This article presents a method that combines whole bone marrow adherence and flow cytometry sorting for isolating, cultivating, sorting, and identifying bone marrow mesenchymal stem cells from rat mandibles.
Here we present an efficient method for isolating and culturing mandibular bone marrow mesenchymal stem cells (mBMSCs) in vitro to rapidly obtain numerous high-quality cells for experimental requirements. mBMSCs could be widely used in therapeutic applications as tissue engineering cells in case of craniofacial diseases and cranio-maxillofacial regeneration in the future due to the excellent self-renewal ability and multi-lineage differentiation potential. Therefore, it is important to obtain mBMSCs in large numbers.
In this study, bone marrow was flushed from the mandible and primary mBMSCs were isolated through whole bone marrow adherent cultivation. Furthermore, CD29+CD90+CD45− mBMSCs were purified through fluorescent cell sorting. The second generation of purified mBMSCs were used for further study and displayed potential in differentiating into osteoblasts, adipocytes, and chondrocytes. Utilizing this in vitro model, one can obtain a high number of proliferative mBMSCs, which may facilitate the study of the biological characteristics, the subsequent reaction to the microenvironment, and other applications of mBMSCs.
Bone marrow mesenchymal stem cells (BMSCs) are non-hematopoietic stem cells derived from bone marrow that manifest strong proliferation capability and multi-lineage differentiation potential1,2,3,4. Indeed, BMSCs have been considered as an ideal candidate for bone tissue engineering and regeneration ever since they were discovered. For years, the iliac crest or long bones such as the tibia and femur have been the most common source of BMSCs for craniofacial regeneration. However, orofacial BMSCs, such as mandibular BMSCs (mBMSCs), display some differences from long bone BMSCs, such as different embryonic origin and development pattern. Mandibles arise from neural crest cells of the neuroectoderm germ layer and undergo intramembranous ossification, while axial and appendicular skeletons are from the mesoderm and undergo endochondral ossification. Furthermore, clinical observations and experimental animal studies have consistently indicated that there are functional differences between orofacial and iliac crest BMSCs5,6,7,8. Reports have shown that BMSCs derived from craniofacial bone such as mandible, maxillary bone, and alveolar bone exhibited superior proliferation, life span, and differentiation capability than those from axial and appendicular bones9. mBMSCs, therefore, are considered to be the preferred resources for future therapeutic applications of craniofacial diseases such as cherubism, jaw tumor, osteoporosis of jaw bone, and periodontal tissue defect10,11,12. To understand the treatment potential in preclinical experiments, it is essential to establish a method for rapidly isolating and culturing mBMSCs in vitro.
In this study, the aim was to obtain purified mBMSCs by whole bone marrow adherence and flow cytometry sorting. The anatomical morphology of rat mandible, clearly observed through micro computed tomography (Micro-CT) and histological sections, showed that the trabecular bone of the mandible was between the incisor medullary space and the alveolar bone. The bone marrow from trabecular bone was flushed to obtain mandibular marrow cells, but the cells cultured in this way were not pure mBMSCs and were likely to consist of multiple types of cells with uncertain potencies and diverse lineages such as cells from bone, fat and endothelial cells13,14. The next step of cell purification was particularly important. Flow cytometry filters cells by recognizing a combination of cell-surface proteins and has been widely adopted in the enrichment of mesenchymal stem cells. Cell homogeneity is the main advantage of flow cytometry, but the process does not determine cell viability and can result in a limited cell yield. In this study, the P0 mBMSCs obtained from whole bone marrow adherence were sorted by flow cytometry to obtain mBMSCs with high purity and strong proliferation capacity.
This study introduces a reproducible and reliable protocol for isolation, culture, and differentiation of rat mandibular BMSCs using a combination of whole bone marrow adherence and flow cytometry sorting. It is a reliable and convenient method for researchers in related fields to use.
All animal experimental procedures in this paper were approved by the Animal Care Committee of Shanghai Ninth People's Hospital, Shanghai Jiao Tong University School of Medicine.
1. Preparation
2. Isolation and cultivation of rat mBMSCs
NOTE: All experimental operations should be performed on ice as much as possible to maintain cell viability.
3. Colony formation capability
NOTE: This step was performed to check for the division ability of mBMSCs.15
4. Multilineage differentiation of mBMSCs
NOTE: The P2 mBMSCs were used for subsequent experiments unless otherwise described.
5. Real-time PCR
Using this protocol, a large proportion of cells adhered to the plate on the third day after the initial culture. Typically, after an additional 3-4 days of culture, the cell confluence reached to 70 to 80% (Figure 1B). With fluorescent cell sorting, DAPI–CD29+CD90+CD45− mBMSCs were purified18,22, which accounted for about 81.1% in the P0 cells (Figure 1C).
After seeding P2 mBMSCs at 100 cells in each well of 6 well plate for a week, a significant amount of colony forming units were observed, which suggested the significant colony forming capability of mBMSCs (Figure 1D).
To assess the multi-lineage differentiation ability, the mBMSCs were induced into osteo-, chondro- and adipo-lineages, respectively, in 12 well plates. The mBMSCs displayed strong osteogenic differentiation capability. Increased activity of ALP, red calcific nodules distributed sporadically under alizarin red staining, and increased expression of osteogenic specific genes Runx2, Alp, Bsp and Ocn (Figure 2) indicated oestogenic induction. For adipogenesis, identified by Oil-red-O staining, numerous lipid-rich vacuoles were evident after 9 days of induction. Likewise, the expression of adipogenic specific genes Pparγ1 and Cebpa showed a significant increase (Figure 3). For microscopic observation of chondrogenic differentiation slides, the samples showed positive staining for Alcian blue. In addition, immunostaining with anti-type II collagen antibody showed enhanced accumulation of cartilage matrix (Figure 4).
Culture Medium | Component | Final Concentration |
1.α-MEM culture medium(with 10%FBS) | α-minimum essential medium | |
Fetal bovine serum | 10% | |
Penicillin and streptomycin | 1% | |
2.Osteogenic induction medium | α-MEM culture medium(with 10%FBS) | 70% |
Osteogenic differentiation differentiation medium | 30% | |
3.Osteogenic differentiation medium | Osteogenic differentiation basal medium | |
Fetal bovine serum | 10% | |
Glutamine | 1% | |
Penicillin-Streptomycin | 1% | |
Ascorbic acid | 0.20% | |
β-Glycerophosphate | 1% | |
Dexamethasone | 0.01% | |
4.Adipogenic differentiation medium A | Adipogenic differentiation basal medium | |
Fetal bovine serum | 10% | |
Glutamine | 1% | |
Penicillin-Streptomycin | 1% | |
Insulin | 0.20% | |
IBMX | 0.10% | |
Rosiglitazone | 0.10% | |
Dexamethasone | 0.01% | |
5.Adipogenic differentiation medium B: | Adipogenic differentiation basal medium | |
Fetal bovine serum | 10% | |
Glutamine | 1% | |
Penicillin-Streptomycin | 1% | |
Insulin | 0.20% | |
6.Chondrogenic differentiation medium: | Chondrogenesis differentiation basial medium | |
Dexamethasone | 0.01% | |
Ascorbic acid | 0.30% | |
ITS | 1% | |
Sodium pyruvate | 0.10% | |
Proline | 0.10% | |
TGF-β3 | 1% |
Table 1: Components of culture medium and differentiation medium.
Antibody | Concentration |
CD90.1 (Thy-1.1) Monoclonal Antibody | 0.5mg/mL |
CD45 Monoclonal Antibody | 0.2mg/mL |
CD29 Antibody | 0.2mg/mL |
CollagenII rabbit polyclonal antibody | 5mg/mL |
Goat Anti-Rabbit IgG H&L (Alexa Fluor® 488) | 1mg/mL |
Table 2: Antibody concentration used in this study.
Primer | Sequence(5' to 3') | |
GAPDH | Foward: CGGCAAGTTCAACGGCACAGTCAAGG | |
Reverse: ACGACATACTCAGCACCAGCATCACC | ||
Runx2 | Foward: GCCTTCAAGGTTGTAGCCCT | |
Reverse: TGAACCTGGCCACTTGGTTT | ||
ALP | Foward: AAACTCGCTTATGGTCCCCG | |
Reverse: TGGGTTTGAATTCCTGCGGT | ||
BPS | Foward: GCACGGTTGAGTATGGGGAA | |
Reverse: ATCCTGACCCTCGTAGCCTT | ||
Ocn | Forward:CAACCCCAATTGTGACGAGC | |
Reverse:GGCAACACATGCCCTAAACG | ||
Cebpa | Foward: AGTCGGTGGATAAGAACAGCAACG | |
Reverse: CGGTCATTGTCACTGGTCAACTCC | ||
Pparγ1 | Foward: CCATCGAGGACATCCAAGACAACC | |
Reverse: GTGCTCTGTGACAATCTGCCTGAG |
Table 3: Primers used in Real-time PCR.
Figure 1: Isolation and culture of mBMSCs. (A) Schematic diagram of the protocol. mBMSCs were isolated and plated on day 0 and incubated with α-MEM culture medium. On day 7, the P0 mBMSCs were purified through flow cytometry sorting and the sorted cells were plated on a new culture dish. On day 14, P1 mBMSCs were collected and plating on 12-well plate. On day 15, P2 mBMSCs were induced into osteoblasts, adipogenic cells and chondroblasts under corresponding induction medium. (B) Schematic model of rat mandibular bone marrow and microscopic observation of P0 mBMSCs. (C) Flow cytometry sorting of rat mBMSCs. The flow cytometry analysis shows these cells were positive for CD29 and CD90, but negative for CD45, which is congruent with BMSC characteristics. Of these, 1.4 x 106 cells were sorted, which accounted for appropriately 80% of the total cells. (D) Representative image of crystal violet stained P2 mBMSC clones. Please click here to view a larger version of this figure.
Figure 2: Osteogenic differentiation potential of mBMSCs. (A) After 7 days of osteogenic induction, the change of ALP activity was visualized. Large numbers of mineralized nodules were stained under alizarin red staining at 14 days after induction of osteogenic differentiation. (B,C) The positive area of ALP and alizarin red staining were evaluated using Image J software. (C-G) The mRNA expression of osteoblast-specific markers Runx2, Alp, Bsp and Ocn increased significantly after 7 days of osteogenesis. Please click here to view a larger version of this figure.
Figure 3: Adipogenic differentiation potential of mBMSCs after nine days of induction. (A) A large quantity of lipid droplets form and adipocytes were stained by oil-red-O. (B,C) The mRNA expression of adipogenic markers Cebpa and Pparγ1 increased remarkably after 9 days of adipogenesis. Please click here to view a larger version of this figure.
Figure 4: Stereoscope view of chondrogenic differentiation effect. (A) mBMSCs after 21 days chondrogenic induction showed positive for alcian blue staining. (B) Immunofluorescence image of chondrogenic aggregate stained with anti-type II collagen. Please click here to view a larger version of this figure.
This protocol describes a method to isolate BMSCs from rat mandibles in vitro by combining whole bone marrow adherence and fluorescent cell sorting, which is a simple and reliable way to obtain proliferative mBMSCs with strong differentiation ability. This method could preliminarily purify mBMSCs by flow cell sorting, but if there are higher requirements for cell homogeneity, more precise purification methods may be required.
Currently, there are four main techniques used for isolating mBMSCs, including whole bone marrow adherence, density gradient centrifugation, fluorescent cell sorting and magnetic activated cell sorting22. Whole bone marrow adherence and density gradient centrifugation are the most common and easy methods used to obtain mBMSCs in a short time, however, the low purity of harvested mBMSCs is their main disadvantage. The last two methods can isolate highly purified mBMSCs through immunological techniques, but have the shortcomings of being expensive, taking long time and impaired cell viability. In this study the advantages of whole bone marrow adherence and the fluorescent cell sorting method were combined to obtain enough numbers of proliferative mBMSCs in a short time.
Doubtlessly, one of the most critical steps in this protocol is dissection of rat mandible, which is quite distinct from those of axial and appendicular bones. It is essential to understand the anatomy of rat mandible to obtain an intact sample. Similar to human, rat mandible sits beneath the maxilla, holds the lower teeth in place and is connected to the skull by bilateral condyles. Since the mandible is the only bone that can move in the skull, there are many muscles attached to mandible, which control its movement. Only by removing these soft tissues completely and turning the mouth open maximally can the condyles connecting with the skull be exposed. It is also worth mentioning that the condylar neck is a physical weakness in mandible and is easy to fracture. If excessive resistance is found when rotating the mandible downwards, it means that the masticatory muscles may not been completely removed. When this is observed, do not rotate it constrainedly, otherwise it is easy to break the condylar neck thereby leading to cell contamination. Other difficulties in separation and culture of mBMSCs include low content in bone marrow, delicate cell activity, low purity, low cell frequency and contamination of hematopoietic cells18,23. To obtain mBMSCs with good growth and relatively high differentiation potential, ensuring the activity of mBMSCs is of crucial importance. There are several key steps, including the use of four-week old rats for this and subsequent experiments, as young rats are preferred to maintain good viability. Many studies have confirmed that the activity of mBMSCs is related to the age of experimental animals. Those mBMSCs from older donors may result in lower proliferation activity, differentiation potential and life span2. All the operations during cell harvest need to be completed on ice and the operation time should be as short as possible, preferably within 2 hours. In addition, keep the trypsin digestion time no longer than 3 minutes. Finally, still another challenge in this protocol is the process of harvesting mBMSCs. It may be troublesome to flush mBMSCs from the bone cavity because the cavity of rat mandible is very small, so it is very important to be familiar with the anatomical structure. Micro-CT images can be of great help in this regard. Besides, it is worth noting that as juvenile bones are slender and brittle, breakage can result in contamination.
Referring to immunophenotypic characterization, BMSCs express several phenotypes, but none of which is specific to them24. It is generally accepted that BMSCs do not express CD11b, CD14, CD34, or CD45, but they have a high expression of Sca-1, CD29, CD90, and CD105. This study chose the widely accepted markers of CD29, CD90, and CD45 for fluorescent cell sorting13,14,25. It found that CD29+CD90+CD45− cell accounted for appropriately 80% of total cells, which was enough for subsequent cell culture and research.
For decades, stem cell therapy is widely used in the treatment of various diseases, such as immune system diseases, hematological systemic diseases, cancers, or trauma. Undoubtedly, mBMSCs, as a substitute for BMSCs, can be used as a safer and more powerful tool in stem cell therapy due to their superior characteristics. Cell culture and expansion of mBMSCs, therefore, become particularly important to obtain sufficient number of cells for treatment.
In summary, this study demonstrated a promising and reliable protocol to harvest abundant mBMSCs with high homogeneity and multi-differentiation capability in a short period of time.
The authors have nothing to disclose.
We thank for the assistance of Laboratory for Digitized Stomatology and Research Center for Craniofacial Anomalies of Shanghai Ninth People's Hospital. The work of this manuscript is supported by grants from the National Natural Science Foundation of China (NSFC) [81570950,81870740,81800949], Shanghai Summit & Plateau Disciplines, the SHIPM-mu fund from Shanghai Institute of Precision Medicine, Shanghai Ninth People's Hospital, Shanghai Jiao Tong University School of Medicine [JC201809], the Incentive Project of High-level Innovation Team for Shanghai Jiao Tong University School of Medicine. And L.J. is a scholar of the Outstanding Youth Medical Talents, Shanghai "Rising Stars of Medical Talent" Youth Development Program and the “Chen Xing” project from Shanghai Jiaotong University.
0.25% Trypsin-EDTA(1X) | Gibco | 25200072 | |
10cm culture dish | Corning | ||
acutenaculum | |||
Adipogenic differentiation medium | Cyagen biosciences inc. | MUBMX-90031 | |
Alcian Blue | Beyotime Biotechnology | ||
Alizarin red | Sigma-Aldrich | A5533 | |
Alkaline Phosphatase Color Development Kit | Beyotime Biotechnology | C3206 | |
alpha-Minimum essential medium | GE Healthcare HyClone Cell Culture | SH30265.01B | |
Anti -CollagenII Rabbit pAb | Abcam | ab34712 | |
Antibodies against CD16/CD32 | |||
Antifade Mounting Medium with DAPI | Beyotime Biotechnology | P0131 | |
APC anti-mouse/rat CD29 Antibody | biolegend inc | 102215 | |
Biosafety cabinet | Esco | AC2-4S8-CN | |
CD45 Monoclonal Antibody (OX1), PE, eBioscience | Invitrogen | 12-0461-82 | |
CD90.1 (Thy-1.1) Monoclonal Antibody (HIS51), FITC, eBioscience | Invitrogen | 11-0900-85 | |
Centrifuge | cence | L500 | |
Chondrogenesis differentiation medium | cyagen biosciences inc. | ||
Confocal laser scanning microscope | Zeiss | LSM880 | |
Countess II FL Automated Cell Counter | Invitrogen | AMQAF1000 | |
Crystal Violet Staining Solution | Beyotime Biotechnology | C0121 | |
Fetal Bovine Serum | GE Healthcare HyClone Cell Culture | SH30084.03 | |
Goat Anti-Rabbit IgG H&L (Alexa Fluor 488) | abcam | ab150077 | |
Incubator | Esco | CCL-170B-8 | |
Inverted microscope | olympus | CKX53 | |
Magzol reagent(Trizol reagent) | Magen | ||
micropipettor | Eppendorf | ||
Oil Red O | |||
Osteogenic differentiation medium | cyagen biosciences inc. | MUBMX-90021 | |
Penicillin-Streptomycin | Gibco | 15070063 | |
Phosphate-buffered saline(1X) | Gibco | 20012027 | |
PrimeScript RT Master Kit | TakaRa Bio Inc | RR036A | |
Proteinase K | Sigma-Aldrich | P6556 | |
QuickBlock Blocking Buffer | Beyotime Biotechnology | P0260 | |
scissor | |||
SYBR1 Premix | TakaRa Bio Inc | ||
Toluidine Blue | Beyotime Biotechnology | ||
Trypan Blue Solution, 0.4% | Gibco | 15250061 |