Name: Probing mRNA Kinetics in Space and Time in Escherichia coli using Two-Color Single-Molecule Fluorescence In Situ Hybridization (Video) | JoVE Journal
Uploaded: 2020-07-30T13:30:00.000+00:00
Duration: 10 min 1 s
Description: Learn two-color smFISH to measure mRNA transcription and degradation kinetics in Escherichia coli. This protocol enables high-throughput analysis of 48 samples in eight hours for molecular biology research.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

This protocol was developed by S.K. during her postdoctoral research in Dr. Christine Jacobs-Wagner&#39;s laboratory at the Howard Hughes Medical Institute and the Microbial Sciences Institute at Yale University. We thank Dr. Jacobs-Wagner and her lab members for various inputs during the method development and Laura Troyer for critical reading of the manuscript. S.K. acknowledges support from the Searle Scholars Program; K.V. acknowledges the support of James Scholar Preble Research Award from the University of Illinois.

<ol><li>Bervoets, I., Charlier, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Diversity%2C+versatility+and+complexity+of+bacterial+gene+regulation+mechanisms%3A+opportunities+and+drawbacks+for+applications+in+synthetic+biology%5BTitle%5D)+AND+%22FEMS+Microbiology+Reviews%22%5BJournal%5D)">Diversity, versatility and complexity of bacterial gene regulation mechanisms: opportunities and drawbacks for applications in synthetic biology.</a> FEMS Microbiology Reviews. 43 (3), 304-339 (2019).</li>
<li>Epshtein, V., Nudler, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cooperation+between+RNA+polymerase+molecules+in+transcription+elongation%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Cooperation between RNA polymerase molecules in transcription elongation.</a> Science. 300 (5620), 801-805 (2003).</li>
<li>Vogel, U., Jensen, K. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+RNA+chain+elongation+rate+in+Escherichia+coli+depends+on+the+growth+rate%5BTitle%5D)+AND+%22Journal+of+Bacteriology%22%5BJournal%5D)">The RNA chain elongation rate in Escherichia coli depends on the growth rate.</a> Journal of Bacteriology. 176 (10), 2807-2813 (1994).</li>
<li>Tennyson, C. N., Klamut, H. J., Worton, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+human+dystrophin+gene+requires+16+hours+to+be+transcribed+and+is+cotranscriptionally+spliced%5BTitle%5D)+AND+%22Nature+Genetics%22%5BJournal%5D)">The human dystrophin gene requires 16 hours to be transcribed and is cotranscriptionally spliced.</a> Nature Genetics. 9, 184(1995).</li>
<li>Singh, J., Padgett, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Rates+of+in+situ+transcription+and+splicing+in+large+human+genes%5BTitle%5D)+AND+%22Nature+Structural+%26+Molecular+Biology%22%5BJournal%5D)">Rates of in situ transcription and splicing in large human genes.</a> Nature Structural & Molecular Biology. 16, 1128(2009).</li>
<li>Selinger, D. W., Saxena, R. M., Cheung, K. J., Church, G. M., Rosenow, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Global+RNA+Half-Life+Analysis+in+Escherichia+coli+Reveals+Positional+Patterns+of+Transcript+Degradation%5BTitle%5D)+AND+%22Genome+Research%22%5BJournal%5D)">Global RNA Half-Life Analysis in Escherichia coli Reveals Positional Patterns of Transcript Degradation.</a> Genome Research. 13 (2), 216-223 (2003).</li>
<li>Bernstein, J. A., Khodursky, A. B., Lin, P. -H., Lin-Chao, S., Cohen, S. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Global+analysis+of+mRNA+decay+and+abundance+in+Escherichia+coli+at+single-gene+resolution+using+two-color+fluorescent+DNA+microarrays%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Sciences%22%5BJournal%5D)">Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays.</a> Proceedings of the National Academy of Sciences. 99 (15), 9697-9702 (2002).</li>
<li>Pérez-Ortín, J. E., Medina, D. A., Chávez, S., Moreno, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((What+do+you+mean+by+transcription+rate%5BTitle%5D)+AND+%22BioEssays%22%5BJournal%5D)">What do you mean by transcription rate.</a> BioEssays. 35 (12), 1056-1062 (2013).</li>
<li>Tang, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((mRNA-Seq+whole-transcriptome+analysis+of+a+single+cell%5BTitle%5D)+AND+%22Nature+Methods%22%5BJournal%5D)">mRNA-Seq whole-transcriptome analysis of a single cell.</a> Nature Methods. 6 (5), 377-382 (2009).</li>
<li>Kuchina, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Microbial+single-cell+RNA+sequencing+by+split-pool+barcoding%5BTitle%5D)+AND+%22BioRxiv%22%5BJournal%5D)">Microbial single-cell RNA sequencing by split-pool barcoding.</a> BioRxiv. , 869248(2019).</li>
<li>Blattman, S. B., Jiang, W., Oikonomou, P., Tavazoie, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Prokaryotic+single-cell+RNA+sequencing+by+in+situ+combinatorial+indexing%5BTitle%5D)+AND+%22Nature+Microbiology%22%5BJournal%5D)">Prokaryotic single-cell RNA sequencing by in situ combinatorial indexing.</a> Nature Microbiology. , (2020).</li>
<li>Femino, A., Fay, F., Fogarty, K., Singer, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Visualization+of+single+RNA+transcripts+in+situ%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Visualization of single RNA transcripts in situ.</a> Science. 280 (5363), 585-590 (1998).</li>
<li>Raj, A., vanden Bogaard, P., Rifkin, S. A., van Oudenaarden, A., Tyagi, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Imaging+individual+mRNA+molecules+using+multiple+singly+labeled+probes%5BTitle%5D)+AND+%22Nature+Methods%22%5BJournal%5D)">Imaging individual mRNA molecules using multiple singly labeled probes.</a> Nature Methods. 5 (10), 877-879 (2008).</li>
<li>Montero Llopis, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Spatial+organization+of+the+flow+of+genetic+information+in+bacteria%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Spatial organization of the flow of genetic information in bacteria.</a> Nature. 466 (7302), 77-81 (2010).</li>
<li>So, L. -h, et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((General+properties+of+transcriptional+time+series+in+Escherichia+coli%5BTitle%5D)+AND+%22Nature+Genetics%22%5BJournal%5D)">General properties of transcriptional time series in Escherichia coli.</a> Nature Genetics. 43 (6), 554-560 (2011).</li>
<li>Taniguchi, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Quantifying+E.+coli+proteome+and+transcriptome+with+single-molecule+sensitivity+in+single+cells%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Quantifying E. coli proteome and transcriptome with single-molecule sensitivity in single cells.</a> Science. 329 (5991), 533-538 (2010).</li>
<li>Jones, D. L., Brewster, R. C., Phillips, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Promoter+architecture+dictates+cell-to-cell+variability+in+gene+expression%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Promoter architecture dictates cell-to-cell variability in gene expression.</a> Science. 346 (6216), 1533-1536 (2014).</li>
<li>Iyer, S., Park, B. R., Kim, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Absolute+quantitative+measurement+of+transcriptional+kinetic+parameters+in+vivo%5BTitle%5D)+AND+%22Nucleic+Acids+Research%22%5BJournal%5D)">Absolute quantitative measurement of transcriptional kinetic parameters in vivo.</a> Nucleic Acids Research. 44 (18), 142(2016).</li>
<li>Kim, S., Beltran, B., Irnov, I., Jacobs-Wagner, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Long-Distance+Cooperative+and+Antagonistic+RNA+Polymerase+Dynamics+via+DNA+Supercoiling%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Long-Distance Cooperative and Antagonistic RNA Polymerase Dynamics via DNA Supercoiling.</a> Cell. 179 (1), 106-119 (2019).</li>
<li>Wang, M., Zhang, J., Xu, H., Golding, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Measuring+transcription+at+a+single+gene+copy+reveals+hidden+drivers+of+bacterial+individuality%5BTitle%5D)+AND+%22Nature+Microbiology%22%5BJournal%5D)">Measuring transcription at a single gene copy reveals hidden drivers of bacterial individuality.</a> Nature Microbiology. 4 (12), 2118-2127 (2019).</li>
<li>Joo, C., Ha, T. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aJoo%2C+C+%22Labeling+DNA+%28or+RNA%29+for+single-molecule+FRET%22">Labeling DNA (or RNA) for single-molecule FRET</a>. 2012 (9), Cold Spring Harbor. 1005-1008 (2012).</li>
<li>Sambrook, J., Russell, D. W. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aSambrook%2C+J+%22Standard+Ethanol+Precipitation+of+DNA+in+Microcentrifuge+Tubes%22">Standard Ethanol Precipitation of DNA in Microcentrifuge Tubes</a>. 2006 (1), Cold Spring Harbor Protocols. 4456(2006).</li>
<li>Skinner, S. O., Sepúlveda, L. A., Xu, H., Golding, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Measuring+mRNA+copy+number+in+individual+Escherichia+coli+cells+using+single-molecule+fluorescent+in+situ+hybridization%5BTitle%5D)+AND+%22Nature+Protocols%22%5BJournal%5D)">Measuring mRNA copy number in individual Escherichia coli cells using single-molecule fluorescent in situ hybridization.</a> Nature Protocols. 8 (6), 1100-1113 (2013).</li>
<li>Adesnik, M., Levinthal, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+synthesis+and+degradation+of+lactose+operon+messenger+RNA+in+E.+coli%5BTitle%5D)+AND+%22Cold+Spring+Harbor+Symposia+on+Quantitative+Biology%22%5BJournal%5D)">The synthesis and degradation of lactose operon messenger RNA in E. coli.</a> Cold Spring Harbor Symposia on Quantitative Biology. 35, 451-459 (1970).</li>
<li>Campbell, E. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Structural+mechanism+for+rifampicin+inhibition+of+bacterial+RNA+polymerase%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Structural mechanism for rifampicin inhibition of bacterial RNA polymerase.</a> Cell. 104 (6), 901-912 (2001).</li>
<li>Raj, A., Tyagi, S. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aRaj%2C+A+%22Methods+in+Enzymology%22">Methods in Enzymology</a>. Walter, N. G. 472, Academic Press. 365-386 (2010).</li>
<li>Sliusarenko, O., Heinritz, J., Emonet, T., Jacobs-Wagner, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((High-throughput%2C+subpixel+precision+analysis+of+bacterial+morphogenesis+and+intracellular+spatio-temporal+dynamics%5BTitle%5D)+AND+%22Molecular+Microbiology%22%5BJournal%5D)">High-throughput, subpixel precision analysis of bacterial morphogenesis and intracellular spatio-temporal dynamics.</a> Molecular Microbiology. 80 (3), 612-627 (2011).</li>
<li>Paintdakhi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Oufti%3A+an+integrated+software+package+for+high-accuracy%2C+high-throughput+quantitative+microscopy+analysis%5BTitle%5D)+AND+%22Molecular+Microbiology%22%5BJournal%5D)">Oufti: an integrated software package for high-accuracy, high-throughput quantitative microscopy analysis.</a> Molecular Microbiology. 99 (4), 767-777 (2016).</li>
<li>Moffitt, J. R., Zhuang, X. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aMoffitt%2C+JR+%22Methods+in+Enzymology%22">Methods in Enzymology</a>. Filonov, G. S., Jaffrey, S. R. 572, Academic Press. 1-49 (2016).</li>
<li>Yu, J., Xiao, J., Ren, X., Lao, K., Xie, X. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Probing+gene+expression+in+live+cells%2C+one+protein+molecule+at+a+time%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Probing gene expression in live cells, one protein molecule at a time.</a> Science. 311 (5767), 1600-1603 (2006).</li>
<li>Chen, H., Shiroguchi, K., Ge, H., Xie, X. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome-wide+study+of+mRNA+degradation+and+transcript+elongation+in+Escherichia+coli%5BTitle%5D)+AND+%22Molecular+Systems+Biology%22%5BJournal%5D)">Genome-wide study of mRNA degradation and transcript elongation in Escherichia coli.</a> Molecular Systems Biology. 11 (1), 781(2015).</li>
<li>Vogel, U., Sørensen, M., Pedersen, S., Jensen, K. F., Kilstrup, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Decreasing+transcription+elongation+rate+in+Escherichia+Coli+exposed+to+amino+acid+starvation%5BTitle%5D)+AND+%22Molecular+Microbiology%22%5BJournal%5D)">Decreasing transcription elongation rate in Escherichia Coli exposed to amino acid starvation.</a> Molecular Microbiology. 6 (15), 2191-2200 (1992).</li>
<li>Yang, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Transcription+and+translation+contribute+to+gene+locus+relocation+to+the+nucleoid+periphery+in+E.+coli%5BTitle%5D)+AND+%22Nature+Communications%22%5BJournal%5D)">Transcription and translation contribute to gene locus relocation to the nucleoid periphery in E. coli.</a> Nature Communications. 10 (1), 5131(2019).</li>
<li>Zenklusen, D., Larson, D. R., Singer, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Single-RNA+counting+reveals+alternative+modes+of+gene+expression+in+yeast%5BTitle%5D)+AND+%22Nature+Structural+%26+Molecular+Biology%22%5BJournal%5D)">Single-RNA counting reveals alternative modes of gene expression in yeast.</a> Nature Structural & Molecular Biology. 15 (12), 1263-1271 (2008).</li>
<li>Fontenete, S., Guimarães, N., Wengel, J., Azevedo, N. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Prediction+of+melting+temperatures+in+fluorescence+in+situ+hybridization+%28FISH%29+procedures+using+thermodynamic+models%5BTitle%5D)+AND+%22Critical+Reviews+in+Biotechnology%22%5BJournal%5D)">Prediction of melting temperatures in fluorescence in situ hybridization (FISH) procedures using thermodynamic models.</a> Critical Reviews in Biotechnology. 36 (3), 566-577 (2016).</li>
<li>Sepúlveda, L. A., Xu, H., Zhang, J., Wang, M., Golding, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Measurement+of+gene+regulation+in+individual+cells+reveals+rapid+switching+between+promoter+states%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Measurement of gene regulation in individual cells reveals rapid switching between promoter states.</a> Science. 351 (6278), 1218-1222 (2016).</li>
<li>Huang, B., Wang, W., Bates, M., Zhuang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Three-Dimensional+Super-Resolution+Imaging+by+Stochastic+Optical+Reconstruction+Microscopy%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Three-Dimensional Super-Resolution Imaging by Stochastic Optical Reconstruction Microscopy.</a> Science. 319 (5864), 810-813 (2008).</li>
<li>Moffitt, J. R., Pandey, S., Boettiger, A. N., Wang, S., Zhuang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Spatial+organization+shapes+the+turnover+of+a+bacterial+transcriptome%5BTitle%5D)+AND+%22eLife%22%5BJournal%5D)">Spatial organization shapes the turnover of a bacterial transcriptome.</a> eLife. 5, 13065(2016).</li>
<li>Fei, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Determination+of+in+vivo+target+search+kinetics+of+regulatory+noncoding+RNA%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Determination of in vivo target search kinetics of regulatory noncoding RNA.</a> Science. 347 (6228), 1371-1374 (2015).</li>
</ol>

The authors declare they have no competing financial interests.

Here, we presented a smFISH protocol for measuring mRNA kinetics in E. coli. In the previously published smFISH protocols for bacteria23, cells were kept in the tubes until the very end of the protocol, that is until they are ready for imaging. While it has many benefits, such as minimal nonspecific binding of fluorescent probes on the coverslip surface23, it is difficult to follow these protocols when there are&#160;many samples&#160;from a time-course experiment. First, a relatively large volume of cells (&#62;1 mL) needs to be sampled and even harvested before fixation. Second, the cell samples need to be centrifuged multiple times to exchange solutions and to wash after the hybridization step. In our protocol, a small volume (&#60;1 mL) of culture is directly mixed with a fixing solution in a 1.5-mL tube, helping to quickly &#8220;freeze&#8221; the cell state at the moment of sampling. Also, cells stay attached to the surface throughout the procedure, and different solutions can be exchanged quickly by aspirating liquids with a vacuum filtration system and applying solution drops at once with a multi-channel pipette. This difference makes our protocol highly advantageous when a large number of samples need to be processed at once. Using our protocol, 12-48 samples can be handled simultaneously and the entire FISH procedure can be completed within ~8 hours, about a similar amount of time needed for a few samples (Figure 2). Although we used the expression of lacZ in E. coli as an example, the protocol is widely applicable to different genes and bacterial species with considerations discussed below.
For different genes, the first thing to consider is smFISH probes. One may design oligonucleotide probes that tile the mRNA of interest (Figure 1A)13. In this &#8220;tiling&#8221; probe approach, each probe is ~20 base long and labeled with a fluorophore at the 5&#8217; or 3&#8217; terminus. This strategy is convenient as no genetic manipulation is needed. Alternatively, a tandem repeat&#160;of ~20 bp sequence, foreign to the genomic sequence (e.g., an array of lacO sequence in Caulobacter crescentus14), may be inserted in the untranslated region of a gene of interest and a single probe complementary to the repeat unit is used to label the mRNA (&#8220;array&#8221; approach; Figure 1B). In both cases, multiple fluorophores decorate an mRNA, giving amplified fluorescence signal that can be easily differentiated from a single probe nonspecifically bound inside a cell.
Whether to choose &#8220;tiling&#8221; or &#8220;array&#8221; approaches depends on the negative control, a sample where nonspecific binding of probes is tested because it lacks the target mRNA. For tiling probes (Figure 1A), a mutant strain without the gene of interest or a condition, in which the gene is not transcribed (e.g., repression of lacZ) can serve as a negative control for testing nonspecific binding of probes. For the array-based smFISH (Figure 1B), a wild-type strain lacking the array can serve as a negative control because it does not contain binding sites for the probes.
Optimal hybridization conditions may depend on the probe sequences and even the choice of fluorophore dyes. We optimized the hybridization condition for lacZ probe sets by keeping the hybridization temperature at 37 &#176;C and testing different concentrations of probe sets and formamide in the hybridization solution. Higher concentrations of formamide tend to reduce both nonspecific and specific binding26,35. We recommend systematically changing the hybridization and its wash conditions while keeping hybridization time and temperature the same. As the condition becomes more stringent, both nonspecific and specific binding decrease (Figure 6). It is important to find a point where the nonspecific binding starts to hit below an acceptable threshold without further compromising specific binding. For example, we used the signal level obtained without any probes (&#8220;no probes&#8221;) as a threshold (Figure 6).
The two-color smFISH method labeling two separate regions of an mRNA is limited to long genes. To&#160;measure&#160;the rate of transcription elongation, we took advantage of the fact that lacZ is long (3075 bp) and its expression can be induced by IPTG. When a gene is short, it is difficult to design two tiling probe sets (near 5&#8217; and 3&#8217; ends) and resolve the time delay between appearances of 5&#8217; vs. 3&#8217; mRNA regions. In this case, one may count nascent mRNAs at steady state by smFISH and analyze their distribution with an analytical model that has the rate of transcription elongation as a fitting parameter20. Also, when a gene of interest is not inducible, one may treat cells with rifampicin at time zero and measure the temporal change in 5&#8217; and 3&#8217; mRNA sub-regions. The delay from the decrease of 5&#8217; mRNA signal to that of 3&#8217; mRNA signal can then be used to calculate the rate of transcription elongation as done previously31.
Finally, the smFISH protocol is versatile and can be combined with other labeling schemes. Previously, DNA locus was visualized together with mRNAs by combining mRNA FISH with either DNA FISH14 or fluorescent reporter-operator system20. Protein products may&#160;be visualized by performing immunofluorescence together with mRNA FISH14,36. Also, it can be combined with three-dimensional super-resolution microscopy37 to visualize mRNAs in all three dimensions38,39.&#160;

The flow of genetic information from DNA to mRNA and protein is one of the most fundamental cellular processes, whose regulation is important for cellular fitness1. The number of mRNAs in a cell is determined by two dynamic processes, transcription, and mRNA degradation. However, how transcription and mRNA degradation are regulated in time and space of a single cell remains not completely understood, largely due to the shortage of experimental methods to quantitatively measure their kinetics in vivo.
Methods based on total mRNAs extracted from a population of cells, such as Northern blot, RT-PCR, RNA sequencing, and gene expression microarrays, can measure the relative difference in mRNA levels and have been widely used to analyze the rate of transcription elongation2,3,4,5 or the rate of mRNA degradation6,7. However, they do not provide the absolute number of mRNAs per cell, and hence, they are not suitable for probing the rate of transcription initiation8. Also, because mRNAs are extracted from a population of cells, the spatial distribution of mRNAs within a single cell and the variability of mRNA copy numbers among cells cannot be measured.
Next-generation RNA sequencing on individual cells (scRNAseq) can quantify the number of mRNAs per cell in a genomic scale9. However, it remains difficult to use this technique to measure transcription kinetics, due to challenges with sample preparation and high cost. In particular, the application of scRNAseq to bacteria has been technically difficult due to low mRNA abundance10,11.
Single-molecule fluorescence in situ hybridization (smFISH) is based on the hybridization of fluorescently-labeled single-stranded probes whose sequences are complementary to the target mRNA of interest12,13. The concept of sequence-specific hybridization is similar to that used in Northern blot or RT-PCR, but the hybridization is done in situ within fixed cells, to preserve the native localization of mRNAs. The signal of a single mRNA is amplified using many probes, ~20 nucleotides (nt) in length, hybridizing to different parts of an mRNA (Figure 1A)13. In this &#8220;tiling&#8221; probe approach, the number of probes needed to detect a single mRNA sets a lower limit on the length of mRNA that can be assayed. Alternatively, the mRNA of interest may be transcriptionally fused to a non-coding array of tandem Lac operator sequences, such that multiple copies of a fluorescently labeled lacO probe hybridize to&#160;a single mRNA (Figure 1B)14.
smFISH has been used to quantify the number of mRNAs per cell at steady state (i.e., when synthesis and decay are in balance) and to analyze the mean and variability of mRNAs among bacterial cells15,16,17. Recently, smFISH has been applied to quantify mRNA numbers at non-steady state, right after induction or repression of gene expression in E. coli18,19,20. The temporal changes in the absolute mRNA copy numbers were then used to calculate the rate of transcription initiation, elongation, and termination, as well as the rate of mRNA degradation. For this application, conventional smFISH procedures can be cumbersome because there are many samples, each representing one time point, that need to go through multiple buffer exchange steps (i.e., centrifugation and washing). Here, we describe an smFISH protocol, in which the sample handling steps are dramatically simplified by having cells adhered to the surface of a coverslip and by aspirating liquids with a vacuum filtration system14,19. Using the expression of lacZ in E. coli as an example, the full workflow (Figure 2) is demonstrated, including image analysis (Figure 3) yielding the in vivo kinetics of transcription (initiation, elongation, and termination) and mRNA degradation, cell-to-cell variability in mRNA expression, and mRNA localization. We anticipate that the protocol is widely applicable to probe in vivo kinetics and localization of other mRNAs in various bacteria species.

<table><tbody><tr><td>&lt;strong&gt;Bacterial strain&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Escherichia coli MG1655</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Chemicals, peptides, and others&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Acetonitrile</td><td>Sigma-Aldrich</td><td>34851</td><td>UPLC buffer B</td></tr><tr><td>Ammonium chloride</td><td>Fisher Chemical</td><td>A661-500</td><td>To make M9 medium</td></tr><tr><td>Bovine serum albumin (BSA)</td><td>Sigma-Aldrich</td><td>B2518</td><td>Probe hybridization</td></tr><tr><td>Calcium chloride</td><td>Acros Organics</td><td>349610250</td><td>To make M9 medium</td></tr><tr><td>Casamino acid</td><td>BD Difco</td><td>223050</td><td>To make M9 medium</td></tr><tr><td>Cy3B NHS ester</td><td>GE Healthcare Life Sciences</td><td>PA63101</td><td>Fluorophore for FISH probes</td></tr><tr><td>Cy5 NHS ester</td><td>GE Healthcare Life Sciences</td><td>PA15101</td><td>Fluorophore for FISH probes</td></tr><tr><td>DEPC</td><td>Sigma-Aldrich</td><td>D5758</td><td></td></tr><tr><td>Dextran sulfate</td><td>Millipore</td><td>S4030</td><td>Probe hybridization</td></tr><tr><td>Dextrose</td><td>Fisher Chemical</td><td>D16</td><td>To repress the expression of lacZ</td></tr><tr><td>Dimethyl sulfoxide (DMSO)</td><td>Sigma-Aldrich</td><td>D8418</td><td>To dissolve fluorophores</td></tr><tr><td>E. coli tRNA</td><td>Sigma-Aldrich</td><td>R1753</td><td>Probe hybridization</td></tr><tr><td>Ethanol</td><td>Decon Laboratories</td><td>2701</td><td>Used in DNA purification, lysis, and cleaning coverslips</td></tr><tr><td>FISH probes</td><td>Biosearch Technologies</td><td></td><td>Sequences are published in ref#16</td></tr><tr><td>Formaldehyde</td><td>Ladd Research Industries</td><td>20295</td><td>Fixation</td></tr><tr><td>Formamide</td><td>American Bio</td><td>AB00600</td><td>Probe hybridization, pre-hybridization, and wash</td></tr><tr><td>Glycerol</td><td>Americanbio</td><td>AB00751-01000</td><td>To make M9 medium</td></tr><tr><td>Isopropylthio-&amp;beta;-galactoside (IPTG)</td><td>Invitrogen</td><td>15529019</td><td>lacZ induction</td></tr><tr><td>Magnesium sulfate</td><td>Fisher Chemical</td><td>M65-500</td><td>To make M9 medium</td></tr><tr><td>2-Nitrophenyl &amp;beta;-D-fucopyranoside (ONPF)</td><td>Santa Cruz Biotechnology</td><td>sc-216258</td><td>lacZ repression</td></tr><tr><td>Picodent twinsil 22</td><td>Picodent</td><td>1300 1000</td><td>Sealant</td></tr><tr><td>Poly-L-lysine</td><td>Sigma-Aldrich</td><td>P8920</td><td>To treat the coverslip surface</td></tr><tr><td>Potassium chloride</td><td>Fisher BioReagents</td><td>BP366-500</td><td>To make PBS</td></tr><tr><td>Potassium phosphate monobasic</td><td>Fisher BioReagents</td><td>BP362-500</td><td>To make PBS and M9 medium</td></tr><tr><td>Rifampicin</td><td>Sigma-Aldrich</td><td>R3501</td><td>To stop transcription initiation</td></tr><tr><td>Saline-sodium citrate buffer (SSC)</td><td>Invitrogen</td><td>AM9763</td><td>Probe hybridization, pre-hybridization, and wash</td></tr><tr><td>sodium bicarbonate</td><td>Fisher BioReagents</td><td>BP328-500</td><td>Fluorophore-probe conjugation</td></tr><tr><td>Sodium chloride</td><td>Fisher BioReagents</td><td>BP358-1</td><td>For DNA purification, PBS and M9 medium</td></tr><tr><td>Sodium phosphate dibasic</td><td>Fisher BioReagents</td><td>BP332-500</td><td>To make PBS and M9 medium</td></tr><tr><td>Sodium phosphate monobasic</td><td>Fisher BioReagents</td><td>BP329-500</td><td>To make a sodium phosphate buffer</td></tr><tr><td>Super PAP Pen</td><td>Invitrogen</td><td>8899</td><td>Hydrophobic marker for coverslips</td></tr><tr><td>TetraSpek microspheres</td><td>Invitrogen</td><td>T7280</td><td>Controls for multi-channel registration</td></tr><tr><td>Thiamine</td><td>Sigma-Aldrich</td><td>T1270</td><td>To make M9 medium</td></tr><tr><td>Triethylammonium acetate</td><td>Sigma-Aldrich</td><td>90358</td><td>UPLC buffer A</td></tr><tr><td>Vanadyl ribonucleoside complex (VRC)</td><td>Sigma-Aldrich</td><td>94742</td><td>Probe hybridization and pre-hybridization</td></tr><tr><td>&lt;strong&gt;Equipment&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>C18 column</td><td>Waters</td><td>Acquity BEH C18 column</td><td></td></tr><tr><td>Countertop centrifuge</td><td>Eppendorf</td><td>5425</td><td></td></tr><tr><td>Countertop incubator</td><td>Eppendorf</td><td>Thermomixer F1.5</td><td></td></tr><tr><td>Incubator (Oven)</td><td>Thermo Scientific</td><td>51030514</td><td>Gravity convection</td></tr><tr><td>Water purification system</td><td>Millipore</td><td>Milli-Q Reference</td><td></td></tr><tr><td>Nanodrop</td><td>Thermo Scientific</td><td>2000C</td><td></td></tr><tr><td>Nitrogen gas</td><td>Building</td><td></td><td>For blow-drying coverslips and glass slides</td></tr><tr><td>UPLC</td><td>Waters</td><td>Acquity UPLC system</td><td></td></tr><tr><td>Vacuum and aspirator</td><td>Building</td><td></td><td>Aspirator is made of a filtration flask with a side arm.</td></tr><tr><td>Vacuum concentrator</td><td>Labconco</td><td>7810010</td><td>Centrivap; to dry samples collected from UPLC.</td></tr><tr><td>Vortexer</td><td>Scientific Industries</td><td>Genie-2 SI-0236</td><td></td></tr><tr><td>Water bath shaker</td><td>New Brunswick</td><td>Innova 3100</td><td>Critical for time-course experiments</td></tr><tr><td>Water bath sonicator</td><td>VWR</td><td>97043-960</td><td>To clean coverslips and glass slides</td></tr><tr><td>&lt;strong&gt;Tools&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>1.5-mL tubes</td><td>Eppendorf</td><td>22431021</td><td>DNA lobind tubes</td></tr><tr><td>1000-uL pipette tip box</td><td>Denville Scientific</td><td>P1126</td><td>An empty box after using all the tips</td></tr><tr><td>Coplin jar</td><td>SPI</td><td>01240-AB</td><td>To clean coverslips and glass slides</td></tr><tr><td>Coverslip</td><td>Fisher Scientific</td><td>22-050-230</td><td>24x60 No1</td></tr><tr><td>Filtered pipette tips</td><td>Denville Scientific</td><td>P1121,P1122,P1126</td><td>SHARP&amp;reg; Precision Barrier Tips</td></tr><tr><td>Forceps</td><td>SPI</td><td>K35a</td><td>To handle clean coverslips and glass slides</td></tr><tr><td>Glass slide</td><td>Fisher Scientific</td><td>12-544-1</td><td></td></tr><tr><td>Gloves</td><td>Microflex</td><td>MK-296-M</td><td></td></tr><tr><td>Multichannel pipetter</td><td>Eppendorf</td><td>2231300045</td><td>To use in the washing step (#7)</td></tr><tr><td>Pipette</td><td>Gilson</td><td>P1000, P200, P20</td><td></td></tr><tr><td>Reagent reservoir</td><td>MTC Bio</td><td>P8025-1S</td><td>To use in the washing step (#7)</td></tr><tr><td>Syringe filter (0.22 um)</td><td>Millipore</td><td>SLGS033SS</td><td></td></tr><tr><td>Timer</td><td>VWR</td><td>62344-641</td><td></td></tr><tr><td>&lt;strong&gt;Software and algorithms&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>MATLAB</td><td>Mathworks</td><td>R2013 and up</td><td>https://www.mathworks.com</td></tr><tr><td>MicrobeTracker or Oufti</td><td></td><td></td><td>https://www.github.com/JacobsWagnerLab/MicrobeTracker</td></tr><tr><td colspan="4">https://oufti.org/</td></tr><tr><td>Stellaris Probe Designer</td><td>Biosearch Technologies</td><td></td><td>https://www.biosearchtech.com/support/tools/design-software/stellaris-probe-designer</td></tr><tr><td>&lt;strong&gt;Microscope&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>CCD camera</td><td>Hamamatsu Photonics</td><td>Orca-II-ER</td><td></td></tr><tr><td>Cy3 filter set</td><td>Chroma</td><td>49004</td><td></td></tr><tr><td>Cy5 filter set</td><td>Chroma</td><td>49006</td><td></td></tr><tr><td>Epi-fluorescence microscope</td><td>Nikon</td><td>Eclipse Ti</td><td>For phase-contrast and epi fluorescence</td></tr><tr><td>Fluorescence excitation source</td><td>Lumencor</td><td>SOLA-E</td><td></td></tr><tr><td>Nikon Elements software</td><td>Nikon</td><td></td><td>software that controls the microscope setup</td></tr><tr><td>Phase-contrast 100x objective</td><td>Nikon</td><td>Plan Apochromat (NA 1.45)</td><td></td></tr><tr><td>&lt;strong&gt;Probe sequence&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>DNA oligos with C6 amino modification at the 5&#039; end</td><td>Biosearch Technologies Inc</td><td></td><td></td></tr><tr><td>lacZ1</td><td></td><td>GTGAATCCGTAATCATGGTC</td><td>5&#039; mRNA</td></tr><tr><td>lacZ2</td><td></td><td>TCACGACGTTGTAAAACGAC</td><td>5&#039; mRNA</td></tr><tr><td>lacZ3</td><td></td><td>ATTAAGTTGGGTAACGCCAG</td><td>5&#039; mRNA</td></tr><tr><td>lacZ4</td><td></td><td>TATTACGCCAGCTGGCGAAA</td><td>5&#039; mRNA</td></tr><tr><td>lacZ5</td><td></td><td>ATTCAGGCTGCGCAACTGTT</td><td>5&#039; mRNA</td></tr><tr><td>lacZ6</td><td></td><td>AAACCAGGCAAAGCGCCATT</td><td>5&#039; mRNA</td></tr><tr><td>lacZ7</td><td></td><td>AGTATCGGCCTCAGGAAGAT</td><td>5&#039; mRNA</td></tr><tr><td>lacZ8</td><td></td><td>AACCGTGCATCTGCCAGTTT</td><td>5&#039; mRNA</td></tr><tr><td>lacZ9</td><td></td><td>TAGGTCACGTTGGTGTAGAT</td><td>5&#039; mRNA</td></tr><tr><td>lacZ10</td><td></td><td>AATGTGAGCGAGTAACAACC</td><td>5&#039; mRNA</td></tr><tr><td>lacZ11</td><td></td><td>GTAGCCAGCTTTCATCAACA</td><td>5&#039; mRNA</td></tr><tr><td>lacZ12</td><td></td><td>AATAATTCGCGTCTGGCCTT</td><td>5&#039; mRNA</td></tr><tr><td>lacZ13</td><td></td><td>AGATGAAACGCCGAGTTAAC</td><td>5&#039; mRNA</td></tr><tr><td>lacZ14</td><td></td><td>AATTCAGACGGCAAACGACT</td><td>5&#039; mRNA</td></tr><tr><td>lacZ15</td><td></td><td>TTTCTCCGGCGCGTAAAAAT</td><td>5&#039; mRNA</td></tr><tr><td>lacZ16</td><td></td><td>ATCTTCCAGATAACTGCCGT</td><td>5&#039; mRNA</td></tr><tr><td>lacZ17</td><td></td><td>AACGAGACGTCACGGAAAAT</td><td>5&#039; mRNA</td></tr><tr><td>lacZ18</td><td></td><td>GCTGATTTGTGTAGTCGGTT</td><td>5&#039; mRNA</td></tr><tr><td>lacZ19</td><td></td><td>TTAAAGCGAGTGGCAACATG</td><td>5&#039; mRNA</td></tr><tr><td>lacZ20</td><td></td><td>AACTGTTACCCGTAGGTAGT</td><td>5&#039; mRNA</td></tr><tr><td>lacZ21</td><td></td><td>ATAATTTCACCGCCGAAAGG</td><td>5&#039; mRNA</td></tr><tr><td>lacZ22</td><td></td><td>TTTCGACGTTCAGACGTAGT</td><td>5&#039; mRNA</td></tr><tr><td>lacZ23</td><td></td><td>ATAGAGATTCGGGATTTCGG</td><td>5&#039; mRNA</td></tr><tr><td>lacZ24</td><td></td><td>TTCTGCTTCAATCAGCGTGC</td><td>5&#039; mRNA</td></tr><tr><td>lacZ25</td><td></td><td>ACCATTTTCAATCCGCACCT</td><td></td></tr><tr><td>lacZ26</td><td></td><td>TTAACGCCTCGAATCAGCAA</td><td></td></tr><tr><td>lacZ27</td><td></td><td>ATGCAGAGGATGATGCTCGT</td><td></td></tr><tr><td>lacZ28</td><td></td><td>TCTGCTCATCCATGACCTGA</td><td></td></tr><tr><td>lacZ29</td><td></td><td>TTCATCAGCAGGATATCCTG</td><td></td></tr><tr><td>lacZ30</td><td></td><td>CACGGCGTTAAAGTTGTTCT</td><td></td></tr><tr><td>lacZ31</td><td></td><td>TGGTTCGGATAATGCGAACA</td><td></td></tr><tr><td>lacZ32</td><td></td><td>TTCATCCACCACATACAGGC</td><td></td></tr><tr><td>lacZ33</td><td></td><td>TGCCGTGGGTTTCAATATTG</td><td></td></tr><tr><td>lacZ34</td><td></td><td>ATCGGTCAGACGATTCATTG</td><td></td></tr><tr><td>lacZ35</td><td></td><td>TGATCACACTCGGGTGATTA</td><td></td></tr><tr><td>lacZ36</td><td></td><td>ATACAGCGCGTCGTGATTAG</td><td></td></tr><tr><td>lacZ37</td><td></td><td>GATCGACAGATTTGATCCAG</td><td></td></tr><tr><td>lacZ38</td><td></td><td>AAATAATATCGGTGGCCGTG</td><td></td></tr><tr><td>lacZ39</td><td></td><td>TTTGATGGACCATTTCGGCA</td><td></td></tr><tr><td>lacZ40</td><td></td><td>TATTCGCAAAGGATCAGCGG</td><td></td></tr><tr><td>lacZ41</td><td></td><td>AAGACTGTTACCCATCGCGT</td><td></td></tr><tr><td>lacZ42</td><td></td><td>TGCCAGTATTTAGCGAAACC</td><td></td></tr><tr><td>lacZ43</td><td></td><td>AAACGGGGATACTGACGAAA</td><td></td></tr><tr><td>lacZ44</td><td></td><td>TAATCAGCGACTGATCCACC</td><td></td></tr><tr><td>lacZ45</td><td></td><td>GGGTTGCCGTTTTCATCATA</td><td></td></tr><tr><td>lacZ46</td><td></td><td>TCGGCGTATCGCCAAAATCA</td><td></td></tr><tr><td>lacZ47</td><td></td><td>TTCATACAGAACTGGCGATC</td><td></td></tr><tr><td>lacZ48</td><td></td><td>TGGTGTTTTGCTTCCGTCAG</td><td></td></tr><tr><td>lacZ49</td><td></td><td>ACGGAACTGGAAAAACTGCT</td><td>3&#039; mRNA</td></tr><tr><td>lacZ50</td><td></td><td>TATTCGCTGGTCACTTCGAT</td><td>3&#039; mRNA</td></tr><tr><td>lacZ51</td><td></td><td>GTTATCGCTATGACGGAACA</td><td>3&#039; mRNA</td></tr><tr><td>lacZ52</td><td></td><td>TTTACCTTGTGGAGCGACAT</td><td>3&#039; mRNA</td></tr><tr><td>lacZ53</td><td></td><td>GTTCAGGCAGTTCAATCAAC</td><td>3&#039; mRNA</td></tr><tr><td>lacZ54</td><td></td><td>TTGCACTACGCGTACTGTGA</td><td>3&#039; mRNA</td></tr><tr><td>lacZ55</td><td></td><td>AGCGTCACACTGAGGTTTTC</td><td>3&#039; mRNA</td></tr><tr><td>lacZ56</td><td></td><td>ATTTCGCTGGTGGTCAGATG</td><td>3&#039; mRNA</td></tr><tr><td>lacZ57</td><td></td><td>ACCCAGCTCGATGCAAAAAT</td><td>3&#039; mRNA</td></tr><tr><td>lacZ58</td><td></td><td>CGGTTAAATTGCCAACGCTT</td><td>3&#039; mRNA</td></tr><tr><td>lacZ59</td><td></td><td>CTGTGAAAGAAAGCCTGACT</td><td>3&#039; mRNA</td></tr><tr><td>lacZ60</td><td></td><td>GGCGTCAGCAGTTGTTTTTT</td><td>3&#039; mRNA</td></tr><tr><td>lacZ61</td><td></td><td>TACGCCAATGTCGTTATCCA</td><td>3&#039; mRNA</td></tr><tr><td>lacZ62</td><td></td><td>TAAGGTTTTCCCCTGATGCT</td><td>3&#039; mRNA</td></tr><tr><td>lacZ63</td><td></td><td>ATCAATCCGGTAGGTTTTCC</td><td>3&#039; mRNA</td></tr><tr><td>lacZ64</td><td></td><td>GTAATCGCCATTTGACCACT</td><td>3&#039; mRNA</td></tr><tr><td>lacZ65</td><td></td><td>AGTTTTCTTGCGGCCCTAAT</td><td>3&#039; mRNA</td></tr><tr><td>lacZ66</td><td></td><td>ATGTCTGACAATGGCAGATC</td><td>3&#039; mRNA</td></tr><tr><td>lacZ67</td><td></td><td>ATAATTCAATTCGCGCGTCC</td><td>3&#039; mRNA</td></tr><tr><td>lacZ68</td><td></td><td>TGATGTTGAACTGGAAGTCG</td><td>3&#039; mRNA</td></tr><tr><td>lacZ69</td><td></td><td>TCAGTTGCTGTTGACTGTAG</td><td>3&#039; mRNA</td></tr><tr><td>lacZ70</td><td></td><td>ATTCAGCCATGTGCCTTCTT</td><td>3&#039; mRNA</td></tr><tr><td>lacZ71</td><td></td><td>AATCCCCATATGGAAACCGT</td><td>3&#039; mRNA</td></tr><tr><td>lacZ72</td><td></td><td>AGACCAACTGGTAATGGTAG</td><td>3&#039; mRNA</td></tr></tbody></table>

probing mrna kinetics in space and time in escherichia coli using two-color single-molecule fluorescence in situ hybridization

Probing mRNA Kinetics in Space and Time in Escherichia coli using Two-Color Single-Molecule Fluorescence In Situ Hybridization

Single-molecule fluorescence in situ hybridization (smFISH) allows for counting the absolute number of mRNAs in individual cells. Here, we describe an application of smFISH to measure the rates of transcription and mRNA degradation in Escherichia coli. As smFISH is based on fixed cells, we perform smFISH at multiple time points during a time-course experiment, i.e., when cells are undergoing synchronized changes upon induction or repression of gene expression. At each time point, sub-regions of an mRNA are spectrally distinguished to probe transcription elongation and premature termination. The outcome of this protocol also allows for analyzing intracellular localization of mRNAs and heterogeneity in mRNA copy numbers among cells. Using this protocol many samples (~50) can be processed within 8 h, like the amount of time needed for just a few samples. We discuss how to apply this protocol to study the transcription and degradation kinetics of different mRNAs in bacterial cells.

This protocol describes an application of single-molecule fluorescence in situ hybridization (smFISH) to measure the in vivo kinetics of mRNA synthesis and degradation.

Single-molecule fluorescence in situ hybridization (smFISH) allows for counting the absolute number of mRNAs in individual cells. Here, we describe an ...

probing-mrna-kinetics-space-time-escherichia-coli-using-two-color

Research

JoVE Journal

Biology

We describe a fluorescence microscopy method, Co-Translational Activation by Cleavage (CoTrAC), to image the production of protein molecules in live cells with single-molecule precision without perturbing the protein's functionality. This method has been used to follow the stochastic expression dynamics of a transcription factor, the λ repressor CI 1.

Single-molecule Imaging of Gene Regulation In vivo Using Cotranslational Activation by Cleavage (CoTrAC)

This protocol describes an experimental procedure for performing Fluorescence in situ Hybridization (FISH) for counting mRNAs in single cells at single-molecule resolution.

Visualization and Analysis of mRNA Molecules Using Fluorescence In Situ Hybridization in Saccharomyces cerevisiae

Studies of biomolecules in vivo are crucial for understanding molecular function in a biological context. Here we describe a novel method allowing the internalization of fluorescent biomolecules, such as DNA or proteins, into living microorganisms. Analysis of in vivo data recorded by fluorescence microscopy is also presented and discussed.

Internalization and Observation of Fluorescent Biomolecules in Living Microorganisms via Electroporation

Here we present a method for directly measuring transfer RNA charging levels from purified Escherichia coli RNA as well as a way to compare relative levels of transfer RNA, or any other short RNA, across different samples based on the addition of spike-in cells expressing a reference gene.

Quantification of the Abundance and Charging Levels of Transfer RNAs in Escherichia coli

This manuscript describes a method for labeling individual messenger RNA (mRNA) transcripts with fluorescently-labeled DNA probes, for use in single-molecule fluorescence in situ hybridization (smFISH) experiments in E. coli. smFISH is a visualization method that allows the simultaneous detection, localization, and quantification of single mRNA molecules in fixed individual cells.

Method for Labeling Transcripts in Individual Escherichia coli Cells for Single-molecule Fluorescence In Situ Hybridization Experiments

This single molecule fluorescence in situ hybridization protocol is optimized to quantify the number of RNA molecules in budding yeast during vegetative growth and meiosis.

Single Molecule Fluorescence In Situ Hybridization (smFISH) Analysis in Budding Yeast Vegetative Growth and Meiosis

Site-directed mutagenesis is a technique used to introduce specific mutations in deoxyribonucleic acid (DNA). This protocol describes how to do site-directed mutagenesis with a 2-step and 3-step polymerase chain reaction (PCR) based approach, which is applicable to any DNA fragment of interest.

Site-Directed Mutagenesis for In Vitro and In Vivo Experiments Exemplified with RNA Interactions in Escherichia Coli

Tracking individual translation events allows for high-resolution kinetic studies of cap-dependent translation mechanisms. Here we demonstrate an in vitro single-molecule assay based on imaging interactions between fluorescently labeled antibodies and epitope-tagged nascent peptides. This method enables single-molecule characterization of initiation and peptide elongation kinetics during active in vitro cap-dependent translation.

An In Vitro Single-Molecule Imaging Assay for the Analysis of Cap-Dependent Translation Kinetics

Single molecule RNA fluorescence in situ hybridization (smFISH) is a method to accurately quantify levels and localization of specific RNAs at the single cell level. Here, we report our validated lab protocols for wet-bench processing, imaging and image analysis for single cell quantification of specific RNAs.

Single Cell Analysis Of Transcriptionally Active Alleles By Single Molecule FISH

Single molecule fluorescence energy transfer is a method that tracks the tRNA dynamics during ribosomal protein synthesis. By tracking individual ribosomes, inhomogeneous populations are identified, which shed light on mechanisms. This method can be used to track biological conformational changes in general to reveal dynamic-function relationships in many other complexed biosystems. Single molecule methods can observe non-rate limiting steps and low-populated key intermediates, which are not...

Single Molecule Fluorescence Energy Transfer Study of Ribosome Protein Synthesis

Intestinal microbes, including extracellular bacteria and intracellular pathogens like the Orsay virus and microsporidia (fungi), are often associated with wild Caenorhabditis nematodes. This article presents a protocol for detecting and quantifying microbes that colonize and/or infect C. elegans nematodes, and for measuring pathogen load after controlled infections in the lab.

RNA Fluorescence in situ Hybridization (FISH) to Visualize Microbial Colonization and Infection in Caenorhabditis elegans Intestines

Learn two-color smFISH to measure mRNA transcription and degradation kinetics in Escherichia coli. This protocol enables high-throughput analysis of 48 samples in eight hours for molecular biology research.

Probing mRNA Kinetics in Space and Time in Escherichia coli using Two-Color Single-Molecule Fluorescence In Situ Hybridization

Explore More Videos