Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

Isolierung und Kultivierung von MandibularKnochenmark Mesenchymal Stammzellen bei Ratten

doi: 10.3791/61532 Published: August 25, 2020
* These authors contributed equally

Summary

Dieser Artikel stellt eine Methode vor, die die vollständige Knochenmarkhaftung und die Durchflusszytometrie-Sortierung für die Isolierung, Kultivierung, Sortierung und Identifizierung von mesenchymalen Knochenmarkstammzellen aus Rattenunterkiefern kombiniert.

Abstract

Hier präsentieren wir eine effiziente Methode zur Isolierung und Kultivierung von mandibulären Knochenmarkmesenchymalstammzellen (mBMSCs) in vitro, um schnell zahlreiche hochwertige Zellen für experimentelle Anforderungen zu erhalten. mBMSCs könnten in Zukunft aufgrund der hervorragenden Selbsterneuerungsfähigkeit und des Differenzierungspotenzials mit mehreren Linien in therapeutischen Anwendungen als gewebetechnische Zellen bei craniofacial-Erkrankungen und der cranio-maxillofacial Regeneration weit verbreitet sein. Daher ist es wichtig, mBMSCs in großer Zahl zu erhalten.

In dieser Studie wurde das Knochenmark aus dem Unterkiefer gespült und primäre mBMSCs wurden durch den Anbau an ganze Knochenmark-Anhänger isoliert. Darüber hinaus wurden CD29+CD90+CD45mBMSCs durch fluoreszierende Zellsortierung gereinigt. Die zweite Generation von gereinigten mBMSCs wurde für weitere Studien verwendet und zeigte Potenzial in der Unterscheidung in Osteoblasten, Adipozyten und Chondrozyten. Mit diesem In-vitro-Modell kann man eine hohe Anzahl von proliferativen mBMSCs erhalten, was die Untersuchung der biologischen Eigenschaften, der nachfolgenden Reaktion auf die Mikroumgebung und anderer Anwendungen von mBMSCs erleichtern kann.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Knochenmark mesenchymale Stammzellen (BMSCs) sind nicht-hämatopoetische Stammzellen aus Knochenmark abgeleitet, die starke Proliferationsfähigkeit und Multi-Lineage Differenzierungspotenzialmanifestieren 1,2,3,4. Tatsächlich gelten BMSCs seit ihrer Entdeckung als idealer Kandidat für Knochengewebetechnik und -regeneration. Seit Jahren sind der Iliaskamm oder lange Knochen wie Tibia und Oberschenkelknochen die häufigste Quelle von BMSCs für die craniofacial Regeneration. Orofaziale BMSCs, wie z. B. Unterkiefer-BMSCs (mBMSCs), weisen jedoch einige Unterschiede zu langknochenförmigen BMSCs auf, z. B. unterschiedlicheembryonale Herkunft und Entwicklungsmuster. Unterkiefer entstehen aus neuralen Kammzellen der Neuroektoderm-Keimschicht und durchlaufen eine intramembranöse Verknöcherung, während axiale und anhängliche Skelette aus dem Mesoderm stammen und endochondraler Verknöcherung unterzogen werden. Darüber hinaus haben klinische Beobachtungen und experimentelle Tierstudien immer wieder gezeigt, dass es funktionelle Unterschiede zwischen orofazialen und iliac enkchenen BMSCs5,6,7,8gibt. Berichte haben gezeigt, dass BMSCs, die aus craniofacial Knochen wie Unterkiefer, Kieferknochen und Alveolarknochen abgeleitet wurden, eine überlegene Proliferations-, Lebensdauer- und Differenzierungsfähigkeit aufwiesen als solche von axialen und anhänglichen Knochen9. mBMSCs gelten daher als bevorzugte Ressourcen für zukünftige therapeutische Anwendungen von craniofacial Erkrankungen wie Kerubism, Kiefertumor, Osteoporose des Kieferknochens und Parodontalgewebedefekt10,11,12. Um das Behandlungspotenzial in präklinischen Experimenten zu verstehen, ist es wichtig, eine Methode zur schnellen Isolierung und Kultivierung von mBMSCs in vitro zu etablieren.

In dieser Studie bestand das Ziel darin, gereinigte mBMSCs durch vollständige Knochenmarkhaftung und Durchflusszytometriesortierung zu erhalten. Die anatomische Morphologie der Rattenunterkiefer, die durch Mikro-Computertomographie (Micro-CT) und histologische Abschnitte deutlich beobachtet wurde, zeigte, dass der trabekuläre Knochen des Unterkiefers zwischen dem Schneidemittel- und dem Alveolarknochen lag. Das Knochenmark aus trabekulären Knochen wurde gespült, um Unterkiefermarkzellen zu erhalten, aber die auf diese Weise kultivierten Zellen waren keine reinen mBMSCs und waren wahrscheinlich aus mehreren Arten von Zellen mit unsicheren Potenzen und verschiedenen Linien wie Zellen aus Knochen, Fett und Endothelzellen13,14bestehen. Der nächste Schritt der Zellreinigung war besonders wichtig. Durchflusszytometrie filtert Zellen durch Erkennung einer Kombination von Zell-Oberflächen-Proteinen und wurde weithin in der Anreicherung von mesenchymalen Stammzellen angenommen. Die Zellhomogenität ist der Hauptvorteil der Durchflusszytometrie, aber der Prozess bestimmt nicht die Zelllebensfähigkeit und kann zu einer begrenzten Zellausbeute führen. In dieser Studie wurden die P0-MBMSCs, die aus der gesamten Knochenmarkhaftung gewonnen wurden, nach Durchflusszytometrie sortiert, um mBMSCs mit hoher Reinheit und starker Proliferationsfähigkeit zu erhalten.

Diese Studie führt ein reproduzierbares und zuverlässiges Protokoll für Isolierung, Kultur und Differenzierung von munterdibulären BMSCs von Ratten ein, das eine Kombination aus ganzer Knochenmarkhaftung und Durchflusszytometriesortierte verwendet. Es ist eine zuverlässige und bequeme Methode für Forscher in verwandten Bereichen zu verwenden.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alle tierischen Versuchsverfahren in diesem Papier wurden vom Animal Care Committee des Shanghai Ninth People es Hospital, Shanghai Jiao Tong University School of Medicine, genehmigt.

1. Vorbereitung

  1. Verwenden Sie zwei 5 Wochen alte männliche Sprague Dawley Ratten für das Experiment.
  2. Sterilisieren Sie alle Instrumente, einschließlich Nadelhalter, Pinzette und Schere bei hoher Temperatur oder eingetaucht in 75% Ethanol für 10 min.
    HINWEIS: Ethanol-Eintauchen sollte nicht zu lang sein, um Zellschäden zu vermeiden.
  3. Vorbereiten von Kulturmedien im Voraus, deren Zusammensetzung in Tabelle 1aufgeführt ist. Ergänzen Sie jedes Medium wie unten beschrieben.
    1. Zubereitung von α-MEM-Kulturmedium (mit 10% FBS): Ergänzung des minimalen essentiellen Mediums Alpha (α-MEM) mit 10% fetalem Rinderserum und 1% Penicillin und Streptomycin.
    2. Zubereitung des osteogenen Differenzierungsmediums: Ergänzung osteogene Differenzierung Basalmedium mit 10% fetalem Rinderserum, 1% Glutamin, 1% Penicillin-Streptomycin, 0,20% Ascorbinsäure, 1% β-Glycerophosphat und 0,01% Dexamethason.
    3. Zubereitung eines osteogenen Induktionsmediums: Mischen Sie 70% α-MEM-Kulturmedium (mit 10% FBS) und 30% osteogene Differenzierungsmedium.
    4. Zubereitung des adipogenen Differenzierungsmediums A: Ergänzung adipogenic Differenzierung Basalmedium mit 10% fetalem Rinderserum, 1% Glutamin, 1% Penicillin-Streptomycin, 0,20% Insulin, 0,10% IBMX, 0,10% Rosiglitazon und 0,01% Dexamethason.
    5. Herstellung des adipogenen Differenzierungsmediums B: Ergänzung adipogenic Differenzierung Basalmedium mit 10% fetalem Rinderserum, 1% Glutamin, 1% Penicillin-Streptomycin und 0,20% Insulin.
    6. Zubereitung des chondrogenen Differenzierungsmediums: Ergänzung chondrogener Differenzierung Basalmedium mit 0,01% Dexamethason, 0,30% Ascorbinsäure, 1% ITS, 0,10% Natriumpyruvat, 0,10% Proline und 1% TGF-3.
      HINWEIS: Das osteogene Differenzierungsmedium muss innerhalb eines Monats nach der Konfiguration aufgebraucht sein. Die effektive Periode des konfigurierten chondrogenen Differenzierungsmediums beträgt 12 h.

2. Isolierung und Kultivierung von Ratten-MBMSCs

HINWEIS: Alle experimentellen Operationen sollten so weit wie möglich auf Eis durchgeführt werden, um die Zelllebensfähigkeit zu erhalten.

  1. Ernte von Rattenunterkiefern
    1. Euthanisieren Sie zwei 5 Wochen alte männliche Sprague Dawley Ratten durch CO2 Erstickung. Stellen Sie sicher, dass die Atmung des Tieres gestoppt wird, bevor Sie mit dem Experiment fortfahren.
    2. Spülen Sie diese Ratten in einem Becher, der 75% Ethanol für 3 min enthält.
    3. Legen Sie die Ratte in eine saubere Dunstabzugshaube, um Unterkiefer zu ernten.
      HINWEIS: Sterilisieren Sie die Dunstabzugshaube vor Gebrauch 30 min lang durch ultraviolette Lichtstrahlung.
    4. Legen Sie die Ratte in eine Supine-Position. Schneiden Sie die Häute und Buccinator-Muskeln von bilateralen Angulus oris in die hintere Region des Unterkiefers, die der einzige bewegliche Knochen mit niedrigerem Schneidemittel ist.
      HINWEIS: Es wird empfohlen, einen 2 cm Schnitt auf jeder Seite des Angulus-Oris zu machen, um ein klares Operationsfeld zu erhalten.
    5. Öffnen Sie den Mund der Ratte, indem Sie die Kiefer- und Unterkieferschneideschneide schneideinn in die entgegengesetzte Richtung mit beiden Daumen drücken, um die Unterkieferzähne freizulegen, die an der Unterkiefer befestigt sind.
    6. Trennen Sie die bukkalen Muskeln und Sehnen, die an den Koracoiden befestigt sind, und die untere Grenze des Unterkiefers vollständig ab.
      HINWEIS: Eine erhöhte Beweglichkeit des Unterkiefers wird während dieses Schritts aufgrund des Mangels an Muskelspannung beobachtet.
    7. Drücken Sie die unterkieferförmigen hinteren Zähne und drehen Sie sich nach hinten und unten, bis die Kondylen auf beiden Seiten deutlich frei gelegt sind.
      HINWEIS: Dieser Schritt wird durchgeführt, um den Mund der Ratte so weit wie möglich künstlich zu öffnen, um den Condyle zu verrenzieren. Der Unterkiefer ist durch bilaterale Kondylen mit dem Schädel verbunden, so dass die Exposition der Kondylen zur Trennung zwischen Schädel und Unterkiefer führt.
    8. Trennen Sie den Unterkieferkörper vom Schädel.
    9. Reinigen Sie das anhaftende Weichgewebe auf der Knochenoberfläche mit einer nassen Gaze.
    10. Legen Sie den Knochen in eine 10 cm sterile Glasschale, gefüllt mit vorgekühlten minimal α en (α-MEM) oder Phosphatpuffer-Saline (PBS) auf Eis, um die Lebensfähigkeit zu erhalten.
  2. Isolierung und Kultivierung der mBMSCs
    1. Schneiden Sie den vorderen Knochen entlang der mesialen Kante des ersten Molaren vom Unterkieferkörper ab. Entfernen Sie den Unterkiefer-Ramus einschließlich Corakoid und Condyle entlang der distalen Kante des dritten Molaren, um die Markhöhle freizulegen.
    2. Füllen Sie eine 10 cm sterile Glasschale mit 10 ml α-MEM (mit 10% FBS).
    3. Verwenden Sie 1 ml Spritze, um α-MEM-Kulturmedium zu aspirieren. Mit der Spritzennadel, die in die Knochenmarkhöhle eingeführt wird, spülen Sie das Knochenmark wiederholt in die Schale. Spülen Sie die Knochenhöhle mindestens 3 Mal von beiden mesialen und distalen Seiten des Knochens, bis der Knochen weiß wurde.
      HINWEIS: Dies ist der kritischste Schritt, da die Knochenmarkhöhle einer Rattenunterkiefer nicht so offensichtlich ist wie bei langen Knochen und der richtige Punkt, um die Nadel einzusetzen, empirisch bestimmt werden muss. Alle oben genannten Versuchsproben sollten auf Eis gelagert werden, um die Zelllebensfähigkeit zu erhalten, so dass die Betriebszeit nicht länger als 2 h betragen darf.
    4. Übertragen Sie das Medium, das die gespülten Zellen enthält, in ein 15 ml Zentrifugenrohr und eine Zentrifuge bei 800 x g bei 4 °C für 5 min. Entsorgen Sie den Überstand.
    5. Setzen Sie die Zellen mit 3 ml α-MEM (mit 10% FBS) wieder aus. Die Zellen in einer neuen 10 cm Kulturschale aufsieben und bei 37 °C in einem 5% CO2-Inkubator brüten.
    6. Überprüfen Sie die morphologischen Veränderungen und das Wachstum dieser Zellen am 3. Tag der Kultur. Entfernen Sie das Kulturmedium mit nicht haftenden Zellen und Gewebefragmenten. Fügen Sie vorsichtig 10 ml frische α-MEM (mit 10% FBS) hinzu.
    7. Nach 7 Tagen Kultur erreichten P0-MBMSCs 70% bis 80% Zusammenfluss.
  3. Durchflusszellensortierung
    HINWEIS: P0-MBMSCs wurden phänotypisch identifiziert und in erster Linie durch Durchflusszellensortierung gereinigt.
    1. Das Kulturmedium ansaugen und entsorgen und dann das Gericht mit PBS waschen. Entsorgen Sie die PBS.
    2. 1 ml 0,25% Trypsin mit 0,02% EDTA in die Schale geben. Verdauen Sie die Zellen bei 37 °C für 5 min, dann fügen Sie 2 ml α-MEM (mit 10% FBS) hinzu, um die Reaktion zu stoppen.
    3. Übertragen Sie die Zellsuspension in ein 15 ml Zentrifugenrohr und Zentrifuge bei 800 x g für 5 min.
    4. Setzen Sie die Zellen nach der Zentrifugation in 120 l PBS (mit 10% FBS) aus.
    5. Blockieren Sie diese Zellsuspensionen mit 1 l Antikörper gegen CD16/CD32 bei 4 °C für 15 min.
    6. 100 l der Zellsuspension in ein neues Mikrozentrifugenrohr übertragen, die Zellen mit Phycoerythrin (PE)-konjugiertem Antikörper gegen CD45, Fluorescein-Isothiocyanat (FITC)-konjugierte Antikörper gegen CD90 und Allophycocyanin (APC)-Antikörper gegen CD29 bei 4 °C bei 1 h im Dunkelnfärben. Die Konzentration der in diesem Experiment verwendeten Antikörper ist in Tabelle 2dargestellt. Verwenden Sie die anderen 20 L zellsuspension als ungefärbte Negativkontrolle.
    7. Zentrifugieren Sie dann die Rohre bei 800 x g für 5 min, entsorgen Sie die Suspension und setzen Sie die Zellen in 0,5 ml PBS (mit 10% FBS) wieder auf.
    8. Fügen Sie vor der Analyse 10 l von 0,01 mg/ml DAPI für 10 min hinzu.
    9. Verwenden Sie 40 nm Filter, die auf Zentrifugenrohren platziert werden, um die Zellen zu filtern.
    10. Analysieren Sie die Zellen auf Fluoreszenz-aktivierten Zellsortierer. Stellen Sie die Bedienfelder wie folgt ein. Entfernen Sie zunächst abgestorbene Zellen aus der Gesamtzellenzahl, indem Sie DAPI- Zellen, dann Gate CD29+CD90+CD45- in den ausgewählten Zellen als Ziel-MBMSCs veranlassen.
    11. Sammeln Sie die sortierten CD29+CD90+CD45- Zellen in ein 15 ml Zentrifugenrohr mit 3 ml α-MEM (mit 10% FBS) vorgefertigt.
    12. Zentrifugieren Sie die Rohre bei 800 x g für 5 min. Entfernen Sie den Sammlungspuffer, und fügen Sie 1 ml frisches α-MEM (mit 10 % FBS) hinzu, um die Zellen erneut auszusetzen. Dann teller sie in einem 6 cm Kulturgericht.

3. Fähigkeit zur Koloniebildung

HINWEIS: Dieser Schritt wurde ausgeführt, um die Divisionsfähigkeit von mBMSCs zu überprüfen. 15

  1. Wählen Sie die zweite Passage mBMSCs (P2) für dieses Experiment. Wenn der Zellzusammenfluss 80% bis 90% erreichte, sät die Zellen in einem seriellen Gradienten in einer 6-Well-Platte neu, um ihre klonale Proliferationsfähigkeit zu bewerten.
    HINWEIS: Es wird empfohlen, den Gradienten von 1 x 102 bis 1 x 103 Zellen pro Bohrkörper einzustellen, aber die endgültigen Verdünnungen verschiedener Zelllinien menschlichen oder tierischen Ursprungs wurden empirisch bestimmt.
  2. Kultur die Zellen in α-MEM (mit 10% FBS) für etwa zwei Wochen, bis eine gute Anzahl der koloniebildenden Einheiten unter Lichtmikroskop gesehen werden konnte. Erfrischen Sie das Kulturmedium alle 3 Tage.
  3. Aspirieren und entsorgen Sie das Kulturmedium, waschen Sie die Brunnen mit PBS zweimal für 5 min am Mal. Als nächstes 4% Paraformaldehyd-Lösung zu jedem Brunnen hinzufügen und für mindestens 10 min fixieren.
  4. Entfernen Sie das Paraformaldehyd und spülen Sie die Brunnen zweimal mit PBS.
  5. Die Zellen mit kristallvioletter Färbelösung färben und in 37 °C ca. 10 min inkubieren.
    HINWEIS: Die Färbezeit wird entsprechend eingestellt, bis der gewünschte Farbton erreicht ist.
  6. Entfernen Sie die Färbelösung und waschen Sie die Proben mit destilliertem Wasser, um die Reaktion zu stoppen.
  7. Bild unter einem Stereomikroskop und zählen verstreute Zellkolonien, die aus mindestens 50 Zellen bestanden.

4. Multilineage-Differenzierung von mBMSCs

HINWEIS: Die P2-MBMSCs wurden für nachfolgende Experimente verwendet, sofern nicht anders beschrieben.

  1. Osteogene Induktion von mBMSCs
    1. Digest die mBMSCs wie oben beschrieben. Samenzellen mit einer Dichte von 2,5 x 105/cm2 in einer 12-Well-Platte, ergänzt durch 1 ml α-MEM (mit 10% FBS).
    2. Wenn der Zellzusammenfluss 60-70% erreichte, ändern Sie das Medium in 30% osteogene Induktionsmedien. Kultur die Zellen mit α-MEM (mit 10% FBS) als negative Kontrolle und ändern Sie das Medium alle 2 Tage.
      HINWEIS: Nachdem während der Osteogenese eine große Anzahl von Kalziumknötchen auftreten, wird empfohlen, das mittlere Austauschmuster alle 2 Tage auf einen mittleren Volumenaustausch umzutauschen, um zu verhindern, dass Osteoblasten schwimmen.
    3. Nach der Kultivierung für sieben Tage, bewerten Sie die Verkalkung dieser Zellen durch alkalische Phosphatase Färbung16,17.
    4. Entfernen Sie das Kulturmedium und fixieren Sie die Zellen mit 4% Paraformaldehyd für 10 min. Spülen Sie die Zellen mit 1 ml PBS pro Brunnen für 3 min zweimal.
    5. Dann färben Sie die Zellen mit alkalischer Phosphatase-Färbungslösung und inkubieren bei 37 °C für 10-30 min.
      HINWEIS: Die Inkubation kann über Nacht bei Raumtemperatur durchgeführt werden, um die gewünschte Farbe zu erhalten.
    6. Waschen Sie die Brunnen mit destilliertem Wasser, um die Reaktion zu stoppen. Fotografieren Sie unter Lichtmikroskop. Rot pigmentierte sulfierte Granulate stellen die Aktivität der alkalischen Phosphatase (ALP) dar.
    7. Nach der Kultivierung der verbleibenden Zellen für weitere 7 Tage, führen Sie Alizarin rote Färbung, um die Mineralisierungskapazität der Zellen zu bewerten.
    8. Färben Sie die Zellen mit 0,5% Alizarin rote Färbung Lösung nach Zellfixierung für 10 min16,18. Beenden Sie die chromogene Reaktion mit destilliertem Wasser nach 3-5 min.
      HINWEIS: Die Reaktionszeit kann je nach entwickelter Farbe verlängert werden.
    9. Schließlich legen Sie die Kulturplatte unter das Lichtmikroskop, um die Wirkung der osteogenen Färbung zu beobachten; rote Knötchen weisen auf Kalziumablagerungen dieser Zellen hin.
  2. Adipogene Induktion von mBMSCs
    1. Seed P2 mBMSCs in einer 12 WellPlatte, wie oben beschrieben.
    2. Nach dem Brunnen zu 90% konfluent werden, Kultur die Zellen mit adipogene Differenzierung Medium A. Verwenden Sie Zellen kultiviert in α-MEM Kulturmedium (mit 10% FBS) als negative Kontrolle.
    3. Nach 2 Tagen Induktion das Medium A aus dem Brunnen ansaugen und in jedem Brunnen 1 ml adipogene Differenzierungsmedium B hinzufügen.
    4. Nach einem Tag entfernen Sie Medium B und starten Sie den Zyklus wieder mit Medium A wieder in den Brunnen hinzugefügt. Kultur der Zellen abwechselnd mit Medium A und B.
    5. Tragen Sie das Differenzierungsmedium A und B abwechselnd für drei Zyklen auf und detektieren Sie die Adipogenese dieser Zellen durch ölrote O-Färbung16,18.
      HINWEIS: Viele runde und große Lipidtröpfchen können beobachtet werden, indem diese Zellen mit Differenzierungsmedium B für weitere 2 bis 3 Tage kultiviert werden.
    6. Entfernen Sie das Medium und fixieren Sie die Zellen mit 4% Paraformaldehyd für 10 min. Waschen Sie die Zellen mit PBS aus.
    7. Die Zellen mit ölroter O-Färbungslösung beflecken und ca. 3 min bei 37 °C brüten.
    8. Entfernen Sie die Färbelösung und waschen Sie die Brunnen mit destilliertem Wasser.
    9. Beobachten Sie die Adipogenese unter Lichtmikroskop.
  3. Chondrogenese-Induktion von mBMSCs
    1. Seed P2 mBMSCs in 15 ml Zentrifugenrohr mit einer Dichte von 5 x 105/cm2.
    2. Zentrifugieren Sie die Rohre bei 300 x g für 5 min. Entsorgen Sie den Überstand.
    3. Resuspend ieren die Zellen mit 0,5 ml chondrogene Differenzierung Medium. Zentrifugieren Sie die Zellen bei 300 x g für 5 min.
    4. Lösen Sie die Kappe des Zentrifugenrohrs und inkubieren Sie es bei 37 °C in einem 5% CO2-Inkubator. Erneuern Sie das Medium alle 2 Tage.
      HINWEIS: Zellen beginnen nach 24 h mit dem Pelletieren. Es wird empfohlen, das Zentrifugenrohr nicht für 48 h zu bewegen. Achten Sie darauf, das Zellpellet nicht zu aspirieren, wenn Sie das Medium wechseln.
    5. Fixieren Sie die Zellpellets nach 21 Tagen Induktion mit 4% Paraformaldehyd, gefolgt von Dehydrierung, Paraffineinbettung und Schnitt.
    6. Nach Derparaffinierung und Hydratation die Dias in alcian blauer Lösung für mindestens 15 min18,19,20,21färben und dann mit destilliertem Wasser waschen, um die Reaktion zu stoppen. Erfassen Sie die Fotos unter Lichtmikroskop.
    7. Führen Sie für die immunfluoreszierende Färbung von Kollagen Typ II die folgenden Schritte aus.
      1. Die Dias nach dem Deparaffinierungs- und Hydratationsschritt mit 5 g/ml Proteinase K für 15 min bei 37 °C inkubieren.
      2. Inkubieren Sie die Dias im Sperrpuffer für 1 h bei 37 °C.
      3. 1 L KollagenTyp II Antikörper in 200 l Sperrpuffer auf die Dias auftragen und über Nacht bei 4 °C inkubieren.
      4. Am nächsten Tag die Dias zweimal mit PBS waschen und bei 37 °C für 1 h mit Sekundärantikörpern bebrüten.
      5. Inkubieren Sie die Scheiben mit 40,6-Diamidino-2-Phenylindole (DAPI) für 10 min.
    8. Fotografieren Sie jedes Diaunter unter Fluoreszenzmikroskopie.

5. Echtzeit-PCR

  1. Extrahieren Sie die gesamte RNA aus mBMSCs mit einem Guanidium isothiocyanat, das auf kommerziell erhältlichem Reagenz basiert.
  2. Führen Sie die umgekehrte Transkription von RNA in komplementäre DNA mit einem handelsüblichen Kit durch. Die Reaktionsbedingungen der Umgekehrten Transkription waren wie folgt: 65 °C für 5 min, 37 °C für 15 min, 85 °C für 15 s.
  3. Führen Sie Echtzeit-PCR durch, um Osteogenese und Adipogenese-spezifische Gene mithilfe von Primern zu erkennen, die in Tabelle 3 aufgeführt sind. Das PCR-Verstärkungsverfahren war wie folgt: 95 °C für 5 min. 95 °C für 5 s, 60 °C für 30 s für 40 Zyklen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Mit diesem Protokoll haftete ein großer Teil der Zellen am dritten Tag nach der Anfangskultur an der Platte. In der Regel erreichte der Zellzusammenfluss nach zusätzlichen 3-4 Tagen Kultur 70 bis 80 %(Abbildung 1B). Mit fluoreszierender Zellsortierung wurden DAPI-CD29+CD90+CD45- mBMSCs18,22, die etwa 81,1% in den P0-Zellen ausmachten (Abbildung 1C) gereinigt.

Nach der Aussaat von P2-MBMSCs an 100 Zellen in jedem Brunnen von 6 Brunnenplatten für eine Woche wurde eine signifikante Menge von koloniebildenden Einheiten beobachtet, was auf die signifikante Koloniebildungsfähigkeit von mBMSCs hindeutete (Abbildung 1D).

Zur Beurteilung der Multiliniendifferenzierungsfähigkeit wurden die mBMSCs in 12 Brunnenplatten in Osteo-, Chondro- und Adipo-Linien induziert. Die mBMSCs zeigten eine starke osteogene Differenzierungsfähigkeit. Erhöhte Aktivität von ALP, rote kalkhaltige Knötchen verteilt sporadisch unter Alizarin rote Färbung, und erhöhte Expression der osteogene spezifischen Gene Runx2, Alp, Bsp und Ocn (Abbildung 2) zeigte östogene Induktion. Bei der Adipogenese, die durch Öl-Rot-O-Färbung identifiziert wurde, waren nach 9 Tagen Induktion zahlreiche lipidreiche Vakuole erkennbar. Ebenso zeigte die Expression der adipogenen spezifischen Gene Ppar1 und Cebpa einen signifikanten Anstieg (Abbildung 3). Für die mikroskopische Beobachtung von chondrogenen Differenzierungsdias zeigten die Proben eine positive Färbung für Alcian blau. Darüber hinaus zeigte die Immunfärbung mit Anti-Typ-II-Kollagen-Antikörper eine verbesserte Ansammlung der Knorpelmatrix (Abbildung 4).

Kulturmedium Komponente Endgültige Konzentration
1.α-MEM Kulturmedium (mit 10%FBS) α-Minimum-Essential-Medium
Fetales Rinderserum 10%
Penicillin und Streptomycin 1%
2.Osteogenes Induktionsmedium α-MEM-Kulturmedium (mit 10%FBS) 70%
Osteogene Differenzierungsmedium 30%
3.Osteogenes Differenzierungsmedium Osteogene Differenzierung Basalmedium
Fetales Rinderserum 10%
Glutamin 1%
Penicillin-Streptomycin 1%
Ascorbinsäure 0.20%
β-Glycerophosphat 1%
Dexamethason 0.01%
4.Adipogene Differenzierungsmedium A Adipogene Differenzierung Basalmedium
Fetales Rinderserum 10%
Glutamin 1%
Penicillin-Streptomycin 1%
Insulin 0.20%
IBMX 0.10%
Rosiglitazon 0.10%
Dexamethason 0.01%
5.Adipogene Differenzierungsmedium B: Adipogene Differenzierung Basalmedium
Fetales Rinderserum 10%
Glutamin 1%
Penicillin-Streptomycin 1%
Insulin 0.20%
6.Chondrogenische Differenzierung serann: Chondrogenese Differenzierung basiales Medium
Dexamethason 0.01%
Ascorbinsäure 0.30%
Seine 1%
Natriumpyruvat 0.10%
Proline 0.10%
TGF-Nr. 3 1%

Tabelle 1: Komponenten des Kulturmediums und des Differenzierungsmediums.

Antikörper Konzentration
CD90.1 (Thy-1.1) Monoklonaler Antikörper 0,5mg/ml
CD45 Monoklonaler Antikörper 0,2mg/ml
CD29 Antikörper 0,2mg/ml
KollagenII Kaninchen polyklonaler Antikörper 5mg/ml
Ziege Anti-Rabbit IgG H&L (Alexa Fluor® 488) 1mg/ml

Tabelle 2: In dieser Studie verwendete Antikörperkonzentration.

Primer Sequenz(5' bis 3')
GAPDH Foward: CGGCAAGTTCAACGGCACAGTCAAGG
Rückseite: ACGACATACTCAGCACCAGCATCACC
Runx2 Foward: GCCTTCAAGGTTGTAGCCCT
Rückseite: TGAACCTGGCCACTTGGTTT
Alp Foward: AAACTCGCTTATGGTCCCCG
Rückseite: TGGGTTTGAATTCCTGCGGT
Bps Foward: GCACGGTTTTTATGGGGAA
Rückseite: ATCCTGACCCTCGTAGCCTT
Ocn Vorwärts:CAACCCCAATTGTGACGAGC
Rückseite:GGCAACACATGCCCTAAACG
Cebpa Foward: AGTCGGTGGATAAGAACAGCAACG
Rückseite: CGGTCATTGTCACTGGTCAACTCC
Papa1 Foward: CCATCGAGGACATCCAAGACAACC
Rückseite: GTGCTCTGTGACACTCTGCCTGAG

Tabelle 3: Primer, die in Echtzeit-PCR verwendet werden.

Figure 1
Abbildung 1: Isolation und Kultur von mBMSCs. (A) Schematisches Diagramm des Protokolls. mBMSCs wurden am 0. Tag isoliert und plattiert und mit α-MEM-Kulturmedium inkubiert. Am 7. Tag wurden die P0-MBMSCs durch Durchflusszytometrie-Sortierung gereinigt und die sortierten Zellen auf eine neue Kulturschale plattiert. Am 14. Tag wurden P1-MBMSCs gesammelt und auf 12-Well-Platten plattiert. Am 15. Tag wurden P2-MBMSCs unter entsprechendem Induktionsmedium in Osteoblasten, adipogene Zellen und Chondroblasten induziert. (B) Schematisches Modell des unterdibulären Knochenmarks der Ratte und mikroskopische Beobachtung von P0-mBMSCs. (C) Durchflusszytometrie-Sortierung von Ratten-MBMSCs. Die Strömungszytometrie-Analyse zeigt, dass diese Zellen positiv für CD29 und CD90 waren, aber negativ für CD45, das mit BMSC-Eigenschaften kongruent ist. Davon wurden 1,4 x 106 Zellen sortiert, die entsprechend 80% der gesamtzellen ausmachten. (D) Repräsentatives Bild von kristallviolett gebeizten P2 mBMSC-Klonen. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 2
Abbildung 2: Osteogenes Differenzierungspotenzial von mBMSCs. (A) Nach 7 Tagen osteogener Induktion wurde die Veränderung der ALP-Aktivität visualisiert. Eine große Anzahl mineralisierter Knötchen wurde 14 Tage nach der Induktion der osteogenen Differenzierung unter Alizarin-Rotfärbung gefärbt. (B,C) Der positive Bereich der ALP- und Alizarin-Rotfärbung wurde mit der Image J Software bewertet. (C-G) Die mRNA-Expression der Osteoblasten-spezifischen Marker Runx2, Alp, Bsp und Ocn nahm nach 7 Tagen Osteogenese signifikant zu. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 3
Abbildung 3: Adipogenes Differenzierungspotenzial von mBMSCs nach neun Tagen Induktion. (A) Eine große Menge fetter Tröpfchen bilden sich und Adipozyten wurden mit Öl-Rot-O gefärbt. (B,C) Die mRNA-Expression der adipogenen Marker Cebpa und Pamé1 nahm nach 9 Tagen Adipogenese bemerkenswert zu. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 4
Abbildung 4: Stereoskopansicht des chondrogenen Differenzierungseffekts. (A) mBMSCs nach 21 Tagen chondrogenische Induktion zeigte positiv für alcian blaue Färbung. (B) Immunfluoreszenzbild des chondrogenen Aggregats, das mit Antityp-II-Kollagen gefärbt ist. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Dieses Protokoll beschreibt eine Methode, um BMSCs von Rattenunterkiefern in vitro zu isolieren, indem ganze Knochenmarkhaftung und fluoreszierende Zellsortierung kombiniert werden, was eine einfache und zuverlässige Möglichkeit ist, proliferative mBMSCs mit starker Differenzierungsfähigkeit zu erhalten. Diese Methode könnte mBMSCs vorläufig durch Durchflusszellensortierung reinigen, aber wenn höhere Anforderungen an die Zellhomogenität bestehen, können präzisere Reinigungsmethoden erforderlich sein.

Derzeit gibt es vier Haupttechniken zur Isolierung von mBMSCs, einschließlich der GesamtenKnochenmarkhaftung, der Dichtegradientenzentrifugation, der fluoreszierenden Zellsortierung und der magnetisch aktivierten Zellsortierung22. Die Zentrifugierung des ganzen Knochenmarks und die Zentrifuge des Dichtegradienten sind die gebräuchlichsten und einfachsten Methoden, um in kurzer Zeit mBMSCs zu erhalten, aber die geringe Reinheit der geernteten mBMSCs ist ihr Hauptnachteil. Die letzten beiden Methoden können hochgereinigte mBMSCs durch immunologische Techniken isolieren, haben aber die Mängel, teuer zu sein, lange Zeit in Zeit zu nehmen und die Zelllebensfähigkeit zu beeinträchtigen. In dieser Studie wurden die Vorteile der gesamten Knochenmarkhaftung und der fluoreszierenden Zellsortierungsmethode kombiniert, um in kurzer Zeit genügend proliferative mBMSCs zu erhalten.

Zweifellos ist einer der kritischsten Schritte in diesem Protokoll die Zerlegung von Rattenunterkiefern, die sich deutlich von denen von axialen und appendicularen Knochen unterscheidet. Es ist wichtig, die Anatomie der Rattenunterkiefer zu verstehen, um eine intakte Probe zu erhalten. Ähnlich wie beim Menschen sitzt Rattenunterkiefer unter der Oberkiefer, hält die unteren Zähne an Ort und Stelle und ist durch bilaterale Kondylen mit dem Schädel verbunden. Da der Unterkiefer der einzige Knochen ist, der sich im Schädel bewegen kann, gibt es viele Muskeln, die an Unterkiefer befestigt sind, die seine Bewegung steuern. Nur wenn diese Weichgewebe vollständig entfernt und der Mund maximal geöffnet wird, können die mit dem Schädel verbindenden Kondylen freigelegt werden. Es ist auch erwähnenswert, dass der kondylar Hals eine körperliche Schwäche im Unterkiefer ist und leicht zu brechen ist. Wenn beim Drehen des Unterkiefers nach unten ein übermäßiger Widerstand festgestellt wird, bedeutet dies, dass die Kaumuskeln möglicherweise nicht vollständig entfernt werden. Wenn dies beobachtet wird, drehen Sie es nicht eingeschränkt, sonst ist es einfach, den kondylaren Hals zu brechen, wodurch eine Zellkontamination. Weitere Schwierigkeiten bei der Trennung und Kultur von mBMSCs sind geringer Gehalt an Knochenmark, zarte Zellaktivität, geringe Reinheit, geringe Zellfrequenz und Kontamination hämatopoetischer Zellen18,23. Um mBMSCs mit gutem Wachstum und relativ hohem Differenzierungspotenzial zu erhalten, ist es von entscheidender Bedeutung, die Aktivität von mBMSCs sicherzustellen. Es gibt mehrere wichtige Schritte, einschließlich der Verwendung von vier Wochen alten Ratten für diese und nachfolgende Experimente, da junge Ratten bevorzugt werden, um eine gute Lebensfähigkeit zu erhalten. Viele Studien haben bestätigt, dass die Aktivität von mBMSCs mit dem Alter von Versuchstieren zusammenhängt. Diese mBMSCs älterer Spender können zu einer geringeren Proliferationsaktivität, differenzierungspotenzial und Lebensdauer führen2. Alle Operationen während der Zellernte müssen auf Eis abgeschlossen werden und die Betriebszeit sollte so kurz wie möglich sein, vorzugsweise innerhalb von 2 Stunden. Darüber hinaus halten Sie die Trypsin-Verdauungszeit nicht länger als 3 Minuten. Eine weitere Herausforderung in diesem Protokoll ist schließlich die Ernte von mBMSCs. Es kann lästig sein, mBMSCs aus der Knochenhöhle zu spülen, da der Hohlraum des Rattenunterkiefers sehr klein ist, daher ist es sehr wichtig, mit der anatomischen Struktur vertraut zu sein. Mikro-CT-Bilder können dabei eine große Hilfe sein. Außerdem ist es erwähnenswert, dass als jungbeinige Knochen schlank und spröde sind, Bruch kann zu Kontamination führen.

Unter Bezugnahme auf die immunphenotypische Charakterisierung exprimieren BMSCs mehrere Phänotypen, von denen jedoch keiner spezifisch für sie ist24. Es ist allgemein anerkannt, dass BMSCs nicht CD11b, CD14, CD34 oder CD45 ausdrücken, aber sie haben einen hohen Ausdruck von Sca-1, CD29, CD90 und CD105. Diese Studie wählte die weithin akzeptierten Marker von CD29, CD90 und CD45 für die fluoreszierende Zellsortierung13,14,25. Sie stellte fest, dass CD29+CD90+CD45- Zelle entsprechend 80 % der Gesamtzellen ausmachte, was für die spätere Zellkultur und Forschung ausreichte.

Seit Jahrzehnten ist die Stammzelltherapie weit verbreitet bei der Behandlung verschiedener Krankheiten wie Erkrankungen des Immunsystems, hämatologische systemische Erkrankungen, Krebs oder Traumata. Zweifellos können mBMSCs als Ersatz für BMSCs aufgrund ihrer überlegenen Eigenschaften als sichereres und leistungsfähigeres Werkzeug in der Stammzelltherapie eingesetzt werden. Die Zellkultur und die Erweiterung von mBMSCs werden daher besonders wichtig, um eine ausreichende Anzahl von Zellen für die Behandlung zu erhalten.

Zusammenfassend zeigte diese Studie ein vielversprechendes und zuverlässiges Protokoll zur Ernte reichlich erkönnener mBMSCs mit hoher Homogenität und Multidifferenzierungsfähigkeit in kurzer Zeit.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Alle Autoren erklären, dass sie keine Interessenkonflikte haben.

Acknowledgments

Wir danken für die Unterstützung von Laboratory for Digitized Stomatology and Research Center for Craniofacial Anomalies of Shanghai Ninth People es Hospital. Die Arbeit dieses Manuskripts wird durch Stipendien der National Natural Science Foundation of China (NSFC) [81570950,81870740,81800949] unterstützt, Shanghai Summit & Plateau Disciplines, der SHIPM-mu Fonds des Shanghai Institute of Precision Medicine, Shanghai Ninth People es Hospital, Shanghai Jiao Tong University School of Medicine [JC201809], das Incentive Project of High-Level Innovation Team for Shanghai Jiao Tong University School of Medicine. Und L.J. ist Ein Gelehrter des Outstanding Youth Medical Talents, Shanghai "Rising Stars of Medical Talent" Youth Development Program und des Projekts "Chen Xing" der Shanghai Jiaotong University.

Materials

Name Company Catalog Number Comments
0.25% Trypsin-EDTA(1X) Gibco 25200072
10cm culture dish Corning
acutenaculum
Adipogenic differentiation medium Cyagen biosciences inc. MUBMX-90031
Alcian Blue Beyotime Biotechnology
Alizarin red Sigma-Aldrich A5533
Alkaline Phosphatase Color Development Kit Beyotime Biotechnology C3206
alpha-Minimum essential medium GE Healthcare HyClone Cell Culture SH30265.01B
Anti -CollagenII Rabbit pAb Abcam ab34712
Antibodies against CD16/CD32
Antifade Mounting Medium with DAPI Beyotime Biotechnology P0131
APC anti-mouse/rat CD29 Antibody biolegend inc 102215
Biosafety cabinet Esco AC2-4S8-CN
CD45 Monoclonal Antibody (OX1), PE, eBioscience Invitrogen 12-0461-82
CD90.1 (Thy-1.1) Monoclonal Antibody (HIS51), FITC, eBioscience Invitrogen 11-0900-85
Centrifuge cence L500
Chondrogenesis differentiation medium cyagen biosciences inc.
Confocal laser scanning microscope Zeiss LSM880
Countess II FL Automated Cell Counter Invitrogen AMQAF1000
Crystal Violet Staining Solution Beyotime Biotechnology C0121
Fetal Bovine Serum GE Healthcare HyClone Cell Culture SH30084.03
Goat Anti-Rabbit IgG H&L (Alexa Fluor 488) abcam ab150077
Incubator Esco CCL-170B-8
Inverted microscope olympus CKX53
Magzol reagent(Trizol reagent) Magen
micropipettor Eppendorf
Oil Red O
Osteogenic differentiation medium cyagen biosciences inc. MUBMX-90021
Penicillin-Streptomycin Gibco 15070063
Phosphate-buffered saline(1X) Gibco 20012027
PrimeScript RT Master Kit TakaRa Bio Inc RR036A
Proteinase K Sigma-Aldrich P6556
QuickBlock Blocking Buffer Beyotime Biotechnology P0260
scissor
SYBR1 Premix TakaRa Bio Inc
Toluidine Blue Beyotime Biotechnology
Trypan Blue Solution, 0.4% Gibco 15250061

DOWNLOAD MATERIALS LIST

References

  1. Jin, C., et al. Stem cell education for medical students at Tongji University: Primary cell culture and directional differentiation of rat bone marrow mesenchymal stem cells. Biochemistry and Molecular Biology Education. 46, (2), 151-154 (2018).
  2. Chu, D. T., et al. An Update on the Progress of Isolation, Culture, Storage, and Clinical Application of Human Bone Marrow Mesenchymal Stem/Stromal Cells. International Journal of Molecular Sciences. 21, (3), 708 (2020).
  3. Jin, Z., Chen, J., Shu, B., Xiao, Y., Tang, D. Bone mesenchymal stem cell therapy for ovariectomized osteoporotic rats: a systematic review and meta-analysis. BMC Musculoskeleton Disorder. 20, (1), 556 (2019).
  4. Jiang, Y., et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature. 418, (6893), 41-49 (2002).
  5. Musina, R. A., Bekchanova, E. S., Belyavskii, A. V., Sukhikh, G. T. Differentiation potential of mesenchymal stem cells of different origin. Bulletin of Experimental Biology and Medicine. 141, (1), 147-151 (2006).
  6. Lloyd, B., et al. Similarities and differences between porcine mandibular and limb bone marrow mesenchymal stem cells. Archives in Oral Biology. 77, 1-11 (2017).
  7. Zhang, W., et al. Comparison of the use of adipose tissue-derived and bone marrow-derived stem cells for rapid bone regeneration. Journal of Dental Research. 92, (12), 1136-1141 (2013).
  8. Stefanik, D., et al. Disparate osteogenic response of mandible and iliac crest bone marrow stromal cells to pamidronate. Oral Disorders. 14, (5), 465-471 (2008).
  9. Aghaloo, T. L., et al. Osteogenic potential of mandibular vs. long-bone marrow stromal cells. Journal of Dental Research. 89, (11), 1293-1298 (2010).
  10. Kaigler, D., et al. Stem cell therapy for craniofacial bone regeneration: a randomized, controlled feasibility trial. Cell Transplantation. 22, (5), 767-777 (2013).
  11. Li, C., Wang, F., Zhang, R., Qiao, P., Liu, H. Comparison of proliferation and osteogenic differentiation potential of rat mandibular and femoral bone marrow mesenchymal stem cells in vitro. Stem Cells Development. 2020, 1941629 (2020).
  12. Matsubara, T., et al. Alveolar bone marrow as a cell source for regenerative medicine: differences between alveolar and iliac bone marrow stromal cells. Journal of Bone and Mineral Research. 20, (3), 399-409 (2005).
  13. Chan, C. K. F., et al. Identification of the Human Skeletal Stem Cell. Cell. 175, (1), 43-56 (2018).
  14. Bianco, P., Riminucci, M., Gronthos, S., Robey, P. G. Bone marrow stromal stem cells: nature, biology, and potential applications. Stem Cells. 19, (3), 180-192 (2001).
  15. Franken, N. A., Rodermond, H. M., Stap, J., Haveman, J., van Bree, C. Clonogenic assay of cells in vitro. Nature Protocol. 1, (5), 2315-2319 (2006).
  16. Xu, H., et al. Icariin prevents oestrogen deficiency-induced alveolar bone loss through promoting osteogenesis via STAT3. Cell Proliferation. 53, (2), 12743 (2020).
  17. Zhang, P., Wu, Y., Jiang, Z., Jiang, L., Fang, B. Osteogenic response of mesenchymal stem cells to continuous mechanical strain is dependent on ERK1/2-Runx2 signaling. Internation Journal of Molecular Medicine. 29, (6), 1083-1089 (2012).
  18. Zhu, H., et al. A protocol for isolation and culture of mesenchymal stem cells from mouse compact bone. Nature Protocol. 5, (3), 550-560 (2010).
  19. Lach, M. S., et al. Chondrogenic Differentiation of Pluripotent Stem Cells under Controllable Serum-Free Conditions. International Journal of Molecular Sciences. 20, (11), 2711 (2019).
  20. Huang, X., Zhong, L., Hendriks, J., Post, J. N., Karperien, M. The Effects of the WNT-Signaling Modulators BIO and PKF118-310 on the Chondrogenic Differentiation of Human Mesenchymal Stem Cells. International Journal of Molecular Sciences. 19, (2), 561 (2018).
  21. Gale, A. L., Linardi, R. L., McClung, G., Mammone, R. M., Ortved, K. F. Comparison of the Chondrogenic Differentiation Potential of Equine Synovial Membrane-Derived and Bone Marrow-Derived Mesenchymal Stem Cells. Frontiers in Veterinary Sciences. 6, 178 (2019).
  22. Li, X., Zhang, Y., Qi, G. Evaluation of isolation methods and culture conditions for rat bone marrow mesenchymal stem cells. Cytotechnology. 65, (3), 323-334 (2013).
  23. Kagami, H., Agata, H., Tojo, A. Bone marrow stromal cells (bone marrow-derived multipotent mesenchymal stromal cells) for bone tissue engineering: basic science to clinical translation. International Journal of Biochemistry and Cell Biology. 43, (3), 286-289 (2011).
  24. Chamberlain, G., Fox, J., Ashton, B., Middleton, J. Concise review: mesenchymal stem cells: their phenotype, differentiation capacity, immunological features, and potential for homing. Stem Cells. 25, (11), 2739-2749 (2007).
  25. Abdallah, B. M., Alzahrani, A. M., Abdel-Moneim, A. M., Ditzel, N., Kassem, M. A simple and reliable protocol for long-term culture of murine bone marrow stromal(mesenchymal) stem cells that retained their in vitro and in vivo stemness in long-term culture. Biology Proceedings Online. 21, 3 (2019).
Isolierung und Kultivierung von MandibularKnochenmark Mesenchymal Stammzellen bei Ratten
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Hong, Y., Xu, H., Yang, Y., Zhou, S., Jin, A., Huang, X., Dai, Q., Jiang, L. Isolation and Cultivation of Mandibular Bone Marrow Mesenchymal Stem Cells in Rats. J. Vis. Exp. (162), e61532, doi:10.3791/61532 (2020).More

Hong, Y., Xu, H., Yang, Y., Zhou, S., Jin, A., Huang, X., Dai, Q., Jiang, L. Isolation and Cultivation of Mandibular Bone Marrow Mesenchymal Stem Cells in Rats. J. Vis. Exp. (162), e61532, doi:10.3791/61532 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter