Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

Aislamiento Y Cultivo De Células Madre Mesenquimales De Médula Ósea Mandibular En Ratas

doi: 10.3791/61532 Published: August 25, 2020
* These authors contributed equally

Summary

Este artículo presenta un método que combine la adherencia entera de la médula y el flujo cytometry que clasifica para aislar, cultivar, clasificar, e identificar las células madres mesenquimales de la médula de las mandíbulas de la rata.

Abstract

Aquí presentamos un método eficiente para aislar y cultivar células madre mesenquimales de médula ósea mandibular (mBMSCs) in vitro para obtener rápidamente numerosas células de alta calidad para los requisitos experimentales. Los mBMSCs podrían ser ampliamente utilizados en aplicaciones terapéuticas como células de ingeniería de tejidos en caso de enfermedades craneofaciales y regeneración craneo-maxilofacial en el futuro debido a la excelente capacidad de autorre renovación y potencial de diferenciación multi-linaje. Por lo tanto, es importante obtener mBMSCs en grandes cantidades.

En este estudio, la médula fue limpiada con un chorro de agua de la mandíbula y los mBMSCs primarios fueron aislados con la cultivación adherente entera de la médula. Además, CD29+CD90+CD45 mBMSCs fueron purificados a través de la clasificación de células fluorescentes. La segunda generación de mBMSCs purificados fue utilizada para el estudio adicional y exhibió potencial en el distinción en osteoblasts, adipocytes, y chondrocytes. Utilizando este modelo in vitro, se puede obtener un alto número de mBMSCs proliferativos, lo que puede facilitar el estudio de las características biológicas, la reacción posterior al microambiente y otras aplicaciones de los mBMSCs.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Las células madre mesenquimales de médula ósea (BMSCs) son células madre no hematopoyéticas derivadas de la médula ósea que manifiestan una fuerte capacidad de proliferación y un potencial de diferenciación de múltipleslinajes 1,2,3,4. De hecho, los BMSCs han sido considerados como un candidato ideal para la ingeniería y regeneración de tejidos óseos desde que fueron descubiertos. Durante años, la cresta ilíaca o los huesos largos como la tibia y el fémur han sido la fuente más común de BMSCs para la regeneración craneofacial. Sin embargo, los BMSCs orofaciales, como los BMSCs de la mandíbula (mBMSCs), muestran algunas diferencias de los BMSCs de hueso largo, como el origen embrionario diferente y el patrón de desarrollo. Las mandíbulas surgen de las células neurales de la cresta de la capa germinal del neuroectodermo y se someten a la osificación intramembranosa, mientras que los esqueletos axiales y apendiculares son del mesodermo y se someten a la osificación endocondral. Además, las observaciones clínicas y los estudios experimentales en animales han indicado consistentemente que existen diferencias funcionales entre la cresta orofacial e ilíaca BMSCs5,6,7,8. Los informes han demostrado que los BMSCs derivados del hueso craneofacial, como la mandíbula, el hueso maxilar y el hueso alveolar, exhibieron una proliferación, una vida y una capacidad de diferenciación superiores a las de los huesos axiales y apendiculares9. Los mBMSCs, por lo tanto, se consideran los recursos preferidos para futuras aplicaciones terapéuticas de enfermedades craneofaciales como el querubismo, el tumor de mandíbula, la osteoporosis del hueso de la mandíbula y el defecto del tejido periodontal10,11,12. Para entender el potencial del tratamiento en experimentos preclínicos, es esencial establecer un método para aislar y cultivar rápidamente mBMSCs in vitro.

En este estudio, el objetivo fue obtener mBMSCs purificados por adherencia de médula ósea entera y clasificación por citometría de flujo. La morfología anatómica de la mandíbula de la rata, observada claramente con la tomografía computada micro (Micro-CT) y las secciones histológicas, demostró que el hueso trabecular de la mandíbula estaba entre el espacio medular de la incisivo y el hueso alveolar. La médula ósea del hueso trabecular se enjuagaba para obtener células de médula mandibular, pero las células cultivadas de esta manera no eran mBMSCs puros y eran susceptibles de consistir en múltiples tipos de células con potencias inciertas y diversos linajes como células de células óseas, grasas y endoteliales13,14. El siguiente paso de la purificación celular fue particularmente importante. La citometría de flujo filtra las células mediante el reconocimiento de una combinación de proteínas de la superficie celular y ha sido ampliamente adoptada en el enriquecimiento de las células madre mesenquimales. La homogeneidad celular es la principal ventaja de la citometría de flujo, pero el proceso no determina la viabilidad celular y puede resultar en un rendimiento celular limitado. En este estudio, los mBMSCs P0 obtenidos de la adherencia entera de la médula fueron clasificados por cytometry de flujo para obtener los mBMSCs con alta pureza y capacidad fuerte de la proliferación.

Este estudio introduce un protocolo reproducible y confiable para el aislamiento, la cultura, y la diferenciación de la mandíbula BMSCs de la rata usando una combinación de adherencia entera de la médula y de la clasificación cytometry de flujo. Es un método confiable y conveniente para que los investigadores en campos relacionados lo usen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Todos los procedimientos experimentales en animales en este documento fueron aprobados por el Comité de Cuidado Animal del Noveno Hospital Popular de Shanghai, Facultad de Medicina de la Universidad Jiao Tong de Shanghai.

