Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Sondering mRNA kinetik i rum og tid i Escherichia coli ved hjælp af to-color single-molecule fluorescens In Situ Hybridization

doi: 10.3791/61520 Published: July 30, 2020

Summary

Denne protokol beskriver en anvendelse af enkelt-molekyle fluorescens in situ hybridisering (smFISH) til at måle in vivo kinetik af mRNA syntese og nedbrydning.

Abstract

Single-molekyle fluorescens in situ hybridisering (smFISH) giver mulighed for at tælle det absolutte antal mRNA'er i de enkelte celler. Her beskriver vi en anvendelse af smFISH til at måle satserne for transskription og mRNA nedbrydning i Escherichia coli. Da smFISH er baseret på faste celler, udfører vi smFISH på flere tidspunkter i løbet af et tidsforløbseksperiment, dvs. På hvert tidspunkt skelnes subregioner af et mRNA spectrally til sondetransskriptionsforseelse og for tidlig afslutning. Resultatet af denne protokol giver også mulighed for at analysere intracellulær lokalisering af mRNAs og heterogenitet i mRNA-kopinumre blandt celler. Ved hjælp af denne protokol mange prøver (~ 50) kan behandles inden for 8 timer, ligesom den tid, der er nødvendig for blot et par prøver. Vi diskuterer, hvordan man anvender denne protokol til at studere transskription og nedbrydning kinetik af forskellige mRNAs i bakterieceller.

Introduction

Strømmen af genetiske oplysninger fra DNA til mRNA og protein er en af de mest grundlæggende cellulære processer, hvis regulering er vigtig for cellulære fitness1. Antallet af mRNA'er i en celle bestemmes af to dynamiske processer, transskription og mRNA-nedbrydning. Men hvordan transskription og mRNA nedbrydning er reguleret i tid og rum af en enkelt celle forbliver ikke helt forstået, hovedsagelig på grund af manglen på eksperimentelle metoder til kvantitativt at måle deres kinetik in vivo.

Metoder baseret på total mRNA'er, der er udvundet fra en population af celler, såsom Northern blot, RT-PCR, RNA-sekvensering og genekspressionsmikroarrays, kan måle den relative forskel i mRNA-niveauer og er blevet anvendt i vid udstrækning til at analysere transskriptionshastigheden2,,3,,4,,5 eller hastigheden af mRNA-nedbrydning6,7. Men de giver ikke det absolutte antal mRNAs per celle, og dermed, de er ikke egnet til sondering af hastigheden af transskriptionindledning 8. Også, fordi mRNA'er er udvundet fra en population af celler, kan den rumlige fordeling af mRNA'er inden for en enkelt celle og variabiliteten af mRNA-kopinumre blandt cellerne ikke måles.

Næste generations RNA-sekvensering på individuelle celler (scRNAseq) kan kvantificere antallet af mRNA'er pr. celle i en genomisk skala9. Det er dog stadig vanskeligt at bruge denne teknik til at måle transskription kinetik, på grund af udfordringer med prøve forberedelse og høje omkostninger. Især har anvendelsen af scRNAseq på bakterier været teknisk vanskelig på grund af lav mRNA overflod10,11.

Enkeltmolekyle fluorescens in situ hybridisering (smFISH) er baseret på hybridisering af fluorescerende-mærkede enkeltstrengede sonder, hvis sekvenser supplerer målet mRNA af interesse12,13. Begrebet sekvens-specifik hybridisering svarer til den, der anvendes i Northern blot eller RT-PCR, men hybridisering sker in situ inden for faste celler, for at bevare den oprindelige lokalisering af mRNA'er. Signalet fra en enkelt mRNA forstærkes ved hjælp af mange sonder, ~ 20 nukleotider (nt) i længden, hybridisering til forskellige dele af et mRNA (Figur 1A)13. I denne "flisebelægning" sonde tilgang, antallet af sonder er nødvendige for at opdage en enkelt mRNA sætter en lavere grænse for længden af mRNA, der kan analyseres. Alternativt kan mRNA af interesse transskriptionelt smeltet til en ikke-kodning vifte af tandem Lac operatør sekvenser, således at flere kopier af en fluorescerende mærket lacO sonde hybridisere til en enkelt mRNA (Figur 1B)14.

smFISH er blevet brugt til at kvantificere antallet af mRNAs pr. celle i stabil tilstand (dvs. når syntese og henfald er i balance) og til at analysere middelværdi og variabilitet af mRNAs blandt bakterieceller15,16,17. For nylig er smFISH blevet anvendt til at kvantificere mRNA-numre i ikke-stabil tilstand, lige efter induktion eller undertrykkelse af genekspression i E. coli18,19,20. De tidsmæssige ændringer i de absolutte mRNA-kopinumre blev derefter brugt til at beregne hastigheden af transskriptionsiniering, forlængelse og afslutning samt hastigheden af mRNA-nedbrydning. Til denne ansøgning kan konventionelle smFISH-procedurer være besværlige, fordi der er mange prøver, der hver repræsenterer et tidspunkt, der skal gennemgå flere bufferudvekslingstrin (dvs. centrifugering og vask). Her beskriver vi en smFISH-protokol, hvor prøvehåndteringstrinnene forenkles dramatisk ved at få cellerne til at holde sig til overfladen af en dækslæd og ved at aspirere væsker med et vakuumfiltreringssystem14,19. Ved hjælp lacZ af lacZ-ekspressionen i E. coli som eksempel demonstreres den fulde arbejdsgang (Figur 2), herunder billedanalyse (Figur 3), der giver in vivo kinetik af transskription (indledning, forlængelse og afslutning) og mRNA-nedbrydning, celle-til-celle-variabilitet i mRNA-ekspression og mRNA-lokalisering. Vi forventer, at protokollen er bredt anvendelig til sonde in vivo kinetik og lokalisering af andre mRNAs i forskellige bakteriearter.

Protocol

1. Forberedelse af smFISH-sonder

BEMÆRK: For at mærke smFISH sonder med en enkelt fluorophore, skal du følge en standardprotokol for mærkning af nukleinsyreoligonukleotider baseret på NHS ester kemi21.

  1. Design smFISH sonder. Beslut, om der skal anvendes "flisebelægningssonder" eller "array"-sonder (figur 1) til det pågældende gen. Se afsnittet Diskussion om, hvordan du træffer beslutningen.
    1. For "flisebelægningssonder" (Figur 1A)skal du bruge et online sondedesignerværktøj (se f.eks.
    2. For "array"-sonder (Figur 1B) udføres en BLAST-sekvenssøgning for at sikre, at sondesekvensen ikke supplerer andre mRNA-sekvenser.
    3. For at studere lacZ mRNA transskription og nedbrydning kinetik, bruge to sæt af 24 sonder, hvert sæt, der dækker den første og sidste 1 kb regioner lacZ (3.072 bp)19.
      BEMÆRK: Disse sondesæt benævnes i det følgende henholdsvis "5' mRNA-sonden" og "3' mRNA-sonden". Sekvenser af disse sonder er angivet i materialetabellen.
  2. Bestil sondesekvenser som DNA-oligonukleotrider med en C6 aminolinker i 5' enden. De enkelte sonder opløses i vand til 1 mM.
  3. Kombiner ækvimolarmængder af sonder til "5' mRNA-sonde" og "3' mRNA-sonde"-sæt. For eksempel, for 5 ' mRNA sonde indstillet til lacZ, kombinere 20 μL af hver sonde (i alt 24 slags sonder i sættet).
  4. Udfør ethanolnedbør 22 af de kombinerede sonder for at fjerne eventuelle forureninger af primære og sekundære aminer (såsom Tris, glycin, og ammonium salte), der kan hæmme bøjning reaktion. I sidste ende opløses DNA-pellet i 100 μL vand (giver ~ 4,5 mM DNA i en sonde sæt).
    BEMÆRK: Dette trin anbefales, selvom sonderne gennemgik en standard afsaltning af fabrikanten. En standard filter-baseret rensning kan arbejde i stedet for og ud over ethanol nedbør.
  5. Vælg to spektrally forskellige fluorophores med en monofunktionel NHS ester moiety, således at 5 ' og 3 ' mRNA sonde sæt kan mærkes differentieret. For eksempel forberede Cy5 NHS ester til 5 ' mRNA sonder og Cy3B NHS ester til 3' mRNA sonder. Hver type fluorofoser opløses i vandfri DMSO til endelig 20 mg/ml (~25 mM).
  6. Der tilberedes 0,1 M natriumbikarbonat (pH 8.5) lige før hver mærkningsreaktion. Udsættelse for luft i lang tid vil sænke sin pH og reducere mærkning effektivitet.
  7. Ved bøjningsreaktionen kombineres følgende: 15 μL cy5 fluorophorebestand (fra trin 1.5), 4 μL 5' mRNA-sondesæt (fra trin 1.4), 75 μL natriumbikarbonat (fra trin 1.6) og 7 μL vand. Wrap røret med aluminiumsfolie og ryst ved stuetemperatur i 3-6 h.
    BEMÆRK: Længere inkubation medfører ikke nødvendigvis større mærkningseffektivitet. Desuden kan reaktionen skaleres op eller ned, hvis koncentrationerne af komponenterne opretholdes.
  8. Gentag ovenstående trin for 3' mRNA-sondens sæt og det tilsvarende fluorophore (dvs. Cy3B NHS-ester).
  9. Udfør ethanol nedbør22 for at fjerne un-reagerede farvestof molekyler. Pellet opløses i ~50 μL TE-buffer (10mM Tris-HCl pH 8.0 med 1mM EDTA).
  10. Estimer koncentrationerne af DNA og fluorophore ved hjælp af et UV-Vis spektrometer.
    1. Absorbansen måles ved 260 nm og 559 nm (Cy3B) eller 649 nm (Cy5). Hvis prøven er for koncentreret til at give en nøjagtig måling, fortyndes 1 μL af prøven til 10 μL.
    2. Absorbansen omdannes til koncentrationen:
      Equation 1
      Equation 2
      Equation 3
      εDNA = 0,2 μM-1 (for 20-nt enkeltstrenget DNA), εCy5 = 0,25 μM-1og εCy3B = 0,13 μM-1
      BEMÆRK: [DNA] er koncentrationen af de samlede sonder i opløsningen. Koncentrationen af de enkelte sonder er omkring 24x lavere. Koncentrationen af de samlede sonder vil blive anvendt som "sondekoncentrationer" fra dette punkt. Hvis forholdet mellem [DNA] og [farvestof] er 1, kan følgende HPLC-trin springesover 23, og prøven skal fortyndes til den endelige 4-5 μM i TE-buffer.
  11. (Anbefales) Rens de mærkede sonder fra umærkede sonder og frie farvestoffer ved hjælp af HPLC.
    BEMÆRK: Selv om dette yderligere rensningstrin vil føre til tab af prøve, er det gavnligt for downstream-applikationerne. Fjernelse af umærkede DNA-sonder vil øge fluorescenssignalet fra mRNA-mål, og fjernelse af ureagerede farvestoffer vil reducere baggrundsfluorescens.
    1. Hplc klargøres med en standardanalytisk C18-kolonne, 0,1 M triethylammoniumacetat (TEAA) som buffer A og acetonitrile som buffer B.
    2. Der tilsættes 1 M TEAA til prøven (fra trin 1.9) for at lave 0,1 M TEAA.
    3. Indstil forløbsprogrammet på følgende måde: 0-5 min. med 0% B, 5-35 min. med en 0-30% lineær gradient på B, 35-37 min. med en 30-100% lineær gradient på B og 37-40 min med 0% B. Hold strømningshastigheden på 0,1 ml/min. og optag kromatogram ved 260 og 649 nm (for de Cy5-mærkede prøver) eller ved 260 og 559 nm (for cy3B-mærkede prøver).
    4. Den eluterede prøve opsamls, når absorbansen øges i både DNA- og fluorophorekanalerne.
    5. Den eluterede prøve koncentreres ved hjælp af en vakuumkoncentrator, og pelleten skal suspenderes igen i 50-100 μL TE-buffer.
  12. Kontroller koncentrationen af DNA og fluorophore ved hjælp af et UV-Vis spektrometer (se trin 1.10). Fortyndes om nødvendigt for at gøre den endelige koncentration omkring 4-5 μM. Opbevar sonderne ved -20 °C

2. Udarbejdelse af opløsninger

  1. Forbered en stor mængde DEPC-behandlet vand og buffere (tabel 1). Disse opløsninger kan vare over et år ved stuetemperatur.
  2. Forbered 4x fastgørelsesopløsning og vaskeopløsning (Tabel 1).
  3. Forbered for hybridiseringsløsningen og sondehybribiliseringsløsningen (Tabel 1). Sonde hybridiseringsopløsningen klargøres under inkubationen i trin 5.1 eller trin 6.1, og opløsningen opbevares derefter i en 37 °C bordpladeshaker i 20-40 min. med et dæksel for at minimere eksponeringen for lys.
    BEMÆRK: Koncentrationerne af formamid, SSC og sonden blev optimeret til lacZ-sondens sæt for at minimere baggrundsfluorescens, samtidig med at det virkelige signal maksimeres. Se afsnittet Diskussion for at få flere oplysninger om, hvordan du ændrer disse koncentrationer for forskellige programmer.

3. Klargøring af dækslinge og glasdias

  1. Rengør dækslæber og glasdias.
    1. Placer individuelle dækslæber og dias i en Coplin krukke ved hjælp af sniver. Sørg for, at dækslerne og objektglassene er adskilt og ikke rører hinanden.
    2. Fyld krukken med 100% ethanol og luk låget. Placer krukken i et vandbad ultralydsrenser og soniker i 15-20 min.
      BEMÆRK: For vandbadets lydapparat anbefales det at slukke for varmelegemefunktionen.
    3. Hæld ethanol ud og vask med ultrarent vand 3-4x. Brug vand, der strømmer direkte fra vandrensningsmaskinen.
    4. Hæld vandet ud af krukken og fyld det med 70% ethanol. Luk låget og udfør sonikering i 15-20 min og vask med ultrarent vand.
    5. Fyld krukken med ultrarent vand og sonikere i 15-20 min.
      BEMÆRK: Dækslæber og glasdias kan opbevares natten over i Coplin-krukken fyldt med ultrarent vand.
    6. Tag et dias eller en dæksling ud af Coplin-krukken ved hjælp af rene sceliner, og føntørre den ved hjælp af N2-gas. Gentag dette for de resterende dias og dækslæber.
  2. De tørrede objektglas i en ren opbevaringsboks, indtil de anvendes i trin 7.5. De tørrede dækslæber sættes i en tom 1.000-μL pipettespidskasse, der vil fungere som et "kammer" i den resterende procedure.
  3. Ved hjælp af en hydrofobe markør tegnes cirkler på dækslerne efter cirkulære huller i pipettespidsboksen. Disse cirkler (~ 0,5 cm i diameter) vil tjene som "brønde". Vent mindst 5-10 min for markøren skal være helt tørret.
    BEMÆRK: Hold altid låget på spidsboksen lukket.
  4. Påfør en 20-μL fald på 0,1% poly-L-lysin til hver brønd. Inkuber i 10-50 min ved stuetemperatur.
    BEMÆRK: Juster denne lydstyrke i henhold til brøndstørrelsen. Sørg for, at opløsningen dækker brøndområdet fuldstændigt. Ved længere inkubation skal du være omhyggelig med at undgå fordampning.
  5. Efter inkubation aspirat poly-L-lysin uden at røre overfladen, da dette vil skrabe poly-L-lysin off. Derefter påføres en dråbe (~ 20 μL) AF DEPC vand til poly-L-lysin behandlede brønde. Luk låget på "kammeret" for at forhindre fordampning indtil trin 5.1.

4. Forsøg på tid og kursus og prøvefiksering

  1. Dyrk E. coli celler i ~ 20 ml flydende kultur i en 250-ml kolbe. Kolben opbevares i en vandbadsrystende (30 °C) og fortsætter med at ryste. Stop kun shakeren, når der tages prøver.
    BEMÆRK: Resultaterne i dette papir er opnået fra MG1655 celler dyrket i M9 minimal medium suppleret med 0,2% glycerol, 0,1% casamino syrer, og 1 mg / L thiamin til en eksponentiel vækstfase (OD600~ 0,2).
  2. Der tilsættes 250 μL μL 4x fastgørelsesopløsning i et tomt 1,5 ml rør. Gentag og forberede flere rør, så mange som de tidspunkter, der skal træffes. Mærl rørene med tidspunktnumre, og hold dem ved stuetemperatur.
  3. Tag 750 μL cellekultur (OD600~0,2), før du starter et time-kursus eksperiment. Føj kulturen til et rør, der er markeret til "tids nul" (fra trin 4.2). Inverter røret forsigtigt for at blande celler med fastgørelsesopløsningen.
    BEMÆRK: Må ikke pipette op og ned for at blande, vortex, eller "være ru" på cellerne. Denne prøve repræsenterer den undertrykte tilstand og vil blive brugt som et kontrolelement til at beregne fluorescensintensiteten for et enkelt mRNA (se trin 9.4).
  4. Der tilsættes 0,02-1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) til den flydende kultur for at fremkalde lacZ-udtryk. Start en timer på dette tidspunkt (t = 0 min) og prøve med et bestemt tidsinterval (f.eks. hver 1 min. fra da af. Ved prøveudtagning gentages trin 4.3.
  5. Der tilsættes 5 mM orthonitropheynl-β-D-fucopyranoside (ONPF) eller 500 mM glucose24 på et bestemt tidspunkt i løbet af tidsforløbseksperimentet (f.eks. ved t = 1,5 min) for at undertrykke lacZ-ekspressionen. lacZ Efter re-undertrykkelse fortsættes med at prøve kulturerne (trin 4.3) for at spore mRNA nedbrydning.
    BEMÆRK: Undertrykkelse kan også gøres med ~ 400 μg / ml rifampicin, en transskription indledning hæmmer25.
  6. Ved fiksering inkuberes rørene, der indeholder de prøverede celler ved stuetemperatur, i 15 minutter efterfulgt af inkubation i is i 30 min.
  7. For at fjerne fikse midler, centrifuge rørene på 4.500 x g i 4 min ved stuetemperatur. Fjern supernatanten med en pipette.
    BEMÆRK: Sørg for at kassere formaldehyd i en separat affaldsbeholder efter sikkerhedsprotokollen.
  8. Tilsæt 1 ml DEPC-PBS, og cellerne skal suspenderes igen. Gentag centrifugering og re-suspension 2x flere gange.
    BEMÆRK: Faste celler er skrøbelige og har brug for skånsom behandling. Re-suspender forsigtigt pellet og undgå bobler.
  9. Efter det sidste vasketrin skal cellerne igen suspenderes i ~30 μL DEPC-PBS.

5. Permeabilisering af cellemembraner

  1. Påfør hver tidspunktsprøve på forskellige brønde på dækslæbet (~30 μL pr. brønd). Vent i 10-30 min ved stuetemperatur for celler at holde på overfladen. Undgå sammenlægning af væsken dråber mellem brønde.
  2. For at skylle ubundne celler, aspirere væsken og anvende ~ 20 μL DEPC PBS til hver brønd. Aspirate DEPC PBS inden for få minutter.
  3. Permeabilize cellemembranerne ved at anvende 15 μL af 70% ethanol til hver brønd i 4 min. Aspirere ethanol efter 4 min, og sørg for, at brøndene er helt tørre.
    BEMÆRK: Det er afgørende at begrænse ethanolbehandlingen i 4 min. Længere behandling vil resultere i over-permeabilization.
  4. Påfør 30 μL af vaskeopløsningen på hver brønd.

6. Sonde hybridisering

  1. Aspirer vaskeopløsningen fra hver brønd. Påfør 30 μL af for hybridiseringsopløsningen på hver brønd. Kammeret inkuberes i 37 °C ovnen i 30 min.
    BEMÆRK: Tilsæt ~ 50 ml vand til bunden af kammeret for at give fugtighed.
  2. Aspirere præ-hybridiseringsløsningen fra hver brønd. Påfør ~ 30 μL af sonden hybridisering løsning på hver brønd. Dæk kammeret med aluminiumsfolie og inkuberes i 37 °C ovnen i 2 timer.
    BEMÆRK: Sørg for, at sondehybribiliseringsopløsningen er i 37 °C-bordpladeshakeren før dette trin. Undgå sammenlægning af væsker mellem brønde. Anvend en mindre mængde af opløsningen på hver brønd, hvis det er nødvendigt.

7. Efter hybridisering vask og forberedelse til billedbehandling

  1. Brug en multikanalpipette til at påføre ~30 μL af vaskeopløsningen på hver brønd på én gang. Aspirere og gentag 3-5x gange vask. Kammeret inkuberes i 37 °C ovnen i 15-30 min.
  2. Gentag trin 7.1 to gange mere.
  3. Vask hver brønd med DEPC-PBS 5x gange. Følg den metode, der anvendes i trin 7.1, men spring inkubationsprocessen over.
  4. Aspirer væsken fra dækslæbet. Påfør 4 μL DEPC-PBS på hver brønd.
  5. Brug hpind, løft og vend dækslingen, og læg den forsigtigt over et glasdias (fra trin 3.2). Undgå bobler.
  6. Seal kanterne af coverslip med silikone tandkød.
  7. Vent, indtil tyggegummiet er størknet. Man kan holde pause her og opbevare rutsjebanen natten over ved 4 °C.
    BEMÆRK: Andre smFISH protokoller foreslår at tilføje ilt skylle-reagenser (f.eks glukose oxidase / katalase) eller ved hjælp af en kommerciel anti-fade montering medium14,26 at øge fototabilitet af fluorophores.

8. Billeddannelse

  1. Hvis du vil finde et interesseområde, skal du bruge den dynamiske form for fasekontrastbilleddannelse. Ændre synsfeltet inden for en brønd ved at manøvrere scenen joystick. Vælg et område, hvor celletætheden er optimal (dvs. der er mange celler, der for det meste er adskilt). Juster z-fokus, så fasekontrastcellebilleder er i fokus.
  2. Tag snapshots i rækkefølgen cy5 (4-s eksponering), Cy3 (2-s eksponering), og fase kontrast (0,2-s eksponering).
    BEMÆRK: Cy3B farvestof molekyler er afbildet i Cy3 kanal, og billederne kaldes Cy3 billeder.
  3. Gentag trin 8.1-8.2 for at erhverve billeder af ~ 10 forskellige områder inden for en brønd.
  4. Flyt målet til en anden brønd, og gentag trin 8.1-8.3.
  5. Eksporter billeder som TIFF-filer.
  6. (Valgfrit) Billede multi-farve perler adsorberet på coverslip overflade i Cy5 og Cy3 kanaler til at bestemme rumlige skift mellem Cy5 og Cy3 kanaler til billedregistrering formål.
    1. Påfør ~ 10 μL multi-farve fluorescerende perler (0,2 μm diameter) på en ren coverslip overflade og vente i 10-30 min. Efter vask med ~ 50 μL PBS, anvende ~ 5 μL PBS og sandwich dækslæbet med et glas dias. Forsegle og montere på mikroskopet.
    2. Billedperler i både Cy5- og Cy3-kanaler.

9. Billedanalyse

BEMÆRK: Matlab-kode, der bruges i dette trin, er tilgængelig på følgende GitHub-websted: https://github.com/sjkimlab/Code_Publication/tree/master/JoVE_2020. Mappen GitHub indeholder alt, hvad der er nødvendigt for billedanalysen, herunder parameterværdier for cellesegmentering og staffageidentifikation. Proceduren i dette trin er yderligere forklaret i master script, kaldet "FISHworkflow.m".

  1. Åbn et cellesegmenteringsværktøj,28f.eks.27 Vælg "Uafhængige rammer", og tryk på en knap med titlen "Alle rammer" for at starte segmenteringsprocessen, hvorfra celler identificeres, og deres konturer beregnes (Figur 3B,C).
    BEMÆRK: Detaljerede protokoller for brug af disse softwarepakker er tilgængelige online (f.eks. oufti.org).
  2. Indlæs Cy5 fluorescensbilleder i funktionen spotFinder for mikrobeTracker eller Oufti, og tryk på knappen "Kør" for at begynde spotidentifikation og kvantificering baseret på 2D Gaussisk montering (Figur 3B,C). Gentag dette trin for Cy3 fluorescens billeder til at analysere pletter i Cy3 kanal. Dette trin indeholder en liste over pletter i hver celle, herunder deres intensiteter og koordinater.
  3. (Valgfrit) Bortfiltrer dim spots (falske positiver) ved hjælp af en tærskel, som forklaret i FILEN FISHworkflow.m.
    BEMÆRK: Der undersøges fluorescerende pletter i den negative kontrol (f.eks.lacZ
  4. For at opnå spotintensiteten af et enkelt mRNA skal du bruge en liste over punktintensiteter målt ved tids nul (før du tilføjer IPTG), og fordelingen af punktintensiteter passer til en gaussisk blandingsmodel med to blandingskomponenter. Tag den første gaussiske befolknings topposition (sort linje i figur 3D,E),Esom spotintensiteten for et enkelt mRNA. Udfør dette for Cy5 spots og Cy3 spots separat for at opnå spotintensiteten af en enkelt 5' og 3' lacZ mRNA.
    BEMÆRK: Gentag dette i hvert tidskursuseksperiment, fordi spotintensiteten af et enkelt mRNA kan variere en smule i forskellige eksperimenter.
  5. Divider fluorescensintensiteten af et sted med intensiteten af et enkelt mRNA (fra trin 9.4) for at opnå antallet af mRNA'er på et sted. Summer normaliserede staffageintensiteter i en celle for at beregne det samlede antal mRNA i en celle (Figur 3F). Udfør disse beregninger for 5' og 3' mRNA separat.
  6. De gennemsnitlige mRNA-tal pr. celle beregnes og afbildes pr. celle på hvert tidspunkt (f.eks. figur 4B), og in vivo-kinetik af transskription og mRNA-nedbrydning fra den tidsmæssige ændring i de gennemsnitlige mRNA-niveauer (Figur 4B).
    1. For at opnå transskriptionskulationshastigheden skal du udføre mindst kvadrater, der passer på en linje til den oprindelige stigning i 5' og 3' mRNA-signaler, og identificere aflytninger til de basale niveauer (figur 4B). Forskellen mellem disse aflytninger angiver den gennemsnitlige tid for RNAPs at rejse fra 5 'sonde region til 3 ' sonde region. Divider afstanden mellem to sondesæt (2 kb) med denne gang for at opnå den gennemsnitlige transskriptionsforlængelseshastighed.
    2. For at opnå mRNA-nedbrydningshastigheden skal der monteres en eksponentiel henfaldsfunktion, y = A·exp(-t/τ) til det endelige henfaldsområde i 5' og 3' mRNA-signalerne (f.eks. figur 4B). Tilpasningsparameteren er den gennemsnitlige mRNA-levetid.
  7. (Valgfrit) Analysere celle-til-celle-variationen i genekspression (f.eks. celleniveauresponsen på induktion vist i figur 4C) baseret på fordelingen af mRNA-tal i hver celle (beregnet i trin 9.5).
  8. (Valgfrit) Ved hjælp af oplysninger om stedet placering langs de store og mindre akser i en celle (opnået fra trin 9.2), analysere lokalisering af mRNAs (Figur 4D,E).
  9. (Valgfrit) Analysér sam lokalisering af 5' og 3' mRNAs (figur 5) ved at sammenligne lokalisering af pletter, der er fundet i Cy5- og Cy3-kanalerne.
    1. Læg billeder af multifarvede perler (trin 8.6) i spotFinderF-funktionen i mikrobeTracker og få koordinater for perlecentroider i Cy5- og Cy3-kanaler. Brug listen over centroidkoordinater til at beregne affine transformationsmatrixen, som informerer om, hvordan Cy5- og Cy3-kanaler flyttes og roteres i forhold tilhinanden 29.
    2. Anvend affine transformation matrix til Cy5 og Cy3 FISH billeder til at konvertere Cy3 billeder i Cy5 koordinere. Klassificere, hvis et sted er sam lokaliseret med et andet sted i en anden kanal. For eksempel anses et sted i Cy5-kanalen for at være sam lokaliseret med et andet sted i Cy3-kanalen, hvis afstanden mellem centroiderne er mindre end 150 nm (Figur 5).
    3. Analysere, hvor mange Cy5 pletter er klassificeret som "co-lokaliseret" med Cy3 pletter på hvert tidspunkt. Også analysere intensiteten af de samdepots pletter (Figur 5).

Representative Results

Figur 3 viser repræsentative billeder fra denne smFISH-protokol. Et fuldt synsfelt (86,7 μm x 66,0 μm ved hjælp af vores mikroskopi opsætning beskrevet i Tabel over Materialer) viser ~ 500 E. coli celler spredt over hele feltet ( Figur3A). Hvis cellernes tæthed er meget højere end det, der vises i dette billede, bliver automatisk cellesegmentering vanskelig, da segmenteringsalgoritmer ikke pålideligt identificerer individuelle celler, når celler rører hinanden. Man skal justere koncentrationen af celler og inkubationstid, der anvendes til overfladebeklæbende (trin 5.1) for at opnå den optimale tæthed af celler i synsfeltet.

Cellernes morfologi i fasekontrastbillederne bør forblive sammenlignelig med levende cellers til segmenteringsformål (figur 3A-C). Hvis cellerne er over-permeabilized, cellen morfologi ændringer (som "spøgelser"; Supplerende figur 1). I så fald kan man nedsætte varigheden af 70% ethanolbehandling i trin 5.3.

Før induktion var det gennemsnitlige lacZ-udtryksniveau ~ 0,03 mRNAs pr. celle, hvilket eri overensstemmelse med tidligere rapporter 15,30. Også fordelingen af lacZ mRNA spot intensiteter før induktion ikke passer godt med en normal fordeling eller en Poisson fordeling på grund af tilstedeværelsen af pletter med høje intensiteter (Figur 3D,E). Dette tyder på, at de fleste af de pletter opdaget under den undertrykte tilstand repræsenterer en enkelt lacZ mRNA, men en lille population af pletter indeholder mere end én lacZ mRNA. For at isolere populationen med en enkelt lacZ mRNA brugte vi en gaussisk blandingsmodel med to blandingskomponenter (indlæg i figur 3D,E). Derefter blev gennemsnittet af den første Gaussian taget som gennemsnitsintensiteten af et enkelt mRNA-punkt (f.eks. toppen af den sorte kurve i figur 3D) og bruges til at konvertere spotintensiteten til antallet af mRNA'er for eventuelle pletter, der påvises i tidsforløbseksperimentet. For at beregne det samlede antal mRNA'er i en celle blev de normaliserede staffageintensiteter opsummeret i hver celle (Figur 3F)19.

Når ekspressionsniveauet for lacZ mRNA er lavt, er der en eller to diffraktions-begrænsede lacZ mRNA-pletter, der er rumligt adskilt i en celle. Derfor kan billederne af disse pletter analyseres ved 2D Gaussian montering for deres intensitet og lokalisering.

Når udtryksniveauet er højt, så pletter overlapper hinanden i en celle, er 2D Gaussian fitting ikke pålidelig kvantificering. I så fald skal mRNA-niveauet beregnes ved at dividere det samlede, baggrundsfraterede fluorescenssignal i en celle med gennemsnitsintensiteten af en enkelt mRNA19.

Når der induceres lacZ-ekspression, øges signalet fra 5' lacZ mRNA først, og 3' lacZ mRNA stiger senere ( Figur4B). Hvis lacZ's ekspression undertrykkes, falder både 5' og 3' lacZ mRNA-signaler med en vis forsinkelse imellem (Figur 4B). For at opnå transskriptionsom forlængelse, stigningen i 5 'og 3' signaler er først passer medlinjer (Figur 4B), og forskellen i x-aflytninger er taget som tid for RNAPs at rejse afstanden mellem to sonde regioner (2.000 nt). Transskriptionshastigheden kan måles fra hvert tidskursuseksperiment, og standardafvigelser kan beregnes ud fra eksperimentelle dubletter. Den gennemsnitlige transskriptionsforlængelse var 15-30 nt/s under vores eksperimentelleforhold 19.

Derudover blev hastigheden af mRNA-nedbrydning (omvendt af den gennemsnitlige mRNA-levetid) opnået ved at montere henfaldsregionen med en eksponentiel funktion (Figur 4B). Vores tidsforløbsdata indeholder mRNA-nedbrydning under og efter transskription31. Vi passer til tidspunkterne efter 3 ' mRNA begyndte at henfalde (t > 6 min) at sonde nedbrydningen af frigivne mRNA'er. Vi opnåede ~ 90 s som en gennemsnitlig levetid på enten 5 'eller 3' lacZ mRNA19.

Hastigheden af transskriptionsiniten kan beregnes ud fra hældningen af 5' signalforøgelse efter induktion(figur 4B, blå) eller fra det gennemsnitlige mRNA-tal i stabil tilstand (som er initieringshastigheden divideret med nedbrydningshastigheden). Desuden kan sandsynligheden for for tidlig transskriptionsafslutning anslås, enten ved at tage forholdet mellem hældningen af 3' signalstigning i forhold til 5' signalstigning32 eller mellem steady-state-niveauet i 3' og 5' mRNA-regioner19.

Da smFISH er en encellet teknik, kan vi analysere celle-til-celle variabilitet i transskription. For eksempel kan man analysere procentdelen af celler, der udtrykker lacZ mRNA efter IPTG er tilføjet (Figur 4C). Man kan også tage fat på, om mRNA-lokalisering ændres efter induktion. Vi bemærkede, at 5 ' og 3' lacZ mRNA pletter bevæge sig lidt udad, væk fra midten af cellen (Figur 4D, E), i overensstemmelse med en tidligere rapport33.

Endelig kan analysen af sam lokalisering mellem 5' og 3' mRNA-spots være informativ (figur 5A). For eksempel, i undertrykt tilstand (tid nul), omkring 25% af 5 'mRNA pletter er co-lokaliseret med en 3 ' mRNA stedet. Ved t = 1 min, da mange genloci har 5' mRNA syntese, men endnu ikke 3' mRNA syntese, er de fleste af de 5' mRNA-pletter i sig selv uden 3' mRNA-signal (dvs. lav sandsynlighed for co-lokalisering). Men når 3 ' mRNA vises (dvs. t = 2 min), sandsynligheden for co-lokalisering stiger (lilla pil i figur 5A,B). Dette tidspunkt, når co-lokalisering bliver hyppige, afhænger af hastigheden af transskription forlængelse. 2D-tæthedsplottet på 5' og 3' lacZ mRNA-numre inden for hvert co-lokaliseringssted, der påvises på dette tidspunkt, kan bruges til at udlede tætheden af RNAPs på lacZ-genet (Figur 5C). Som tidligere rapporteret19, de 5 ' mRNA numre i dette plot viser, at de fleste af lacZ loci har mindre end 10 RNAPs på DNA, når lacZ udtryk er induceret af 1 mM IPTG. Derudover er de 3' mRNA-numre i dette plot relateret til klyngedannelse af RNAPs34. Det faktum, at antallet af 3' mRNA er tæt på én betyder, at omkring kun én RNAP kommer ind i 3' sonderegionen. Dette tyder på, at RNAPs på lacZ genet er rumligt adskilt, i stedet for at danne en klynge (eller "konvoj").

Figure 1
Figur 1: Design af smFISH sonder til en mRNA af interesse. (A) En fliselægningsmetode. Sekvenser af korte DNA oligonukleotider (~ 20 bp i længden) er valgt, så de kan dække mRNA af interesse. Oligonukleotidsonden er mærket med et fluorescerende farvestofmolekyle. (B) En matrixmetode. En ikke-kodning vifte af tandem sekvenser (f.eks"lacO array") er transskriptionelt smeltet til mRNA af interesse. Fluorescerende mærket sonde supplerer den gentagne enhed (f.eks lacO-sonden på 17 bp i længden) bruges til at forstærke signalet fra et mRNA. Klik her for at se en større version af dette tal.

Figure 2
Figur 2: Skematisk af smFISH forsøgsproceduren og tid varighed af hvert trin. Klik her for at se en større version af dette tal.

Figure 3
Figur 3: smFISH billedanalyse. (A-C) smFISH mikroskopi billede af 5 ' lacZ mRNA (rød) og 3' lacZ mRNA (grøn) i vilde-type E. coli (MG1655) dyrket i M9 minimal medium suppleret med 0,2% glycerol, 0,1 % casaminosyrer og 1 mg/L thiamin ved 30 °C. (A) Et repræsentativt billede af en prøve fra t = 3 min efter induktion med 0,05 mM IPTG ved t = 0 min og undertrykkelse med 500 mM glukose ved t = 1,5 min. Fase kontrast og to fluorescens billeder af Cy5 (for 5 ' lacZ mRNA, rød) og Cy3 (for 3 ' lacZ mRNA, grøn) blev overlejret med pseudo-farve. Billedet viser et helt felt på 86,7 μm x 66,0 μm. Skalabar, 5 μm. (B) Zoom-in version af et lille område (gul boks) i (A). Cellekonturer vises med hvid, og fluorescenspletter, der er identificeret fra billedanalyse, vises med røde prikker. Skalabar, 1 μm. cC) Påvisning af cellekonturer og lysstofrør under højt udtryk (t = 4 min efter induktion med 1 mM IPTG). Skalabar, 1 μm. (D-E) Fordelinger af 5' og 3' mRNA-spotintensiteter målt før tilsætning af IPTG (den undertrykte tilstand). Histogrammerne vises med to gaussiske funktioner (sort og grå), hvis middelværdier er fra den gaussiske blandingsmodel. Inset viser kvantitet-kvantitet af tilfældige tal genereret fra de gaussiske blandingsmodeller og eksperimentelt målte mRNA-spotintensiteter (n = 1040 for 5' mRNA og 680 for 3' mRNA). (F) Oplysninger opnået for en enkelt celle pegede i panel (B). For en given celle (i) blev pletterne identificeret i Cy5- og Cy3-kanaler, og deres intensitet (I) og koordinere langs en celles korte og lange akse (d, l) blev kvantificeret ud fra 2D Gaussian-tilpasning. Efter normalisering blev punktintensiteterne opsummeret for at give det samlede antal 5' eller 3' mRNA'er i denne celle. Desuden kan sam lokalisering mellem steder fra forskellige kanaler analyseres som i eksemplet i figur 5. Klik her for at se en større version af dette tal.

Figure 4
Figur 4: Analyse af in vivo kinetik af transskription og mRNA nedbrydning. (A) Skematiske og repræsentative billeder af to-farve smFISH eksperimenter måle ændringer i lacZ mRNA niveauer over tid. Røde og grønne stiplede linjer angiver Cy5- eller Cy3B-baserede oligonukleotidsonder, der hybridiserer til de 1-kb lange 5' og 3' mRNA-områder af lacZ mRNA i henholdsvis E. coli. Også vist er overlejringer af to fluorescens billeder med en fase kontrast billede på angivne tidspunkt punkter efter induktion med 0,2 mM IPTG på t = 0 min. Transskription blev undertrykt med 500 mM glukose ved t = 1,5 min. Skalabar, 1 μm. Tallet er blevet ændret fra Kim et al19. (B) 5' og 3' lacZ mRNA-tal pr. celle over tid under det eksperiment, der er beskrevet i panelet (A). Fejllinjer er bootstrapped SEMs. Mindst 1.200 celler blev analyseret pr. tidspunkt. Den første stigning i 5' og 3' mRNA-signaler var i overensstemmelse med en linje (blå). Forskellen i x-aflytninger var 1,93 min, hvilket giver den gennemsnitlige transskriptionsforlængelsessats på 17,3 nt/s. henfaldet af 5' og 3' mRNA-signalerne var i overensstemmelse med en eksponentiel henfaldsfunktion (grå). De indstillede parametre indikerer, at den gennemsnitlige mRNA-levetid er 1,52 min for 5' mRNA og 1,66 min. for 3' mRNA. (C) Procentdel af celler med en eller flere lacZ mRNA-pletter under det i litra A beskrevne eksperiment). Fejllinjer er bootstrapped SEMs. DD) Lokalisering af et sted langs en celles korte akse. Man kan kvantificere et steds nærhed til membranen ved at dividere placeringen langs den korteakse (d) med en halv bredde af cellen (w). (E)Ændring i lokaliseringen af 5' og 3' lacZ mRNA-pletter langs cellernes korte akse under det i litra A beskrevne eksperiment). Klik her for at se en større version af dette tal.

Figure 5
Figur 5: Analyse af sam lokalisering af 5' og 3' mRNA-spots. aA) Skematisk, der viser den forventede sam lokalisering mellem 5' og 3' mRNA-pletter efter induktion. Når der foretages 3' mRNA, øges sandsynligheden for, at et 5' mRNA-sted samdes med et 3' mRNA-spot (lilla pil). (B) Sandsynligheden for sam lokalisering efter induktion med 1 mM IPTG. Den lilla pil angiver det tidspunkt, hvor sandsynligheden for sam lokalisering først bliver hyppig i henhold til skemaet i panelet (A). cC) Antallet af 5' og 3' lacZ mRNAs inden for et co-localization spot, der er påvist ved t = 2 min efter induktion med 1 mM IPTG (i alt 841 pladser). Grå prikker repræsenterer individuelle co-lokaliserede pletter, mens røde prikker repræsenterer gennemsnittet af binned data. Fejllinjer er SEM. Grå nuance angiver tætheden af punkter i et givet område af grafen. Den stiplede linje angiver en hældning på 1. Klik her for at se en større version af dette tal.

Figure 6
Figur 6: Optimering af sondens hybridiseringstilstand. Der blev anvendt to typer prøver: MG1655-celler, der er dyrket som beskrevet i figur 3, og forbliver uinducerede (blå) eller behandlet med 0,5 mM IPTG i 20 min (rød). Sonde hybridisering løsning blev foretaget med forskellige koncentrationer af sonder (i alt 72 Cy5-konjugerede sonder fliser hele lacZ regionen) og af formamid. Formamidkoncentrationerne blev også justeret i præ hybridiseringsopløsningen og vaskeopløsningen i overensstemmelse hermed. "Ingen sonde" (grå linje) angiver fluorescensniveauet for de IPTG-tilsat celler, der behandles uden sonder under hybridiseringstrinnet. Gennemsnitlig fluorescensintensitet normaliseret efter celleområde (AU) blev beregnet ud fra 300-800 celler. Fejllinjer er bootstrapped SEMs. Klik her for at se en større version af dette tal.

Supplerende figur 1: Forvrænget celle morfologier på grund af over permeabilization. Overlejring af fasekontrast (gråskala), 5' lacZ mRNA (Cy5, rød) og 3' lacZ mRNA (Cy3, grøn) billeder af MG1655 celler 5 min efter induktionen med 1 mM IPTG. (A) Et eksempel, der viser blanding af normale celler og alt for permeabiliserede celler mangler normal morfologi (angivet med lyserøde pile). (B) Et eksempel, der viser "ghosty" celler klumpet sammen. Skalalinje = 1 μm. Klik her for at downloade denne fil.

DEPC Vand
Tilsæt 0,1% DEPC til ultrarent vand og inkuber flasken (dækket) i 37 °C ovnen natten over og autoklave næste dag.
DEPC PBS (10X)
Bland følgende:
80 g NaCl (endelig 1,37 M)
2 g KCl (endelig 27 mM)
14,2 g Na2HPO4 (endelig 100 mM)
2,7 g KH2PO4 (endelig 20 mM)
Ultrarent vand til 1L
Filter (0,22 μm) i en glasflaske.
Tilsæt 0,1% DEPC og følg vejledningen for DEPC vand.
For at lave 1X opløsning, fortyndes 10 gange med DEPC vand.
1M DEPC natriumphosphat buffer, pH 7,4
Bland følgende:
115 g Na2HPO4
22,8 g NaH2PO4
Ultrarent vand til 1 L
Filter (0,22 μm) i en glasflaske.
Tilsæt 0,1% DEPC og følg vejledningen for DEPC vand.
4X fastgørelsesopløsning (16% formaldehyd)
5 mL 20% formaldehyd
500 μL DEPC vand
750 μL 1M DEPC natriumphosphat buffer, pH 7,4
Opbevares ved 4 °C i op til 2-4 uger.
FORSIGTIG: Formaldehyd er giftigt. Brug handsker og brug en røghætte, når du laver denne løsning.
Vaskeløsning
Bland følgende:
10 mL Formamid (endelig 25%)
4 mL 20X SSC (endelig 2X)
Fyld DEPC vand til 40 ml
Filter (0,22 μm) og opbevares ved 4 °C
FORSIGTIG: Formamid er giftigt. Brug handsker og brug en røghætte, når du laver denne løsning.
Løsning med præ hybridisering
200 μL Formamid (endelig 20%)
100 μL 20X SSC (endelig 2X)
10 μL 100X VRC (sidste 1X)
25 μL 4% (w/v) BSA (endelig 0,1%)
685 μL DEPC vand
BEMÆRK: Vortex VRC-aktien, før du tager 10 μL ud.
FORSIGTIG: Formamid er giftigt og et kendt teratogen. Bær handsker og håndtere det under en røghætte.
Sonde hybridiseringsløsning
200 μL Formamid (endelig 20%)
100 μL 20X SSC (endelig 2X)
10 μL 100X VRC (sidste 1X)
25 μL 4% (w/v) BSA (endelig 0,1%)
10 μL 40 mg/ml E. coli tRNA (endelig 0,4 mg/ml)
200 μL 50% dextransulfat (endelig 10%)
x μL 5' mRNA-sondesæt (fra trin 1.12) til endelig 4 nM.
y μL 3' mRNA-sondesæt (fra trin 1.12) til endelig 4 nM.
- DEPC vand for at gøre det samlede volumen 1 ml
BEMÆRK: Tilsæt dextransulfat sidst. Fordi det er meget tyktflydende, skæres enden af en pipette spids, før du tager 200 μL ud fra 50% lager. Efter tilsætning af dextransulfat, pipette op og ned for at homogenisere opløsningen.

Tabel 1: Opskrifter på de anvendte løsninger.

Discussion

Her præsenterede vi en smFISH protokol til måling af mRNA kinetik i E. coli. I de tidligere offentliggjorte smFISH protokoller for bakterier23, celler blev holdt i rørene indtil slutningen af protokollen, det vil sige indtil de er klar til billeddannelse. Selv om det har mange fordele, såsom minimal uspecifikke binding af fluorescerende sonder på coverslip overflade23,er det vanskeligt at følge disse protokoller, når der er mange prøver fra en tid-kursus eksperiment. For det første skal der udtages prøver af en forholdsvis stor mængde celler (>1 ml) og endda høstes før fiksering. For det andet skal celleprøverne centrifugeres flere gange for at udveksle opløsninger og vaske efter hybridiseringstrinnet. I vores protokol blandes en lille mængde (<1 ml) af kultur direkte med en fastgørelsesløsning i et 1,5 ml rør, hvilket hjælper med hurtigt at "fryse" celletilstanden på prøvetagningstidspunktet. Cellerne forbliver også fastgjort til overfladen under hele proceduren, og forskellige løsninger kan hurtigt udskiftes ved at indsugning af væsker med et vakuumfiltreringssystem og anvende opløsningsfald på én gang med en multikanalpipette. Denne forskel gør vores protokol meget fordelagtig, når et stort antal prøver skal behandles på én gang. Ved hjælp af vores protokol, 12-48 prøver kan håndteres samtidigt, og hele FISH procedure kan afsluttes inden for ~ 8 timer, omkring en lignende mængde tid, der er nødvendig for et par prøver (Figur 2). Selv om vi brugte udtrykket lacZ i E. coli som et eksempel, protokollen er bredt anvendelig på forskellige gener og bakteriearter med overvejelser diskuteret nedenfor.

For forskellige gener, den første ting at overveje, er smFISH sonder. Man kan designe oligonucleotid sonder, flise mRNA af interesse (Figur 1A)13. I denne "flisebelægning" sonde tilgang, hver sonde er ~ 20 base lang og mærket med en fluorophore på 5 'eller 3' terminus. Denne strategi er praktisk, da ingen genetisk manipulation er nødvendig. Alternativt kan en tandem gentagelse af ~ 20 bp sekvens, fremmed for den genomiske sekvens (f.eks en vifte af lacO sekvens i Caulobacter crescentus14), indsættes i den uoversatte region af et gen af interesse og en enkelt sonde supplerer den gentagne enhed bruges til at mærke mRNA ("array" tilgang; Figur 1B). I begge tilfælde dekorerer flere fluorophores et mRNA, hvilket giver forstærket fluorescenssignal, der let kan skelnes fra en enkelt sonde, der er uspecifikke bundet inde i en celle.

Om der skal vælges "fliselægning" eller "array"-tilgange, afhænger af den negative kontrol, en prøve, hvor uspecifikke bindinger af sonder testes, fordi den mangler målet mRNA. For flisebelægningssonder (figur 1A) kan en mutant stamme uden genet af interesse eller en tilstand, hvor genet ikke transskriberes (f.eks. undertrykkelse af lacZ) tjene som en negativ kontrol til test af uspecifik binding af sonder. For array-baserede smFISH(Figur 1B), en wild-type stamme mangler array kan tjene som en negativ kontrol, fordi det ikke indeholder bindende steder for sonder.

Optimale hybridiseringsforhold kan afhænge af sondesekvenserne og endda valget af fluorophorefarvestoffer. Vi optimerede hybridiseringsbetingelsen for lacZ-sondesæt ved at holde hybridiseringstemperaturen på 37 °C og teste forskellige koncentrationer af sondesæt og formamid i hybridiseringsløsningen. Højere koncentrationer af formamid har tendens til at reducere både uspecifikke og specifikkebindinger 26,35. Vi anbefaler systematisk at ændre hybridiseringen og dens vaskeforhold, samtidig med at hybridiseringstid og temperatur bevares på samme måde. Efterhånden som betingelsen bliver strengere, falder både det uspecifikke og det specifikke bindende fald (figur 6). Det er vigtigt at finde et punkt, hvor den uspecifikke binding begynder at ramme under en acceptabel tærskel uden yderligere at gå på kompromis med den specifikke binding. For eksempel brugte vi det signalniveau, der blev opnået uden sonder ("ingen sonder") som en tærskel (figur 6).

Den tofarvede smFISH-metode, der mærker to separate regioner i et mRNA, er begrænset til lange gener. For at måle transskriptionshastigheden, benyttede vi os af det faktum, at lacZ er lang (3075 bp) og dens udtryk kan induceres af IPTG. Når et gen er kort, er det vanskeligt at designe to fliselæggende sondesæt (nær 5' og 3' ender) og løse tidsforsinkelsen mellem optrædener af 5' vs. 3' mRNA-områder. I dette tilfælde kan man tælle spirende mRNAs på steady state ved smFISH og analysere deres fordeling med en analytisk model, der har hastigheden af transskription forlængelse som en passende parameter20. Når et af interesse genet ikke er inducerende, kan man også behandle celler med rifampicin ved tid nul og måle den tidsmæssige ændring i 5' og 3' mRNA-underområder. Forsinkelsen fra faldet på 5' mRNA-signal til 3' mRNA-signalet kan derefter bruges til at beregne transskriptionshastigheden som tidligere31.

Endelig er smFISH-protokollen alsidig og kan kombineres med andre mærkningsordninger. Tidligere blev DNA locus visualiseret sammen med mRNA'er ved at kombinere mRNA FISH med enten DNA FISH14 eller fluorescerende reporter-operatør system20. Proteinprodukter kan visualiseres ved at udføre immunfluorescens sammen med mRNA FISH14,36. Det kan også kombineres med tre-dimensionelle super-opløsning mikroskopi37 til at visualisere mRNA'er i alle tredimensioner 38,39.

Disclosures

Forfatterne erklærer, at de ikke har nogen konkurrerende finansielle interesser.

Acknowledgments

Denne protokol blev udviklet af S.K. under hendes postdoc forskning i Dr. Christine Jacobs-Wagners laboratorium på Howard Hughes Medical Institute og Microbial Sciences Institute på Yale University. Vi takker Dr. Jacobs-Wagner og hendes lab medlemmer for forskellige input i løbet af metoden udvikling og Laura Troyer for kritisk læsning af manuskriptet. S.K. anerkender støtte fra Searle Scholars-programmet; K.V. anerkender støtte fra James Scholar Preble Research Award fra University of Illinois.

Materials

Name Company Catalog Number Comments
Bacterial strain
Escherichia coli MG1655
Chemicals, peptides, and others
Acetonitrile Sigma-Aldrich 34851 UPLC buffer B
Ammonium chloride Fisher Chemical A661-500 To make M9 medium
Bovine serum albumin (BSA) Sigma-Aldrich B2518 Probe hybridization
Calcium chloride Acros Organics 349610250 To make M9 medium
Casamino acid BD Difco 223050 To make M9 medium
Cy3B NHS ester GE Healthcare Life Sciences PA63101 Fluorophore for FISH probes
Cy5 NHS ester GE Healthcare Life Sciences PA15101 Fluorophore for FISH probes
DEPC Sigma-Aldrich D5758
Dextran sulfate Millipore S4030 Probe hybridization
Dextrose Fisher Chemical D16 To repress the expression of lacZ
Dimethyl sulfoxide (DMSO) Sigma-Aldrich D8418 To dissolve fluorophores
E. coli tRNA Sigma-Aldrich R1753 Probe hybridization
Ethanol Decon Laboratories 2701 Used in DNA purification, lysis, and cleaning coverslips
FISH probes Biosearch Technologies Sequences are published in ref#16
Formaldehyde Ladd Research Industries 20295 Fixation
Formamide American Bio AB00600 Probe hybridization, pre-hybridization, and wash
Glycerol Americanbio AB00751-01000 To make M9 medium
Isopropylthio-β-galactoside (IPTG) Invitrogen 15529019 lacZ induction
Magnesium sulfate Fisher Chemical M65-500 To make M9 medium
2-Nitrophenyl β-D-fucopyranoside (ONPF) Santa Cruz Biotechnology sc-216258 lacZ repression
Picodent twinsil 22 Picodent 1300 1000 Sealant
Poly-L-lysine Sigma-Aldrich P8920 To treat the coverslip surface
Potassium chloride Fisher BioReagents BP366-500 To make PBS
Potassium phosphate monobasic Fisher BioReagents BP362-500 To make PBS and M9 medium
Rifampicin Sigma-Aldrich R3501 To stop transcription initiation
Saline-sodium citrate buffer (SSC) Invitrogen AM9763 Probe hybridization, pre-hybridization, and wash
sodium bicarbonate Fisher BioReagents BP328-500 Fluorophore-probe conjugation
Sodium chloride Fisher BioReagents BP358-1 For DNA purification, PBS and M9 medium
Sodium phosphate dibasic Fisher BioReagents BP332-500 To make PBS and M9 medium
Sodium phosphate monobasic Fisher BioReagents BP329-500 To make a sodium phosphate buffer
Super PAP Pen Invitrogen 8899 Hydrophobic marker for coverslips
TetraSpek microspheres Invitrogen T7280 Controls for multi-channel registration
Thiamine Sigma-Aldrich T1270 To make M9 medium
Triethylammonium acetate Sigma-Aldrich 90358 UPLC buffer A
Vanadyl ribonucleoside complex (VRC) Sigma-Aldrich 94742 Probe hybridization and pre-hybridization
Equipment
C18 column Waters Acquity BEH C18 column
Countertop centrifuge Eppendorf 5425
Countertop incubator Eppendorf Thermomixer F1.5
Incubator (Oven) Thermo Scientific 51030514 Gravity convection
Water purification system Millipore Milli-Q Reference
Nanodrop Thermo Scientific 2000C
Nitrogen gas Building For blow-drying coverslips and glass slides
UPLC Waters Acquity UPLC system
Vacuum and aspirator Building Aspirator is made of a filtration flask with a side arm.
Vacuum concentrator Labconco 7810010 Centrivap; to dry samples collected from UPLC.
Vortexer Scientific Industries Genie-2 SI-0236
Water bath shaker New Brunswick Innova 3100 Critical for time-course experiments
Water bath sonicator VWR 97043-960 To clean coverslips and glass slides
Tools
1.5-mL tubes Eppendorf 22431021 DNA lobind tubes
1000-uL pipette tip box Denville Scientific P1126 An empty box after using all the tips
Coplin jar SPI 01240-AB To clean coverslips and glass slides
Coverslip Fisher Scientific 22-050-230 24x60 No1
Filtered pipette tips Denville Scientific P1121,P1122,P1126 SHARP® Precision Barrier Tips
Forceps SPI K35a To handle clean coverslips and glass slides
Glass slide Fisher Scientific 12-544-1
Gloves Microflex MK-296-M
Multichannel pipetter Eppendorf 2231300045 To use in the washing step (#7)
Pipette Gilson P1000, P200, P20
Reagent reservoir MTC Bio P8025-1S To use in the washing step (#7)
Syringe filter (0.22 um) Millipore SLGS033SS
Timer VWR 62344-641
Software and algorithms
MATLAB Mathworks R2013 and up https://www.mathworks.com
MicrobeTracker or Oufti https://www.github.com/JacobsWagnerLab/MicrobeTracker
https://oufti.org/
Stellaris Probe Designer Biosearch Technologies https://www.biosearchtech.com/support/tools/design-software/stellaris-probe-designer
Microscope
CCD camera Hamamatsu Photonics Orca-II-ER
Cy3 filter set Chroma 49004
Cy5 filter set Chroma 49006
Epi-fluorescence microscope Nikon Eclipse Ti For phase-contrast and epi fluorescence
Fluorescence excitation source Lumencor SOLA-E
Nikon Elements software Nikon software that controls the microscope setup
Phase-contrast 100x objective Nikon Plan Apochromat (NA 1.45)
Probe sequence
DNA oligos with C6 amino modification at the 5' end Biosearch Technologies Inc
lacZ1 GTGAATCCGTAATCATGGTC 5' mRNA
lacZ2 TCACGACGTTGTAAAACGAC 5' mRNA
lacZ3 ATTAAGTTGGGTAACGCCAG 5' mRNA
lacZ4 TATTACGCCAGCTGGCGAAA 5' mRNA
lacZ5 ATTCAGGCTGCGCAACTGTT 5' mRNA
lacZ6 AAACCAGGCAAAGCGCCATT 5' mRNA
lacZ7 AGTATCGGCCTCAGGAAGAT 5' mRNA
lacZ8 AACCGTGCATCTGCCAGTTT 5' mRNA
lacZ9 TAGGTCACGTTGGTGTAGAT 5' mRNA
lacZ10 AATGTGAGCGAGTAACAACC 5' mRNA
lacZ11 GTAGCCAGCTTTCATCAACA 5' mRNA
lacZ12 AATAATTCGCGTCTGGCCTT 5' mRNA
lacZ13 AGATGAAACGCCGAGTTAAC 5' mRNA
lacZ14 AATTCAGACGGCAAACGACT 5' mRNA
lacZ15 TTTCTCCGGCGCGTAAAAAT 5' mRNA
lacZ16 ATCTTCCAGATAACTGCCGT 5' mRNA
lacZ17 AACGAGACGTCACGGAAAAT 5' mRNA
lacZ18 GCTGATTTGTGTAGTCGGTT 5' mRNA
lacZ19 TTAAAGCGAGTGGCAACATG 5' mRNA
lacZ20 AACTGTTACCCGTAGGTAGT 5' mRNA
lacZ21 ATAATTTCACCGCCGAAAGG 5' mRNA
lacZ22 TTTCGACGTTCAGACGTAGT 5' mRNA
lacZ23 ATAGAGATTCGGGATTTCGG 5' mRNA
lacZ24 TTCTGCTTCAATCAGCGTGC 5' mRNA
lacZ25 ACCATTTTCAATCCGCACCT
lacZ26 TTAACGCCTCGAATCAGCAA
lacZ27 ATGCAGAGGATGATGCTCGT
lacZ28 TCTGCTCATCCATGACCTGA
lacZ29 TTCATCAGCAGGATATCCTG
lacZ30 CACGGCGTTAAAGTTGTTCT
lacZ31 TGGTTCGGATAATGCGAACA
lacZ32 TTCATCCACCACATACAGGC
lacZ33 TGCCGTGGGTTTCAATATTG
lacZ34 ATCGGTCAGACGATTCATTG
lacZ35 TGATCACACTCGGGTGATTA
lacZ36 ATACAGCGCGTCGTGATTAG
lacZ37 GATCGACAGATTTGATCCAG
lacZ38 AAATAATATCGGTGGCCGTG
lacZ39 TTTGATGGACCATTTCGGCA
lacZ40 TATTCGCAAAGGATCAGCGG
lacZ41 AAGACTGTTACCCATCGCGT
lacZ42 TGCCAGTATTTAGCGAAACC
lacZ43 AAACGGGGATACTGACGAAA
lacZ44 TAATCAGCGACTGATCCACC
lacZ45 GGGTTGCCGTTTTCATCATA
lacZ46 TCGGCGTATCGCCAAAATCA
lacZ47 TTCATACAGAACTGGCGATC
lacZ48 TGGTGTTTTGCTTCCGTCAG
lacZ49 ACGGAACTGGAAAAACTGCT 3' mRNA
lacZ50 TATTCGCTGGTCACTTCGAT 3' mRNA
lacZ51 GTTATCGCTATGACGGAACA 3' mRNA
lacZ52 TTTACCTTGTGGAGCGACAT 3' mRNA
lacZ53 GTTCAGGCAGTTCAATCAAC 3' mRNA
lacZ54 TTGCACTACGCGTACTGTGA 3' mRNA
lacZ55 AGCGTCACACTGAGGTTTTC 3' mRNA
lacZ56 ATTTCGCTGGTGGTCAGATG 3' mRNA
lacZ57 ACCCAGCTCGATGCAAAAAT 3' mRNA
lacZ58 CGGTTAAATTGCCAACGCTT 3' mRNA
lacZ59 CTGTGAAAGAAAGCCTGACT 3' mRNA
lacZ60 GGCGTCAGCAGTTGTTTTTT 3' mRNA
lacZ61 TACGCCAATGTCGTTATCCA 3' mRNA
lacZ62 TAAGGTTTTCCCCTGATGCT 3' mRNA
lacZ63 ATCAATCCGGTAGGTTTTCC 3' mRNA
lacZ64 GTAATCGCCATTTGACCACT 3' mRNA
lacZ65 AGTTTTCTTGCGGCCCTAAT 3' mRNA
lacZ66 ATGTCTGACAATGGCAGATC 3' mRNA
lacZ67 ATAATTCAATTCGCGCGTCC 3' mRNA
lacZ68 TGATGTTGAACTGGAAGTCG 3' mRNA
lacZ69 TCAGTTGCTGTTGACTGTAG 3' mRNA
lacZ70 ATTCAGCCATGTGCCTTCTT 3' mRNA
lacZ71 AATCCCCATATGGAAACCGT 3' mRNA
lacZ72 AGACCAACTGGTAATGGTAG 3' mRNA

DOWNLOAD MATERIALS LIST

References

  1. Bervoets, I., Charlier, D. Diversity, versatility and complexity of bacterial gene regulation mechanisms: opportunities and drawbacks for applications in synthetic biology. FEMS Microbiology Reviews. 43, (3), 304-339 (2019).
  2. Epshtein, V., Nudler, E. Cooperation between RNA polymerase molecules in transcription elongation. Science. 300, (5620), 801-805 (2003).
  3. Vogel, U., Jensen, K. F. The RNA chain elongation rate in Escherichia coli depends on the growth rate. Journal of Bacteriology. 176, (10), 2807-2813 (1994).
  4. Tennyson, C. N., Klamut, H. J., Worton, R. G. The human dystrophin gene requires 16 hours to be transcribed and is cotranscriptionally spliced. Nature Genetics. 9, 184 (1995).
  5. Singh, J., Padgett, R. A. Rates of in situ transcription and splicing in large human genes. Nature Structural & Molecular Biology. 16, 1128 (2009).
  6. Selinger, D. W., Saxena, R. M., Cheung, K. J., Church, G. M., Rosenow, C. Global RNA Half-Life Analysis in Escherichia coli Reveals Positional Patterns of Transcript Degradation. Genome Research. 13, (2), 216-223 (2003).
  7. Bernstein, J. A., Khodursky, A. B., Lin, P. -H., Lin-Chao, S., Cohen, S. N. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proceedings of the National Academy of Sciences. 99, (15), 9697-9702 (2002).
  8. Pérez-Ortín, J. E., Medina, D. A., Chávez, S., Moreno, J. What do you mean by transcription rate. BioEssays. 35, (12), 1056-1062 (2013).
  9. Tang, F., et al. mRNA-Seq whole-transcriptome analysis of a single cell. Nature Methods. 6, (5), 377-382 (2009).
  10. Kuchina, A., et al. Microbial single-cell RNA sequencing by split-pool barcoding. BioRxiv. 869248 (2019).
  11. Blattman, S. B., Jiang, W., Oikonomou, P., Tavazoie, S. Prokaryotic single-cell RNA sequencing by in situ combinatorial indexing. Nature Microbiology. (2020).
  12. Femino, A., Fay, F., Fogarty, K., Singer, R. Visualization of single RNA transcripts in situ. Science. 280, (5363), 585-590 (1998).
  13. Raj, A., vanden Bogaard, P., Rifkin, S. A., van Oudenaarden, A., Tyagi, S. Imaging individual mRNA molecules using multiple singly labeled probes. Nature Methods. 5, (10), 877-879 (2008).
  14. Montero Llopis, P., et al. Spatial organization of the flow of genetic information in bacteria. Nature. 466, (7302), 77-81 (2010).
  15. So, L. -h, et al. General properties of transcriptional time series in Escherichia coli. Nature Genetics. 43, (6), 554-560 (2011).
  16. Taniguchi, Y., et al. Quantifying E. coli proteome and transcriptome with single-molecule sensitivity in single cells. Science. 329, (5991), 533-538 (2010).
  17. Jones, D. L., Brewster, R. C., Phillips, R. Promoter architecture dictates cell-to-cell variability in gene expression. Science. 346, (6216), 1533-1536 (2014).
  18. Iyer, S., Park, B. R., Kim, M. Absolute quantitative measurement of transcriptional kinetic parameters in vivo. Nucleic Acids Research. 44, (18), 142 (2016).
  19. Kim, S., Beltran, B., Irnov, I., Jacobs-Wagner, C. Long-Distance Cooperative and Antagonistic RNA Polymerase Dynamics via DNA Supercoiling. Cell. 179, (1), 106-119 (2019).
  20. Wang, M., Zhang, J., Xu, H., Golding, I. Measuring transcription at a single gene copy reveals hidden drivers of bacterial individuality. Nature Microbiology. 4, (12), 2118-2127 (2019).
  21. Joo, C., Ha, T. Labeling DNA (or RNA) for single-molecule FRET. 2012, (9), Cold Spring Harbor. 1005-1008 (2012).
  22. Sambrook, J., Russell, D. W. Standard Ethanol Precipitation of DNA in Microcentrifuge Tubes. 2006, (1), Cold Spring Harbor Protocols. 4456 (2006).
  23. Skinner, S. O., Sepúlveda, L. A., Xu, H., Golding, I. Measuring mRNA copy number in individual Escherichia coli cells using single-molecule fluorescent in situ hybridization. Nature Protocols. 8, (6), 1100-1113 (2013).
  24. Adesnik, M., Levinthal, C. The synthesis and degradation of lactose operon messenger RNA in E. coli. Cold Spring Harbor Symposia on Quantitative Biology. 35, 451-459 (1970).
  25. Campbell, E. A., et al. Structural mechanism for rifampicin inhibition of bacterial RNA polymerase. Cell. 104, (6), 901-912 (2001).
  26. Raj, A., Tyagi, S. Methods in Enzymology. Walter, N. G. 472, Academic Press. 365-386 (2010).
  27. Sliusarenko, O., Heinritz, J., Emonet, T., Jacobs-Wagner, C. High-throughput, subpixel precision analysis of bacterial morphogenesis and intracellular spatio-temporal dynamics. Molecular Microbiology. 80, (3), 612-627 (2011).
  28. Paintdakhi, A., et al. Oufti: an integrated software package for high-accuracy, high-throughput quantitative microscopy analysis. Molecular Microbiology. 99, (4), 767-777 (2016).
  29. Moffitt, J. R., Zhuang, X. Methods in Enzymology. Filonov, G. S., Jaffrey, S. R. 572, Academic Press. 1-49 (2016).
  30. Yu, J., Xiao, J., Ren, X., Lao, K., Xie, X. S. Probing gene expression in live cells, one protein molecule at a time. Science. 311, (5767), 1600-1603 (2006).
  31. Chen, H., Shiroguchi, K., Ge, H., Xie, X. S. Genome-wide study of mRNA degradation and transcript elongation in Escherichia coli. Molecular Systems Biology. 11, (1), 781 (2015).
  32. Vogel, U., Sørensen, M., Pedersen, S., Jensen, K. F., Kilstrup, M. Decreasing transcription elongation rate in Escherichia Coli exposed to amino acid starvation. Molecular Microbiology. 6, (15), 2191-2200 (1992).
  33. Yang, S., et al. Transcription and translation contribute to gene locus relocation to the nucleoid periphery in E. coli. Nature Communications. 10, (1), 5131 (2019).
  34. Zenklusen, D., Larson, D. R., Singer, R. H. Single-RNA counting reveals alternative modes of gene expression in yeast. Nature Structural & Molecular Biology. 15, (12), 1263-1271 (2008).
  35. Fontenete, S., Guimarães, N., Wengel, J., Azevedo, N. F. Prediction of melting temperatures in fluorescence in situ hybridization (FISH) procedures using thermodynamic models. Critical Reviews in Biotechnology. 36, (3), 566-577 (2016).
  36. Sepúlveda, L. A., Xu, H., Zhang, J., Wang, M., Golding, I. Measurement of gene regulation in individual cells reveals rapid switching between promoter states. Science. 351, (6278), 1218-1222 (2016).
  37. Huang, B., Wang, W., Bates, M., Zhuang, X. Three-Dimensional Super-Resolution Imaging by Stochastic Optical Reconstruction Microscopy. Science. 319, (5864), 810-813 (2008).
  38. Moffitt, J. R., Pandey, S., Boettiger, A. N., Wang, S., Zhuang, X. Spatial organization shapes the turnover of a bacterial transcriptome. eLife. 5, 13065 (2016).
  39. Fei, J., et al. Determination of in vivo target search kinetics of regulatory noncoding RNA. Science. 347, (6228), 1371-1374 (2015).
Sondering mRNA kinetik i rum og tid i <em>Escherichia coli ved hjælp</em> af to-color single-molecule fluorescens In Situ Hybridization
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kim, S., Vaidya, K. Probing mRNA Kinetics in Space and Time in Escherichia coli using Two-Color Single-Molecule Fluorescence In Situ Hybridization. J. Vis. Exp. (161), e61520, doi:10.3791/61520 (2020).More

Kim, S., Vaidya, K. Probing mRNA Kinetics in Space and Time in Escherichia coli using Two-Color Single-Molecule Fluorescence In Situ Hybridization. J. Vis. Exp. (161), e61520, doi:10.3791/61520 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter