-C) smFISH microscopy image of 5’ lacZ mRNA (red) and 3’ lacZ mRNA (green) in wild-type E. coli (MG1655) grown in M9 minimal medium supplemented with 0.2% glycerol, 0.1% casamino acids, and 1 mg/L thiamine at 30 °C. (A) A representative image of a sample from t = 3 min after induction with 0.05 mM IPTG at t = 0 min and repression with 500 mM glucose at t = 1.5 min. Phase contrast and two fluorescence images of Cy5 (for 5’ lacZ mRNA, red) and Cy3 (for 3’ lacZ mRNA, green) were overlaid with pseudo-coloring. The image shows an entire field of 86.7 μm x 66.0 μm. Scale bar, 5 μm. (B) Zoom-in version of a small region (yellow box) in (A). Cell outlines are shown in white, and fluorescence spots identified from image analysis are shown with red dots. Scale bar, 1 μm. (C) Detection of cell outlines and fluorescent spots under a high expression condition (t = 4 min after induction with 1 mM IPTG). Scale bar, 1 μm. (D-E) Distributions of 5’ and 3’ mRNA spot intensities measured before adding IPTG (the repressed state). The histograms are shown with two Gaussian functions (black and grey) whose mean values are from the Gaussian mixture model. Inset shows quantile-quantile plot of random numbers generated from the Gaussian mixture models and experimentally measured mRNA spot intensities (n = 1040 for 5’ mRNA and 680 for 3’ mRNA). (F) Information obtained for an individual cell pointed in panel (B). For a given cell (i), spots were identified in Cy5 and Cy3 channels, and their intensity (I) and coordinate along the short and long axis of a cell (d, l) were quantified from 2D Gaussian fitting. After normalization spot intensities were summed to yield the total number of 5’ or 3’ mRNAs in this cell. Also, co-localization between spots from different channels can be analyzed as in the example shown in Figure 5. Please click here to view a larger version of this figure.

Figure 4: Analysis of in vivo kinetics of transcription and mRNA degradation. (A) Schematic and representative images of two-color smFISH experiments measuring changes in lacZ mRNA levels over time. Red and green dotted lines indicate Cy5 or Cy3B labeled oligonucleotide probes that hybridize to the 1-kb-long 5’ and 3’ mRNA regions of lacZ mRNA in E. coli, respectively. Also shown are overlays of two fluorescence images with a phase contrast image at indicated time points after induction with 0.2 mM IPTG at t = 0 min. Transcription was repressed with 500 mM glucose at t = 1.5 min. Scale bar, 1 μm. The figure has been modified from Kim et al19. (B) 5’ and 3’ lacZ mRNA numbers per cell over time, during the experiment described in the panel (A). Error bars are bootstrapped SEMs. At least 1,200 cells were analyzed per time point. The initial rise of the 5’ and 3’ mRNA signals was fit with a line (blue). The difference in x-intercepts was 1.93 min, yielding the average rate of transcription elongation of 17.3 nt/s. Final decay of the 5’ and 3’ mRNA signals was fit with an exponential decay function (grey). The fit parameters indicate that the average mRNA lifetime is 1.52 min for 5’ mRNA and 1.66 min for 3’ mRNA. (C) Percentage of cells with one or more lacZ mRNA spots during the experiment described in (A). Error bars are bootstrapped SEMs. (D) Localization of a spot along a cell’s short axis. One can quantify a spot’s proximity to the membrane by dividing the location along the short axis (d) with half width of the cell (w). (E) Change in the localization of 5’ and 3’ lacZ mRNA spots along cells’ short axis during the experiment described in (A). Please click here to view a larger version of this figure.

Figure 5: Analysis of co-localization of 5’ and 3’ mRNA spots. (A) Schematic showing the expected co-localization between 5’ and 3’ mRNA spots after induction. When 3’ mRNA is made, the probability of a 5’ mRNA spot being co-localized with a 3’ mRNA spot increases (purple arrow). (B) The probability of co-localization after induction with 1 mM IPTG. The purple arrow indicates the time point where the probability of co-localization first becomes frequent according to the schematic in panel (A). (C) The number of 5’ and 3’ lacZ mRNAs within a co-localization spot detected at t = 2 min after induction with 1 mM IPTG (total 841 spots). Gray dots represent individual co-localized spots, whereas red dots represent the average of binned data. Error bars are SEM. The shade of gray indicates the density of points in a given area of the graph. The dotted line indicates a slope of 1. Please click here to view a larger version of this figure.

Figure 6: Optimization of the probe hybridization condition. Two kinds of samples were used: MG1655 cells grown as described in Figure 3 and remain uninduced (blue) or treated with 0.5 mM IPTG for 20 min (red). Probe hybridization solution was made with different concentrations of probes (total 72 Cy5-conjugated probes tiling the entire lacZ region) and of formamide. Formamide concentrations were also adjusted in the pre-hybridization solution and the wash solution, accordingly. “No probe” (grey line) indicates the fluorescence level of the IPTG-added cells treated with no probes during the hybridization step. Mean fluorescence intensity normalized by cell area (AU) was calculated from 300-800 cells. Error bars are bootstrapped SEMs. Please click here to view a larger version of this figure.
Supplementary Figure 1: Distorted cell morphologies due to over permeabilization. Overlay of phase contrast (gray scale), 5’ lacZ mRNA (Cy5, red), and 3’ lacZ mRNA (Cy3, green) images of MG1655 cells 5 min after the induction with 1 mM IPTG. (A) An example showing mixture of normal cells and overly permeabilized cells lacking normal morphology (indicated with pink arrows). (B) An example showing “ghosty” cells clumped together. Scale bar = 1 µm. Please click here to download this file.
| DEPC Water | ||||
| Add 0.1% DEPC to ultrapure water and incubate the bottle (covered) in the 37°C oven overnight and autoclave next day. | ||||
| DEPC PBS (10X) | ||||
| Mix the following: | ||||
| 80 g | NaCl (final 1.37 M) | |||
| 2 g | KCl (final 27 mM) | |||
| 14.2 g | Na2HPO4 (final 100 mM) | |||
| 2.7 g | KH2PO4 (final 20 mM) | |||
| Ultrapure water to 1L | ||||
| Filter (0.22 μm) into a glass bottle. | ||||
| Add 0.1% DEPC and follow the instruction for DEPC water. | ||||
| To make 1X solution, dilute 10 times with DEPC water. | ||||
| 1M DEPC sodium phosphate buffer, pH 7.4 | ||||
| Mix the following: | ||||
| 115 g | Na2HPO4 | |||
| 22.8 g | NaH2PO4 | |||
| Ultrapure water to 1 L | ||||
| Filter (0.22 μm) into a glass bottle. | ||||
| Add 0.1% DEPC and follow the instruction for DEPC water. | ||||
| 4X fixing solution (16% formaldehyde) | ||||
| 5 mL | 20% formaldehyde | |||
| 500 µL | DEPC water | |||
| 750 µL | 1M DEPC sodium phosphate buffer, pH 7.4 | |||
| Store at 4 °C for up to 2-4 weeks. | ||||
| CAUTION: Formaldehyde is toxic. Wear gloves and use a fume hood when making this solution. | ||||
| Wash solution | ||||
| Mix the following: | ||||
| 10 mL | Formamide (final 25%) | |||
| 4 mL | 20X SSC (final 2X) | |||
| Fill DEPC water to 40 mL | ||||
| Filter (0.22 μm) and store at 4 °C | ||||
| CAUTION: Formamide is toxic. Wear gloves and use a fume hood when making this solution. | ||||
| Pre-hybridization solution | ||||
| 200 µL | Formamide (final 20%) | |||
| 100 µL | 20X SSC (final 2X) | |||
| 10 µL | 100X VRC (final 1X) | |||
| 25 µL | 4% (w/v) BSA (final 0.1%) | |||
| 685 µL | DEPC water | |||
| NOTE: Vortex the VRC stock before taking 10 µL out. | ||||
| CAUTION: Formamide is toxic and a known teratogen. Wear gloves and handle it under a fume hood. | ||||
| Probe hybridization solution | ||||
| 200 µL | Formamide (final 20%) | |||
| 100 µL | 20X SSC (final 2X) | |||
| 10 µL | 100X VRC (final 1X) | |||
| 25 µL | 4% (w/v) BSA (final 0.1%) | |||
| 10 µL | 40 mg/mL E. coli tRNA (final 0.4 mg/mL) | |||
| 200 µL | 50% dextran sulfate (final 10%) | |||
| x µL | 5’ mRNA probe set (from Step 1.12) to final 4 nM. | |||
| y µL | 3’ mRNA probe set (from Step 1.12) to final 4 nM. | |||
| - | DEPC water to make the total volume 1 mL | |||
| NOTE: Add dextran sulfate last. Because it is very viscous, cut the end of a pipette tip before taking 200 μL out from the 50% stock. After adding dextran sulfate, pipette up and down to homogenize the solution. | ||||
Table 1: Recipes of the solutions used.
Here, we presented a smFISH protocol for measuring mRNA kinetics in E. coli. In the previously published smFISH protocols for bacteria23, cells were kept in the tubes until the very end of the protocol, that is until they are ready for imaging. While it has many benefits, such as minimal nonspecific binding of fluorescent probes on the coverslip surface23, it is difficult to follow these protocols when there are many samples from a time-course experiment. First, a relatively large volume of cells (>1 mL) needs to be sampled and even harvested before fixation. Second, the cell samples need to be centrifuged multiple times to exchange solutions and to wash after the hybridization step. In our protocol, a small volume (<1 mL) of culture is directly mixed with a fixing solution in a 1.5-mL tube, helping to quickly “freeze” the cell state at the moment of sampling. Also, cells stay attached to the surface throughout the procedure, and different solutions can be exchanged quickly by aspirating liquids with a vacuum filtration system and applying solution drops at once with a multi-channel pipette. This difference makes our protocol highly advantageous when a large number of samples need to be processed at once. Using our protocol, 12-48 samples can be handled simultaneously and the entire FISH procedure can be completed within ~8 hours, about a similar amount of time needed for a few samples (Figure 2). Although we used the expression of lacZ in E. coli as an example, the protocol is widely applicable to different genes and bacterial species with considerations discussed below.
For different genes, the first thing to consider is smFISH probes. One may design oligonucleotide probes that tile the mRNA of interest (Figure 1A)13. In this “tiling” probe approach, each probe is ~20 base long and labeled with a fluorophore at the 5’ or 3’ terminus. This strategy is convenient as no genetic manipulation is needed. Alternatively, a tandem repeat of ~20 bp sequence, foreign to the genomic sequence (e.g., an array of lacO sequence in Caulobacter crescentus14), may be inserted in the untranslated region of a gene of interest and a single probe complementary to the repeat unit is used to label the mRNA (“array” approach; Figure 1B). In both cases, multiple fluorophores decorate an mRNA, giving amplified fluorescence signal that can be easily differentiated from a single probe nonspecifically bound inside a cell.
Whether to choose “tiling” or “array” approaches depends on the negative control, a sample where nonspecific binding of probes is tested because it lacks the target mRNA. For tiling probes (Figure 1A), a mutant strain without the gene of interest or a condition, in which the gene is not transcribed (e.g., repression of lacZ) can serve as a negative control for testing nonspecific binding of probes. For the array-based smFISH (Figure 1B), a wild-type strain lacking the array can serve as a negative control because it does not contain binding sites for the probes.
Optimal hybridization conditions may depend on the probe sequences and even the choice of fluorophore dyes. We optimized the hybridization condition for lacZ probe sets by keeping the hybridization temperature at 37 °C and testing different concentrations of probe sets and formamide in the hybridization solution. Higher concentrations of formamide tend to reduce both nonspecific and specific binding26,35. We recommend systematically changing the hybridization and its wash conditions while keeping hybridization time and temperature the same. As the condition becomes more stringent, both nonspecific and specific binding decrease (Figure 6). It is important to find a point where the nonspecific binding starts to hit below an acceptable threshold without further compromising specific binding. For example, we used the signal level obtained without any probes (“no probes”) as a threshold (Figure 6).
The two-color smFISH method labeling two separate regions of an mRNA is limited to long genes. To measure the rate of transcription elongation, we took advantage of the fact that lacZ is long (3075 bp) and its expression can be induced by IPTG. When a gene is short, it is difficult to design two tiling probe sets (near 5’ and 3’ ends) and resolve the time delay between appearances of 5’ vs. 3’ mRNA regions. In this case, one may count nascent mRNAs at steady state by smFISH and analyze their distribution with an analytical model that has the rate of transcription elongation as a fitting parameter20. Also, when a gene of interest is not inducible, one may treat cells with rifampicin at time zero and measure the temporal change in 5’ and 3’ mRNA sub-regions. The delay from the decrease of 5’ mRNA signal to that of 3’ mRNA signal can then be used to calculate the rate of transcription elongation as done previously31.
Finally, the smFISH protocol is versatile and can be combined with other labeling schemes. Previously, DNA locus was visualized together with mRNAs by combining mRNA FISH with either DNA FISH14 or fluorescent reporter-operator system20. Protein products may be visualized by performing immunofluorescence together with mRNA FISH14,36. Also, it can be combined with three-dimensional super-resolution microscopy37 to visualize mRNAs in all three dimensions38,39.
The authors declare they have no competing financial interests.
This protocol was developed by S.K. during her postdoctoral research in Dr. Christine Jacobs-Wagner's laboratory at the Howard Hughes Medical Institute and the Microbial Sciences Institute at Yale University. We thank Dr. Jacobs-Wagner and her lab members for various inputs during the method development and Laura Troyer for critical reading of the manuscript. S.K. acknowledges support from the Searle Scholars Program; K.V. acknowledges the support of James Scholar Preble Research Award from the University of Illinois.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| Bacterial strain | |||
| Escherichia coli MG1655 | |||
| Chemicals, peptides, and others | |||
| Acetonitrile | Sigma-Aldrich | 34851 | UPLC buffer B |
| Ammonium chloride | Fisher Chemical | A661-500 | To make M9 medium |
| Bovine serum albumin (BSA) | Sigma-Aldrich | B2518 | Probe hybridization |
| Calcium chloride | Acros Organics | 349610250 | To make M9 medium |
| Casamino acid | BD Difco | 223050 | To make M9 medium |
| Cy3B NHS ester | GE Healthcare Life Sciences | PA63101 | Fluorophore for FISH probes |
| Cy5 NHS ester | GE Healthcare Life Sciences | PA15101 | Fluorophore for FISH probes |
| DEPC | Sigma-Aldrich | D5758 | |
| Dextran sulfate | Millipore | S4030 | Probe hybridization |
| Dextrose | Fisher Chemical | D16 | To repress the expression of lacZ |
| Dimethyl sulfoxide (DMSO) | Sigma-Aldrich | D8418 | To dissolve fluorophores |
| E. coli tRNA | Sigma-Aldrich | R1753 | Probe hybridization |
| Ethanol | Decon Laboratories | 2701 | Used in DNA purification, lysis, and cleaning coverslips |
| FISH probes | Biosearch Technologies | Sequences are published in ref#16 | |
| Formaldehyde | Ladd Research Industries | 20295 | Fixation |
| Formamide | American Bio | AB00600 | Probe hybridization, pre-hybridization, and wash |
| Glycerol | Americanbio | AB00751-01000 | To make M9 medium |
| Isopropylthio-β-galactoside (IPTG) | Invitrogen | 15529019 | lacZ induction |
| Magnesium sulfate | Fisher Chemical | M65-500 | To make M9 medium |
| 2-Nitrophenyl β-D-fucopyranoside (ONPF) | Santa Cruz Biotechnology | sc-216258 | lacZ repression |
| Picodent twinsil 22 | Picodent | 1300 1000 | Sealant |
| Poly-L-lysine | Sigma-Aldrich | P8920 | To treat the coverslip surface |
| Potassium chloride | Fisher BioReagents | BP366-500 | To make PBS |
| Potassium phosphate monobasic | Fisher BioReagents | BP362-500 | To make PBS and M9 medium |
| Rifampicin | Sigma-Aldrich | R3501 | To stop transcription initiation |
| Saline-sodium citrate buffer (SSC) | Invitrogen | AM9763 | Probe hybridization, pre-hybridization, and wash |
| sodium bicarbonate | Fisher BioReagents | BP328-500 | Fluorophore-probe conjugation |
| Sodium chloride | Fisher BioReagents | BP358-1 | For DNA purification, PBS and M9 medium |
| Sodium phosphate dibasic | Fisher BioReagents | BP332-500 | To make PBS and M9 medium |
| Sodium phosphate monobasic | Fisher BioReagents | BP329-500 | To make a sodium phosphate buffer |
| Super PAP Pen | Invitrogen | 8899 | Hydrophobic marker for coverslips |
| TetraSpek microspheres | Invitrogen | T7280 | Controls for multi-channel registration |
| Thiamine | Sigma-Aldrich | T1270 | To make M9 medium |
| Triethylammonium acetate | Sigma-Aldrich | 90358 | UPLC buffer A |
| Vanadyl ribonucleoside complex (VRC) | Sigma-Aldrich | 94742 | Probe hybridization and pre-hybridization |
| Equipment | |||
| C18 column | Waters | Acquity BEH C18 column | |
| Countertop centrifuge | Eppendorf | 5425 | |
| Countertop incubator | Eppendorf | Thermomixer F1.5 | |
| Incubator (Oven) | Thermo Scientific | 51030514 | Gravity convection |
| Water purification system | Millipore | Milli-Q Reference | |
| Nanodrop | Thermo Scientific | 2000C | |
| Nitrogen gas | Building | For blow-drying coverslips and glass slides | |
| UPLC | Waters | Acquity UPLC system | |
| Vacuum and aspirator | Building | Aspirator is made of a filtration flask with a side arm. | |
| Vacuum concentrator | Labconco | 7810010 | Centrivap; to dry samples collected from UPLC. |
| Vortexer | Scientific Industries | Genie-2 SI-0236 | |
| Water bath shaker | New Brunswick | Innova 3100 | Critical for time-course experiments |
| Water bath sonicator | VWR | 97043-960 | To clean coverslips and glass slides |
| Tools | |||
| 1.5-mL tubes | Eppendorf | 22431021 | DNA lobind tubes |
| 1000-uL pipette tip box | Denville Scientific | P1126 | An empty box after using all the tips |
| Coplin jar | SPI | 01240-AB | To clean coverslips and glass slides |
| Coverslip | Fisher Scientific | 22-050-230 | 24x60 No1 |
| Filtered pipette tips | Denville Scientific | P1121,P1122,P1126 | SHARP® Precision Barrier Tips |
| Forceps | SPI | K35a | To handle clean coverslips and glass slides |
| Glass slide | Fisher Scientific | 12-544-1 | |
| Gloves | Microflex | MK-296-M | |
| Multichannel pipetter | Eppendorf | 2231300045 | To use in the washing step (#7) |
| Pipette | Gilson | P1000, P200, P20 | |
| Reagent reservoir | MTC Bio | P8025-1S | To use in the washing step (#7) |
| Syringe filter (0.22 um) | Millipore | SLGS033SS | |
| Timer | VWR | 62344-641 | |
| Software and algorithms | |||
| MATLAB | Mathworks | R2013 and up | https://www.mathworks.com |
| MicrobeTracker or Oufti | https://www.github.com/JacobsWagnerLab/MicrobeTracker | ||
| https://oufti.org/ | |||
| Stellaris Probe Designer | Biosearch Technologies | https://www.biosearchtech.com/support/tools/design-software/stellaris-probe-designer | |
| Microscope | |||
| CCD camera | Hamamatsu Photonics | Orca-II-ER | |
| Cy3 filter set | Chroma | 49004 | |
| Cy5 filter set | Chroma | 49006 | |
| Epi-fluorescence microscope | Nikon | Eclipse Ti | For phase-contrast and epi fluorescence |
| Fluorescence excitation source | Lumencor | SOLA-E | |
| Nikon Elements software | Nikon | software that controls the microscope setup | |
| Phase-contrast 100x objective | Nikon | Plan Apochromat (NA 1.45) | |
| Probe sequence | |||
| DNA oligos with C6 amino modification at the 5' end | Biosearch Technologies Inc | ||
| lacZ1 | GTGAATCCGTAATCATGGTC | 5' mRNA | |
| lacZ2 | TCACGACGTTGTAAAACGAC | 5' mRNA | |
| lacZ3 | ATTAAGTTGGGTAACGCCAG | 5' mRNA | |
| lacZ4 | TATTACGCCAGCTGGCGAAA | 5' mRNA | |
| lacZ5 | ATTCAGGCTGCGCAACTGTT | 5' mRNA | |
| lacZ6 | AAACCAGGCAAAGCGCCATT | 5' mRNA | |
| lacZ7 | AGTATCGGCCTCAGGAAGAT | 5' mRNA | |
| lacZ8 | AACCGTGCATCTGCCAGTTT | 5' mRNA | |
| lacZ9 | TAGGTCACGTTGGTGTAGAT | 5' mRNA | |
| lacZ10 | AATGTGAGCGAGTAACAACC | 5' mRNA | |
| lacZ11 | GTAGCCAGCTTTCATCAACA | 5' mRNA | |
| lacZ12 | AATAATTCGCGTCTGGCCTT | 5' mRNA | |
| lacZ13 | AGATGAAACGCCGAGTTAAC | 5' mRNA | |
| lacZ14 | AATTCAGACGGCAAACGACT | 5' mRNA | |
| lacZ15 | TTTCTCCGGCGCGTAAAAAT | 5' mRNA | |
| lacZ16 | ATCTTCCAGATAACTGCCGT | 5' mRNA | |
| lacZ17 | AACGAGACGTCACGGAAAAT | 5' mRNA | |
| lacZ18 | GCTGATTTGTGTAGTCGGTT | 5' mRNA | |
| lacZ19 | TTAAAGCGAGTGGCAACATG | 5' mRNA | |
| lacZ20 | AACTGTTACCCGTAGGTAGT | 5' mRNA | |
| lacZ21 | ATAATTTCACCGCCGAAAGG | 5' mRNA | |
| lacZ22 | TTTCGACGTTCAGACGTAGT | 5' mRNA | |
| lacZ23 | ATAGAGATTCGGGATTTCGG | 5' mRNA | |
| lacZ24 | TTCTGCTTCAATCAGCGTGC | 5' mRNA | |
| lacZ25 | ACCATTTTCAATCCGCACCT | ||
| lacZ26 | TTAACGCCTCGAATCAGCAA | ||
| lacZ27 | ATGCAGAGGATGATGCTCGT | ||
| lacZ28 | TCTGCTCATCCATGACCTGA | ||
| lacZ29 | TTCATCAGCAGGATATCCTG | ||
| lacZ30 | CACGGCGTTAAAGTTGTTCT | ||
| lacZ31 | TGGTTCGGATAATGCGAACA | ||
| lacZ32 | TTCATCCACCACATACAGGC | ||
| lacZ33 | TGCCGTGGGTTTCAATATTG | ||
| lacZ34 | ATCGGTCAGACGATTCATTG | ||
| lacZ35 | TGATCACACTCGGGTGATTA | ||
| lacZ36 | ATACAGCGCGTCGTGATTAG | ||
| lacZ37 | GATCGACAGATTTGATCCAG | ||
| lacZ38 | AAATAATATCGGTGGCCGTG | ||
| lacZ39 | TTTGATGGACCATTTCGGCA | ||
| lacZ40 | TATTCGCAAAGGATCAGCGG | ||
| lacZ41 | AAGACTGTTACCCATCGCGT | ||
| lacZ42 | TGCCAGTATTTAGCGAAACC | ||
| lacZ43 | AAACGGGGATACTGACGAAA | ||
| lacZ44 | TAATCAGCGACTGATCCACC | ||
| lacZ45 | GGGTTGCCGTTTTCATCATA | ||
| lacZ46 | TCGGCGTATCGCCAAAATCA | ||
| lacZ47 | TTCATACAGAACTGGCGATC | ||
| lacZ48 | TGGTGTTTTGCTTCCGTCAG | ||
| lacZ49 | ACGGAACTGGAAAAACTGCT | 3' mRNA | |
| lacZ50 | TATTCGCTGGTCACTTCGAT | 3' mRNA | |
| lacZ51 | GTTATCGCTATGACGGAACA | 3' mRNA | |
| lacZ52 | TTTACCTTGTGGAGCGACAT | 3' mRNA | |
| lacZ53 | GTTCAGGCAGTTCAATCAAC | 3' mRNA | |
| lacZ54 | TTGCACTACGCGTACTGTGA | 3' mRNA | |
| lacZ55 | AGCGTCACACTGAGGTTTTC | 3' mRNA | |
| lacZ56 | ATTTCGCTGGTGGTCAGATG | 3' mRNA | |
| lacZ57 | ACCCAGCTCGATGCAAAAAT | 3' mRNA | |
| lacZ58 | CGGTTAAATTGCCAACGCTT | 3' mRNA | |
| lacZ59 | CTGTGAAAGAAAGCCTGACT | 3' mRNA | |
| lacZ60 | GGCGTCAGCAGTTGTTTTTT | 3' mRNA | |
| lacZ61 | TACGCCAATGTCGTTATCCA | 3' mRNA | |
| lacZ62 | TAAGGTTTTCCCCTGATGCT | 3' mRNA | |
| lacZ63 | ATCAATCCGGTAGGTTTTCC | 3' mRNA | |
| lacZ64 | GTAATCGCCATTTGACCACT | 3' mRNA | |
| lacZ65 | AGTTTTCTTGCGGCCCTAAT | 3' mRNA | |
| lacZ66 | ATGTCTGACAATGGCAGATC | 3' mRNA | |
| lacZ67 | ATAATTCAATTCGCGCGTCC | 3' mRNA | |
| lacZ68 | TGATGTTGAACTGGAAGTCG | 3' mRNA | |
| lacZ69 | TCAGTTGCTGTTGACTGTAG | 3' mRNA | |
| lacZ70 | ATTCAGCCATGTGCCTTCTT | 3' mRNA | |
| lacZ71 | AATCCCCATATGGAAACCGT | 3' mRNA | |
| lacZ72 | AGACCAACTGGTAATGGTAG | 3' mRNA |