1. Preparación

  1. Use dos ratas Sprague Dawley machos de 5 semanas de edad para el experimento.
  2. Esterilizar todos los instrumentos, incluyendo porta agujas, pinzas y tijeras a alta temperatura o sumergidos en etanol al 75% durante 10 min.
    NOTA: La inmersión en etanol no debe ser demasiado larga para evitar el daño celular.
  3. Preparar previamente los medios de cultivo, cuya composición figura en el cuadro 1. Complemente cada medio como se describe a continuación.
    1. Preparación del medio de cultivo α-MEM (con 10% de FBS): Complementar el medio mínimo esencial alfa (α-MEM) con suero fetal bovino al 10% y al 1% de penicilina y estreptomicina.
    2. Preparación del medio de diferenciación osteogénico: Suplemento de diferenciación osteogénica del medio basal con suero bovino fetal al 10%, 1% glutamina, 1% penicilina-estreptomicina, ácido ascórbico al 0,20%, 1% β-glicerofosfato y dexametasona al 0,01%.
    3. Preparación de medio de inducción osteogénico: Mezclar 70% α-MEM medio de cultivo (con 10% FBS) y 30% medio de diferenciación osteogénica.
    4. Preparación del medio de diferenciación adipogénico A: Complementar el medio basal de diferenciación adipógena con suero fetal bovino al 10%, 1% glutamina, 1% penicilina-estreptomicina, 0,20% insulina, 0,10% IBMX, 0,10% Rosiglitazona y 0,01% Dexametasona.
    5. Preparación del medio de diferenciación adipogénico B: complementar la diferenciación adipógena del medio basal con suero fetal bovino al 10%, glutamina al 1%, penicilina-estreptomicina al 1% e insulina al 0,20%.
    6. Preparación del medio de diferenciación condrógena: Suplemento de diferenciación condrogénica del medio basal con 0,01% de dexametasona, 0,30% de ácido ascórbico, 1% its, 0,10% de piruvato de sodio, 0,10% de prolina y 1% de TGF-β3.
      NOTA: El medio de diferenciación osteogénica debe utilizarse dentro de un mes después de la configuración. El período efectivo del medio de diferenciación condrogénica configurado es de 12 h.

2. Aislamiento y cultivo de mBMSCs de rata

NOTA: Todas las operaciones experimentales deben realizarse en hielo tanto como sea posible para mantener la viabilidad celular.

  1. Cosecha de mandíbulas de rata
    1. Euthanize dos ratas masculinas de 5 semanas sprague Dawley por la asfixia delCO2. Asegúrese de que la respiración del animal se detiene antes de continuar con el experimento.
    2. Enjuague estas ratas en un casto que contenga etanol al 75% durante 3 min.
    3. Coloque la rata dentro de una campana extractora de humos limpia para cosechar mandíbulas.
      NOTA: Esterilice la campana extractora de humos mediante radiación de luz ultravioleta durante 30 minutos antes de su uso.
    4. Coloque a la rata en decúbito supino. Incise las pieles y los músculos buccinadores de los oris bilaterales del angulus a la región posterior de la mandíbula, que es el único hueso móvil con la incisivo más baja.
      NOTA: Se recomienda hacer una incisión de 2 cm a cada lado del oris angulus para obtener un campo de operación claro.
    5. Abra la boca de la rata empujando los incisivos maxilares y mandibulares hacia la dirección opuesta con ambos pulgares para exponer los dientes mandibulares, que están unidos a la mandíbula.
    6. Desconecte completamente los músculos bucales y los tendones unidos a los coracoides y el borde inferior de la mandíbula.
      NOTA: Se observa una mayor movilidad de la mandíbula durante este paso debido a la falta de tensión muscular.
    7. Presione los dientes posteriores mandibulares y gire hacia atrás y hacia abajo hasta que los cóndilos en ambos lados estén claramente expuestos.
      NOTA: Este paso se realiza para abrir artificialmente la boca de la rata en la máxima medida posible para dislocar el cóndilo. La mandíbula está conectada al cráneo a través de cóndilos bilaterales, por lo que la exposición de los cóndilos conduce a la desconexión entre el cráneo y la mandíbula.
    8. Separe el cuerpo de la mandíbula del cráneo.
    9. Limpie el tejido blando adherente en la superficie ósea con una gasa húmeda.
    10. Coloque el hueso en un plato de vidrio estéril de 10 cm lleno de α medio esencial mínimo preenfriado (α-MEM) o solución salina tampón de fosfato (PBS) sobre hielo para preservar la viabilidad.
  2. Aislamiento y cultivo de los mBMSCs
    1. Cortar el hueso anterior a lo largo del borde mesial del primer molar del cuerpo mandibular. Retire el ramo mandibular incluyendo el coracoides y el cóndilo a lo largo del borde distal del tercer molar para exponer la cavidad de la médula.
    2. Llene un plato de vidrio estéril de 10 cm con 10 mL de α-MEM (con 10% de FBS).
    3. Use jeringa de 1 ml para aspirar α-MEM. Con la aguja de la jeringa insertada en la cavidad de la médula ósea, enjuague repetidamente la médula ósea en el plato. Enjuague la cavidad ósea al menos 3 veces desde los lados mesial y distal del hueso, respectivamente, hasta que el hueso se volviera blanco.
      NOTA: Este es el paso más crítico, ya que la cavidad de la médula ósea de una mandíbula de rata no es tan obvia como en el hueso largo y el punto adecuado para insertar la aguja debe determinarse empíricamente. Todas las muestras experimentales anteriores deben almacenarse en hielo para mantener la viabilidad de la célula y, por lo tanto, el tiempo de operación no debe ser superior a 2 h.
    4. Transfiera el medio que contiene las células enjuagadas a un tubo centrífuga de 15 mL y la centrífuga a 800 x g en 4 °C durante 5 min. Deseche el sobrenadante.
    5. Resuspend las células con 3 mL de α-MEM (con FBS del 10%). Platear las células en un nuevo plato de cultivo de 10 cm e incubar a 37 °C en una incubadora de CO2 al 5%.
    6. Compruebe los cambios morfológicos y el crecimiento de estas células en el 3er día de cultivo. Retire el medio de cultivo con células no acomodantes y fragmentos de tejido. Agregue suavemente 10 mL de α-MEM fresco (con 10% de FBS).
    7. Después de 7 días de cultivo, P0 mBMSCs alcanzó 70% a 80% de confluencia.
  3. Ordenación de celdas de flujo
    NOTA: P0 mBMSCs fueron identificados fenotípicamente y purificados sobre todo con la clasificación de la célula del flujo.
    1. Aspirar y desechar el medio de cultivo y luego lavar el plato con PBS. Descarte el PBS.
    2. Añadir 1 mL de tripsina al 0,25% con EDTA al 0,02% en el plato. Digiera las células a 37 °C durante 5 min, luego agregue 2 mL de α-MEM (con 10% de FBS) para detener la reacción.
    3. Transfiera la suspensión de las células a un tubo centrífuga de 15 mL y la centrífuga a 800 x g durante 5 min.
    4. Resuspend las células en 120 μL de PBS (con el 10% FBS) después de la centrifugación.
    5. Bloquee estas suspensiones celulares con 1 μL de anticuerpo contra CD16/CD32 a 4 °C durante 15 min.
    6. Transferir 100 μL de la suspensión celular en un nuevo tubo de microcentrífuga, teñir las células con Ficoeritrina (PE)-anticuerpo conjugado contra CD45, fluoresceína-isotiocianato (FITC)-anticuerpo conjugado contra CD90 y Aloficianina (APC)-anticuerpo contra CD29 a 4 °C durante 1 h en la oscuridad13,15. La concentración de anticuerpos utilizados en este experimento se muestra en la Tabla 2. Utilice los otros 20 μL de suspensión celular como control negativo no manchado.
    7. Luego centrifugar los tubos a 800 x g durante 5 min, desechar la suspensión y resuspensar las células en 0.5 mL de PBS (con 10% de FBS).
    8. Añadir 10 μL de 0,01 mg/mL DAPI durante 10 min antes del análisis.
    9. Utilice filtros de 40 nm colocados en tubos centrífugos para filtrar las células.
    10. Analice las células en el clasificador de células activado por fluorescencia. Establezca los paneles de la siguiente manera. En primer lugar, eliminar las células muertas de la cuenta celular total por gating DAPI- células, a continuación, puerta CD29+CD90+CD45- en las células seleccionadas como mBMSCs dirigidos.
    11. Recoja las células CD29+CD90+CD45- clasificadas en un tubo de centrífuga de 15 mL con 3 mL de α-MEM (con 10% de FBS) pre-preparado.
    12. Centrifugar los tubos a 800 x g durante 5 min. Quite el buffer de la colección y agregue 1 mL de α-MEM fresco (con el 10% FBS) para resuspend las células. Luego plaéalos en un plato de cultivo de 6 cm.

3. Capacidad de formación de colonias

NOTA: Este paso se realizó para comprobar la capacidad de división de mBMSC. 15.

  1. Seleccione los mBMSCs del segundo paso (P2) para este experimento. Cuando la confluencia celular alcanzó del 80% al 90%, reseseed las células en un gradiente serial en una placa de 6 pozos para evaluar su capacidad clonal de proliferación.
    NOTA: Se recomienda establecer el gradiente de 1 x 102 a 1 x 103 células por pocillo, pero las diluciones finales de diferentes líneas celulares de origen humano o animal se determinaron empíricamente.
  2. Cultíe las células en α-MEM (con el 10% FBS) por aproximadamente dos semanas hasta que un buen número de las unidades formantes de la colonia se pudieran considerar bajo microscopio ligero. Actualice el medio de cultivo cada 3 días.
  3. Aspirar y desechar el medio de cultivo, lavar los pozos con PBS dos veces durante 5 min a la vez. A continuación, agregue la solución de paraformaaldehído al 4% a cada pozo y arregle durante al menos 10 min.
  4. Retire el paraformalido y enjuague los pozos dos veces con PBS.
  5. Manche las células con una solución de tinción de violeta cristalina e incubarlas en 37 °C durante aproximadamente 10 min.
    NOTA: El tiempo de tinción se ajustó adecuadamente hasta que se logre la sombra deseada.
  6. Retire la solución de tinción y lave las muestras con agua destilada para detener la reacción.
  7. Imagen bajo un estereomicroscopio y recuento de colonias celulares dispersas que consistían en al menos 50 células.

4. Diferenciación multilínea de mBMSCs

NOTA: Los mBMSCs P2 se utilizaron para experimentos posteriores a menos que se describa lo contrario.

  1. Inducción osteogénica de mBMSCs
    1. Digiera los mBMSCs como se describió arriba. Células de semilla a una densidad de 2,5 x 105/cm2 en una placa de 12 pozos suplementada con 1 mL α-MEM (con 10% de FBS).
    2. Cuando la confluencia celular alcanzó el 60-70%, cambie el medio en medios de inducción osteogénica al 30%. Cultíe las células con α-MEM (con FBS al 10%) como control negativo y cambie el medio cada 2 días.
      NOTA: Después de que un gran buen número de nódulos de calcio aparezcan durante la osteogénesis, se recomienda cambiar el patrón de intercambio medio a un intercambio medio de medio volumen cada 2 días, para evitar que los osteoblastos flote.
    3. Después de cultivar durante siete días, evaluar la calcificación de estas células por la fosfatasa alcalina tinción16,17.
    4. Retire el medio de cultivo y fije las células con paraformadehído al 4% durante 10 min. Enjuague las células usando 1 mL de PBS por pozo durante 3 min dos veces.
    5. A continuación, mantejen las células con solución de tinción de fosfatasa alcalina e incuben a 37 °C durante 10-30 min.
      NOTA: La incubación se puede realizar durante la noche a temperatura ambiente para obtener el color requerido.
    6. Lave los pozos con agua destilada para detener la reacción. Tome fotografías bajo microscopio de luz. Los gránulos pigmentados rojos representan actividad de la fosfatasa alcalina (MONTAN@A).
    7. Después de cultivar las células restantes durante otros 7 días, realice la tinción de alizarina en rojo para evaluar la capacidad de mineralización de las células.
    8. Manteje las células con una solución de tinción de alizarina al 0,5% después de la fijación celular durante 10 min16,18. Detener la reacción cromógena con agua destilada después de 3-5 min.
      NOTA: El tiempo de reacción se puede ampliar dependiendo del color desarrollado.
    9. Finalmente, coloque la placa de cultivo debajo del microscopio de luz para observar el efecto de la tinción osteogénica; los nódulos rojos indican los depósitos del calcio de estas células.
  2. Inducción adipógena de mBMSCs
    1. Semilla P2 mBMSCs en una placa de 12 pozos como se describió anteriormente.
    2. Después de que el pozo se convierta en 90% confluente, cultivo de las células con medio de diferenciación adipogénico A. Utilice células cultivadas en α-MEM medio de cultivo (con 10% FBS) como control negativo.
    3. Después de 2 días de inducción, aspirar el medio A del pozo y añadir 1 mL de medio de diferenciación adipógena B en cada pozo.
    4. Después de un día, retire el medio B y comience el ciclo de nuevo con el medio A añadido de nuevo en el pozo. Cultíe las células alternativamente usando los medios A y B.
    5. Aplicar el medio de diferenciación A y B alternativamente durante tres ciclos y detectar la adipogénesis de estas células mediante aceite rojo O tinción16,18.
      NOTA: Un montón de gotitas de lípidos redondos y grandes se pueden observar mediante el cultivo de estas células con el medio de diferenciación B durante un adicional de 2 a 3 días.
    6. Retire el medio y fije las células con paraformadehído al 4% durante 10 min. Lave las células con PBS.
    7. Manteje las células con la solución de tinción de O de color rojo aceite e incube a 37 °C durante aproximadamente 3 min.
    8. Retire la solución de tinción y lave los pozos con agua destilada.
    9. Observe la adipogénesis bajo microscopio de luz.
  3. Inducción de la condrogénesis de mBMSCs
    1. Semilla P2 mBMSCs en tubo centrífugo de 15 mL a una densidad de 5 x 105/cm2.
    2. Centrifugar los tubos a 300 x g durante 5 min. Deseche el sobrenadante.
    3. Resuspend las células con 0,5 mL de medio de diferenciación condrogénica. Centrifugar las células a 300 x g durante 5 min.
    4. Afloje la tapa del tubo de la centrífuga e incube a 37 °C en una incubadora de CO2 al 5%. Renueve el medio cada 2 días.
      NOTA: Las células comienzan a peletizar después de 24 h. Se recomienda no mover el tubo de la centrífuga durante 48 h. Tenga cuidado de no aspirar el pellet celular al cambiar el medio.
    5. Después de 21 días de inducción, fije los pellets celulares con paraformadehído al 4%, seguido de deshidratación, incrustación de parafina y seccionamiento.
    6. Después de la desparafinación e hidratación, manche los portaobjetos en solución azul alciano durante al menos 15 min18,19,20,21,luego lave con agua destilada para detener la reacción. Captura las fotografías bajo microscopio de luz.
    7. Para la tinción inmunofluorescente de colágeno tipo II, realice los pasos a continuación.
      1. Incubar los portaobjetos con 5 μg/mL de proteinasa K durante 15 min a 37 °C después de la etapa de desparafinación e hidratación.
      2. Incubar los portaobjetos en tampón de bloqueo durante 1 h a 37 °C.
      3. Aplicar 1 μL de colágeno tipo II anticuerpo en 200 μL de tampón de bloqueo a los portaobjetos e incubar durante la noche a 4 °C.
      4. Al día siguiente, lave los portaobjetos con PBS dos veces e incube con anticuerpos secundarios a 37 °C durante 1 h.
      5. Incubar las rodajas con 40,6-diamidino-2-fenilindol (DAPI) durante 10 min.
    8. Tome fotografías de cada diapositiva bajo microscopia de fluorescencia.

5. PCR en tiempo real

  1. Extraiga el ARN total de mBMSCs usando un reactivo disponible comercialmente basado en el isotiocianato de guanidium.
  2. Realice la transcripción reversa del ARN en la DNA complementaria usando un kit comercialmente disponible. Las condiciones de reacción de la transcripción inversa fueron las siguientes: 65 °C durante 5 min, 37 °C durante 15 min, 85 °C durante 15 s.
  3. Realizar PCR en tiempo real para detectar genes específicos de osteogénesis y adipogénesis utilizando cebadores listados en la Tabla 3. El procedimiento de amplificación por PCR fue el siguiente: 95 °C durante 5 min. 95 °C durante 5 s, 60 °C durante 30 s durante 40 ciclos.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Usando este protocolo, una gran proporción de células se adhirieron a la placa en el tercer día después de la cultura inicial. Típicamente, después de 3-4 días adicionales de cultivo, la confluencia celular alcanzó el 70-80% (Figura 1B). Con la clasificación de células fluorescentes, dapi-CD29+CD90+CD45 mBMSCs fueron purificados18,22, que representaron alrededor del 81,1% en las células P0 (Figura 1C).

Después de sembrar P2 mBMSCs a 100 células en cada pozo de 6 placas de pozo durante una semana, se observó una cantidad significativa de unidades formantes de colonias, lo que sugirió la capacidad significativa de formación de colonias de mBMSCs(Figura 1D).

Para determinar la capacidad de la diferenciación del multi-linaje, los mBMSCs fueron inducidos en osteo, chondro- y adipo-linajes, respectivamente, en 12 placas bien. Los mBMSCs exhibieron capacidad osteogénica fuerte de la diferenciación. El aumento de la actividad de la ALP, los nódulos calcíficos rojos distribuidos esporádicamente bajo la tinción roja de alizarina, y el aumento de la expresión de los genes específicos osteogénicos Runx2, Alp, Bsp y Ocn (Figura 2)indicaron inducción estetogénica. Para el adipogenesis, identificado por la coloración aceite-rojo-O, las vacuolas lípido-ricas numerosas eran evidentes después de 9 días de inducción. Asimismo, la expresión de genes específicos adipogénicos Pparγ1 y Cebpa mostró un aumento significativo (Figura 3). Para la observación microscópica de las diapositivas condrogénicas de la diferenciación, las muestras demostraron la coloración positiva para el azul de Alcian. Además, la inmunotensación con anticuerpos anti-colágeno tipo II mostró una mayor acumulación de la matriz del cartílago (Figura 4).

medio de cultivo componente Concentración Final
1.α-MEM (con 10% FBS) α-mínimo esencial
Suero fetal bovino 10%
Penicilina y estreptomicina 1%
2.Medio de inducción osteogénica α de cultivo de MEM (con 10% FBS) 70%
Medio de diferenciación osteogénica de diferenciación 30%
3.Medio de diferenciación osteogénica Medio basal de diferenciación osteogénica
Suero fetal bovino 10%
glutamina 1%
Penicilina-Estreptomicina 1%
ácido ascórbico 0.20%
β-Glicerofosfato 1%
dexametasona 0.01%
4.Medio de diferenciación adipogénico A Medio basal de diferenciación adipógena
Suero fetal bovino 10%
glutamina 1%
Penicilina-Estreptomicina 1%
insulina 0.20%
IBMX 0.10%
Rosiglitazona 0.10%
dexametasona 0.01%
5.Medio de diferenciación adipogénico B: Medio basal de diferenciación adipógena
Suero fetal bovino 10%
glutamina 1%
Penicilina-Estreptomicina 1%
insulina 0.20%
6.Medio de diferenciación condrogénico: Medio basial de diferenciación de condrogénesis
dexametasona 0.01%
ácido ascórbico 0.30%
su 1%
Piruvato de sodio 0.10%
prolina 0.10%
TGF-β3 1%

Tabla 1: Componentes del medio de cultivo y medio de diferenciación.

anticuerpo concentración
CD90.1 (Thy-1.1) Anticuerpo monoclonal 0,5 mg/mL
CD45 Anticuerpo monoclonal 0,2 mg/mL
Anticuerpo CD29 0,2 mg/mL
Anticuerpo policlonal de conejo CollagenII 5mg/mL
Cabra Anti-Conejo IgG H&L (Alexa Fluor® 488) 1mg/mL

Tabla 2: Concentración de anticuerpos utilizada en este estudio.

cebador Secuencia(5' a 3')
GAPDH Foward: CGGCAAGTTCAACGGCACAGTCAAGG
Reverso: ACGACATACTCAGCACCAGCATCACC
Runx2 Foward: GCCTTCAAGGTTGTAGCCCT
Reverso: TGAACCTGGCCACTTGGTTT
Alp Foward: AAACTCGCTTATGGTCCCCG
Invertir: TGGGTTTGAATTCCTGCGGT
bps Foward: GCACGGTTGAGTATGGGGAA
Reverso: ATCCTGACCCTCGTAGCCTT
Ocn Adelante:CAACCCCAATTGTGACGAGC
Reverso:GGCAACACATGCCCTAAACG
Cebpa Foward: AGTCGGTGGATAAGAACAGCAACG
Invertir: CGGTCATTGTCACTGGTCAACTCC
Pparγ1 Foward: CCATCGAGGACATCCAAGACAACC
Reverso: GTGCTCTGTGACAATCTGCCTGAG

Tabla 3: Cebadores utilizados en PCR en tiempo real.

Figure 1
Figura 1: Aislamiento y cultivo de mBMSCs. (A) Diagrama esquemático del protocolo. Los mBMSCs fueron aislados y plateados el el día 0 e incubados con el medio de cultivo α-MEM. El el día 7, los mBMSCs P0 fueron purificados con la clasificación cytometry de flujo y las células clasificadas fueron plateadas en un nuevo plato de la cultura. El el día 14, los mBMSCs P1 fueron recogidos y la galjanoplastia en la placa de 12 pozos. El el día 15, P2 mBMSCs fue inducido en osteoblasts, células adipogenic y chondroblasts bajo medio de inducción correspondiente. (B)Modelo esquemático de médula ósea mandibular de rata y observación microscópica de P0 mBMSCs. (C) Clasificación por citometría de flujo de mBMSCs de rata. El análisis citométrico de flujo muestra que estas células fueron positivas para CD29 y CD90, pero negativas para CD45, que es congruente con las características de BMSC. De éstos, 1,4 x 106 células fueron clasificadas, que explicaron apropiadamente el 80% de las células totales. (D) Imagen representativa de los clones de MBMSC de P2 teñidos de violeta cristalina. Haga clic aquí para ver una versión más amplia de esta figura.

Figure 2
Figura 2: Potencial de diferenciación osteogénica de mBMSCs. (A)Después de 7 días de inducción osteogénica, el cambio de la actividad de la MONTAN@A fue visualizado. Una gran cantidad de nódulos mineralizados fueron manchados bajo coloración roja del alizarin en 14 días después de la inducción de la diferenciación osteogénica. b,c) El área positiva de la ALP y de la coloración roja del alizarin fue evaluada usando software de la imagen J. (C-G) La expresión del mRNA de los marcadores osteoblast-específicos Runx2, montan@a, Bsp y Ocn aumentó perceptiblemente después de 7 días de osteogénesis. Haga clic aquí para ver una versión más amplia de esta figura.

Figure 3
Figura 3: Potencial de diferenciación adipógena de mBMSCs después de nueve días de inducción. (A)Se forma una gran cantidad de gotitas lipídicas y los adipocitos fueron teñidos por aceite-rojo-O. b,c) La expresión de ARNm de los marcadores adipogénicos Cebpa y Pparγ1 aumentó notablemente después de 9 días de adipogénesis. Haga clic aquí para ver una versión más amplia de esta figura.

Figure 4
Figura 4: Vista estereoscopio del efecto de diferenciación condrógena. (a)los mBMSCs después de 21 días de inducción condrogénica demostraron el positivo para la coloración azul alcian. (B)Imagen de inmunofluorescencia de agregado condrogénico teñido con colágeno anti-tipo II. Haga clic aquí para ver una versión más amplia de esta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Este protocolo describe un método para aislar BMSCs de mandíbulas de la rata in vitro combinando adherencia entera de la médula y la clasificación fluorescente de la célula, que es una manera simple y confiable de obtener mBMSCs proliferativos con capacidad fuerte de la diferenciación. Este método podría purificar preliminarmente mBMSCs por la clasificación de células de flujo, pero si hay requisitos más altos para la homogeneidad celular, se pueden requerir métodos de purificación más precisos.

Actualmente, existen cuatro técnicas principales utilizadas para aislar los mBMSC, incluyendo la adherencia a toda la médula ósea, la centrifugación del gradiente de densidad, la clasificación de células fluorescentes y la clasificación magnética de células activadas22. La adherencia de la médula ósea entera y la centrifugación del gradiente de densidad son los métodos más comunes y fáciles utilizados para obtener mBMSCs en poco tiempo, sin embargo, la baja pureza de los mBMSCs cosechados es su principal desventaja. Los dos últimos métodos pueden aislar mBMSCs altamente purificados a través de técnicas inmunológicas, pero tienen las deficiencias de ser costosos, tomar mucho tiempo y deteriorar la viabilidad celular. En este estudio las ventajas de la adherencia entera de la médula y del método de clasificación de la célula fluorescente fueron combinadas para obtener bastantes números de mBMSCs proliferativos en un corto tiempo.

Sin duda, uno de los pasos más críticos de este protocolo es la disección de la mandíbula de la rata, que es absolutamente distinta de las de huesos axiales y apendiculares. Es esencial entender la anatomía de la mandíbula de rata para obtener una muestra intacta. Similar al humano, la mandíbula de rata se encuentra debajo del maxilar, mantiene los dientes inferiores en su lugar y está conectada al cráneo por cóndilos bilaterales. Dado que la mandíbula es el único hueso que puede moverse en el cráneo, hay muchos músculos unidos a la mandíbula, que controlan su movimiento. Sólo mediante la eliminación de estos tejidos blandos por completo y la apertura de la boca al máximo se pueden exponer los cóndilos que conectan con el cráneo. También vale la pena mencionar que el cuello condilar es una debilidad física en la mandíbula y es fácil de fracturar. Si se encuentra una resistencia excesiva al girar la mandíbula hacia abajo, significa que los músculos masticatorios pueden no ser eliminados por completo. Cuando esto se observa, no lo gire con restricciones, de lo contrario es fácil romper el cuello condilar, lo que conduce a la contaminación celular. Otras dificultades en la separación y el cultivo de mBMSCs incluyen bajo contenido en médula ósea, actividad celular delicada, baja pureza, baja frecuencia celular y contaminación de células hematopoyéticas18,23. Para obtener mBMSCs con un buen crecimiento y un potencial de diferenciación relativamente alto, asegurar la actividad de mBMSCs es de crucial importancia. Hay varios pasos clave, incluido el uso de ratas viejas de cuatro semanas para este y posteriores experimentos, ya que se prefiere que las ratas jóvenes mantengan una buena viabilidad. Muchos estudios han confirmado que la actividad de los mBMSCs está relacionada con la edad de los animales de experimentación. Esos mBMSCs de donantes más viejos pueden dar lugar a una actividad más baja de la proliferación, al potencial de la diferenciación y a la vida2. Todas las operaciones durante la recolección celular deben completarse en hielo y el tiempo de operación debe ser lo más corto posible, preferiblemente dentro de las 2 horas. Además, mantenga el tiempo de digestión de la tripsina no más de 3 minutos. Por último, otro desafío en este protocolo es el proceso de cosecha de mBMSCs. Puede ser problemático eliminar los mBMSCs de la cavidad ósea porque la cavidad de la mandíbula de rata es muy pequeña, por lo que es muy importante estar familiarizado con la estructura anatómica. Las imágenes micro-CT pueden ser de gran ayuda en este sentido. Además, vale la pena señalar que como los huesos juveniles son delgados y quebradizos, la rotura puede resultar en contaminación.

Refiriéndose a la caracterización inmunofenotípica, los BMSCs expresan varios fenotipos, pero ninguno de los cuales es específico de ellos24. Generalmente se acepta que los BMSC no expresan CD11b, CD14, CD34 o CD45, pero tienen una alta expresión de Sca-1, CD29, CD90 y CD105. Este estudio eligió los marcadores ampliamente aceptados de CD29, CD90, y CD45 para la clasificación de la célula fluorescente13,14,25. Se encontró que CD29+CD90+CD45 célula representó adecuadamente el 80% de las células totales, que fue suficiente para el cultivo celular posterior y la investigación.

Durante décadas, terapia con células madre es ampliamente utilizado en el tratamiento de diversas enfermedades, tales como enfermedades del sistema inmunológico, enfermedades sistémicas hematológicas, cánceres, o trauma. Sin duda, mBMSCs, como un sustituto de BMSCs, puede ser utilizado como una herramienta más segura y más potente en la terapia con células madre debido a sus características superiores. El cultivo celular y la expansión de mBMSCs, por lo tanto, llegan a ser particularmente importantes para obtener el suficiente número de células para el tratamiento.

En resumen, este estudio demostró un protocolo prometedor y fiable para cosechar abundantes mBMSCs con alta homogeneidad y capacidad de multi-diferenciación en un corto período de tiempo.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Todos los autores afirman que no tienen conflictos de intereses.

Acknowledgments

Agradecemos la asistencia del Laboratorio de Estomatología Digitalizada y el Centro de Investigación de Anomalías Craneofaciales del Noveno Hospital Popular de Shanghai. El trabajo de este manuscrito está respaldado por subvenciones de la Fundación Nacional de Ciencias Naturales de China (NSFC) [81570950,81870740,81800949], Shanghai Summit &Plateau Disciplines, el fondo SHIPM-mu del Instituto de Medicina de Precisión de Shanghai, el Noveno Hospital Popular de Shanghai, la Facultad de Medicina de la Universidad Jiao Tong de Shanghai [JC201809], el Proyecto de Incentivo del Equipo de Innovación de Alto Nivel para la Facultad de Medicina de la Universidad Jiao Tong de Shanghai. Y L.J. es un académico de los Talentos Médicos Juveniles Sobresalientes, el Programa de Desarrollo Juvenil "Rising Stars of Medical Talent" de Shanghai y el proyecto "Chen Xing" de la Universidad Jiaotong de Shanghai.

Materials

Name Company Catalog Number Comments
0.25% Trypsin-EDTA(1X) Gibco 25200072
10cm culture dish Corning
acutenaculum
Adipogenic differentiation medium Cyagen biosciences inc. MUBMX-90031
Alcian Blue Beyotime Biotechnology
Alizarin red Sigma-Aldrich A5533
Alkaline Phosphatase Color Development Kit Beyotime Biotechnology C3206
alpha-Minimum essential medium GE Healthcare HyClone Cell Culture SH30265.01B
Anti -CollagenII Rabbit pAb Abcam ab34712
Antibodies against CD16/CD32
Antifade Mounting Medium with DAPI Beyotime Biotechnology P0131
APC anti-mouse/rat CD29 Antibody biolegend inc 102215
Biosafety cabinet Esco AC2-4S8-CN
CD45 Monoclonal Antibody (OX1), PE, eBioscience Invitrogen 12-0461-82
CD90.1 (Thy-1.1) Monoclonal Antibody (HIS51), FITC, eBioscience Invitrogen 11-0900-85
Centrifuge cence L500
Chondrogenesis differentiation medium cyagen biosciences inc.
Confocal laser scanning microscope Zeiss LSM880
Countess II FL Automated Cell Counter Invitrogen AMQAF1000
Crystal Violet Staining Solution Beyotime Biotechnology C0121
Fetal Bovine Serum GE Healthcare HyClone Cell Culture SH30084.03
Goat Anti-Rabbit IgG H&L (Alexa Fluor 488) abcam ab150077
Incubator Esco CCL-170B-8
Inverted microscope olympus CKX53
Magzol reagent(Trizol reagent) Magen
micropipettor Eppendorf
Oil Red O
Osteogenic differentiation medium cyagen biosciences inc. MUBMX-90021
Penicillin-Streptomycin Gibco 15070063
Phosphate-buffered saline(1X) Gibco 20012027
PrimeScript RT Master Kit TakaRa Bio Inc RR036A
Proteinase K Sigma-Aldrich P6556
QuickBlock Blocking Buffer Beyotime Biotechnology P0260
scissor
SYBR1 Premix TakaRa Bio Inc
Toluidine Blue Beyotime Biotechnology
Trypan Blue Solution, 0.4% Gibco 15250061

DOWNLOAD MATERIALS LIST

References

  1. Jin, C., et al. Stem cell education for medical students at Tongji University: Primary cell culture and directional differentiation of rat bone marrow mesenchymal stem cells. Biochemistry and Molecular Biology Education. 46, (2), 151-154 (2018).
  2. Chu, D. T., et al. An Update on the Progress of Isolation, Culture, Storage, and Clinical Application of Human Bone Marrow Mesenchymal Stem/Stromal Cells. International Journal of Molecular Sciences. 21, (3), 708 (2020).
  3. Jin, Z., Chen, J., Shu, B., Xiao, Y., Tang, D. Bone mesenchymal stem cell therapy for ovariectomized osteoporotic rats: a systematic review and meta-analysis. BMC Musculoskeleton Disorder. 20, (1), 556 (2019).
  4. Jiang, Y., et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature. 418, (6893), 41-49 (2002).
  5. Musina, R. A., Bekchanova, E. S., Belyavskii, A. V., Sukhikh, G. T. Differentiation potential of mesenchymal stem cells of different origin. Bulletin of Experimental Biology and Medicine. 141, (1), 147-151 (2006).
  6. Lloyd, B., et al. Similarities and differences between porcine mandibular and limb bone marrow mesenchymal stem cells. Archives in Oral Biology. 77, 1-11 (2017).
  7. Zhang, W., et al. Comparison of the use of adipose tissue-derived and bone marrow-derived stem cells for rapid bone regeneration. Journal of Dental Research. 92, (12), 1136-1141 (2013).
  8. Stefanik, D., et al. Disparate osteogenic response of mandible and iliac crest bone marrow stromal cells to pamidronate. Oral Disorders. 14, (5), 465-471 (2008).
  9. Aghaloo, T. L., et al. Osteogenic potential of mandibular vs. long-bone marrow stromal cells. Journal of Dental Research. 89, (11), 1293-1298 (2010).
  10. Kaigler, D., et al. Stem cell therapy for craniofacial bone regeneration: a randomized, controlled feasibility trial. Cell Transplantation. 22, (5), 767-777 (2013).
  11. Li, C., Wang, F., Zhang, R., Qiao, P., Liu, H. Comparison of proliferation and osteogenic differentiation potential of rat mandibular and femoral bone marrow mesenchymal stem cells in vitro. Stem Cells Development. 2020, 1941629 (2020).
  12. Matsubara, T., et al. Alveolar bone marrow as a cell source for regenerative medicine: differences between alveolar and iliac bone marrow stromal cells. Journal of Bone and Mineral Research. 20, (3), 399-409 (2005).
  13. Chan, C. K. F., et al. Identification of the Human Skeletal Stem Cell. Cell. 175, (1), 43-56 (2018).
  14. Bianco, P., Riminucci, M., Gronthos, S., Robey, P. G. Bone marrow stromal stem cells: nature, biology, and potential applications. Stem Cells. 19, (3), 180-192 (2001).
  15. Franken, N. A., Rodermond, H. M., Stap, J., Haveman, J., van Bree, C. Clonogenic assay of cells in vitro. Nature Protocol. 1, (5), 2315-2319 (2006).
  16. Xu, H., et al. Icariin prevents oestrogen deficiency-induced alveolar bone loss through promoting osteogenesis via STAT3. Cell Proliferation. 53, (2), 12743 (2020).
  17. Zhang, P., Wu, Y., Jiang, Z., Jiang, L., Fang, B. Osteogenic response of mesenchymal stem cells to continuous mechanical strain is dependent on ERK1/2-Runx2 signaling. Internation Journal of Molecular Medicine. 29, (6), 1083-1089 (2012).
  18. Zhu, H., et al. A protocol for isolation and culture of mesenchymal stem cells from mouse compact bone. Nature Protocol. 5, (3), 550-560 (2010).
  19. Lach, M. S., et al. Chondrogenic Differentiation of Pluripotent Stem Cells under Controllable Serum-Free Conditions. International Journal of Molecular Sciences. 20, (11), 2711 (2019).
  20. Huang, X., Zhong, L., Hendriks, J., Post, J. N., Karperien, M. The Effects of the WNT-Signaling Modulators BIO and PKF118-310 on the Chondrogenic Differentiation of Human Mesenchymal Stem Cells. International Journal of Molecular Sciences. 19, (2), 561 (2018).
  21. Gale, A. L., Linardi, R. L., McClung, G., Mammone, R. M., Ortved, K. F. Comparison of the Chondrogenic Differentiation Potential of Equine Synovial Membrane-Derived and Bone Marrow-Derived Mesenchymal Stem Cells. Frontiers in Veterinary Sciences. 6, 178 (2019).
  22. Li, X., Zhang, Y., Qi, G. Evaluation of isolation methods and culture conditions for rat bone marrow mesenchymal stem cells. Cytotechnology. 65, (3), 323-334 (2013).
  23. Kagami, H., Agata, H., Tojo, A. Bone marrow stromal cells (bone marrow-derived multipotent mesenchymal stromal cells) for bone tissue engineering: basic science to clinical translation. International Journal of Biochemistry and Cell Biology. 43, (3), 286-289 (2011).
  24. Chamberlain, G., Fox, J., Ashton, B., Middleton, J. Concise review: mesenchymal stem cells: their phenotype, differentiation capacity, immunological features, and potential for homing. Stem Cells. 25, (11), 2739-2749 (2007).
  25. Abdallah, B. M., Alzahrani, A. M., Abdel-Moneim, A. M., Ditzel, N., Kassem, M. A simple and reliable protocol for long-term culture of murine bone marrow stromal(mesenchymal) stem cells that retained their in vitro and in vivo stemness in long-term culture. Biology Proceedings Online. 21, 3 (2019).
Aislamiento Y Cultivo De Células Madre Mesenquimales De Médula Ósea Mandibular En Ratas
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Hong, Y., Xu, H., Yang, Y., Zhou, S., Jin, A., Huang, X., Dai, Q., Jiang, L. Isolation and Cultivation of Mandibular Bone Marrow Mesenchymal Stem Cells in Rats. J. Vis. Exp. (162), e61532, doi:10.3791/61532 (2020).More

Hong, Y., Xu, H., Yang, Y., Zhou, S., Jin, A., Huang, X., Dai, Q., Jiang, L. Isolation and Cultivation of Mandibular Bone Marrow Mesenchymal Stem Cells in Rats. J. Vis. Exp. (162), e61532, doi:10.3791/61532 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter