Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

Isolering och odling av mandibulära benmärgsmjukelsemjukelsestamceller hos råttor

doi: 10.3791/61532 Published: August 25, 2020
* These authors contributed equally

Summary

Denna artikel presenterar en metod som kombinerar hela benmärgs vidhäftning och flöde cytometri sortering för isolering, odling, sortering och identifiering benmärg mesenchymal stamceller från råtta mandibles.

Abstract

Här presenterar vi en effektiv metod för att isolera och odla mandibulära benmärgsmjukhetsmjukliga stamceller (mBMSCs) in vitro för att snabbt få många högkvalitativa celler för experimentella krav. mBMSCs kan användas i stor utsträckning i terapeutiska tillämpningar som vävnadstekniska celler vid kraniofacial sjukdomar och kranio-maxillofacial regenerering i framtiden på grund av den utmärkta självförnyelse förmåga och multi-lineage differentiering potential. Därför är det viktigt att få mBMSCs i stort antal.

I denna studie spolades benmärgen från underdible och primära mBMSCs isolerades genom hela benmärg vidhäftande odling. Dessutom renades CD29+CD90+CD45 mBMSCs genom fluorescerande cellsortering. Den andra generationen av renade mBMSCs användes för ytterligare studier och visade potential att differentiera till osteoblaster, adipocyter och kondrocyter. Med hjälp av denna in vitro-modell kan man få ett stort antal proliferativa mBMSCs, vilket kan underlätta studien av de biologiska egenskaperna, den efterföljande reaktionen på mikromiljön och andra tillämpningar av mBMSCs.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Benmärgsmmesenkymala stamceller (BMSCs) är icke-hematopoetiska stamceller som härrör från benmärg som manifesterar stark spridningsförmåga och multi-lineage differentiering potential1,2,3,4. BMSCs har faktiskt betraktats som en idealisk kandidat för benvävnadsteknik och regenerering ända sedan de upptäcktes. I åratal har iliaca vapen eller långa ben såsom skenben och lårben varit den vanligaste källan till BMSCs för kraniofacial regenerering. Orofacial BMSCs, såsom mandibular BMSCs (mBMSCs), visar dock vissa skillnader från långa ben BMSCs, såsom olika embryonala ursprung och utvecklingsmönster. Mandibles uppstår från neurala vapenceller i neuroectoderm bakterie lager och genomgår intramembranösa benbildning, medan axiella och appendicular skelett är från mesoderm och genomgår endochondral benbildning. Kliniska observationer och experimentella djurstudier har dessutom konsekvent visat att det finns funktionella skillnader mellan orofacial och iliaca vapen BMSCs5,6,7,8. Rapporter har visat att BMSCs härrör från kraniofacial ben såsom underkäken, maxillary ben och alveolar ben uppvisade överlägsen spridning, livslängd och differentiering kapacitet än de från axiell och appendicular ben9. mBMSCs anses därför vara de föredragna resurserna för framtida terapeutiska tillämpningar av kraniofaciala sjukdomar som kerubism, käktumör, osteoporos i käkben och parodontalavävnadsdefekt 10,11,12. För att förstå behandlingspotentialen i prekliniska experiment är det viktigt att fastställa en metod för att snabbt isolera och odla mBMSCs in vitro.

I denna studie var syftet att erhålla renade mBMSCs genom hel benmärgs vidhäftning och flöde cytometri sortering. Den anatomiska morfologin hos råtta underdible, tydligt observeras genom mikro datortomografi (Micro-CT) och histologiska avsnitt, visade att trabecular ben av underdible var mellan framtänder medullary utrymme och alveolar ben. Benmärgen från trabekulärt ben spolades för att erhålla mandibularmärg celler, men cellerna odlas på detta sätt var inte rena mBMSCs och var sannolikt att bestå av flera typer av celler med osäkra potencies och olika härstamningar såsom celler från ben, fett och endotelceller13,14. Nästa steg i cellrening var särskilt viktigt. Flöde cytometri filtrerar celler genom att känna igen en kombination av cell-ytan proteiner och har antagits allmänt i berikning av mesenchymala stamceller. Cellhom homogenitet är den största fördelen med flödescytometri, men processen bestämmer inte cellens livskraft och kan resultera i ett begränsat cellutbyte. I denna studie sorterades P0 mBMSCs som erhållits från hela benmärg vidhäftning efter flöde cytometri för att erhålla mBMSCs med hög renhet och stark spridning kapacitet.

Denna studie introducerar ett reproducerbart och tillförlitligt protokoll för isolering, kultur och differentiering av råtta mandibular BMSCs med hjälp av en kombination av hela benmärg vidhäftning och flöde cytometri sortering. Det är en pålitlig och bekväm metod för forskare inom relaterade områden att använda.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alla djurförsöksförfaranden i detta dokument godkändes av Animal Care Committee of Shanghai Ninth People's Hospital, Shanghai Jiao Tong University School of Medicine.

1. Förberedelse

  1. Använd två 5 veckor gamla manliga Sprague Dawley råttor för experimentet.
  2. Sterilisera alla instrument, inklusive nålhållare, pincett och sax vid hög temperatur eller nedsänkt i 75% etanol i 10 min.
    OBS: Etanolsänkning bör inte vara för lång för att undvika cellskador.
  3. Förbered kulturmedier i förväg, vars sammansättning finns i tabell 1. Komplettera varje medium enligt beskrivningen nedan.
    1. Beredning av α-MEM odlingsmedium (med 10% FBS): Komplettera minsta essentiella medium alfa (α-MEM) med 10% fetala nötkreatur serum och 1% penicillin och streptomycin.
    2. Beredning av osteogent differentieringsmedium: Komplettera osteogen differentieringsbasalt medium med 10% fetala nötkreatursserum, 1% glutamin, 1% penicillin-streptomycin, 0, 20% askorbinsyra, 1% β-glycerophosphate och 0, 01% dexametason.
    3. Beredning av osteogent induktionsmedium: Blanda 70% α-MEM odlingsmedium (med 10% FBS) och 30% osteogen differentieringsmedium.
    4. Beredning av adipogenic differentiering medium A: Komplettera adipogenic differentiering basal medium med 10% fetala nötkreatur serum, 1% glutamin, 1% penicillin-streptomycin, 0,20% insulin, 0,10% IBMX, 0,10% Rosiglitazone och 0,01% Dexamethasone.
    5. Beredning av adipogenic differentiering medium B: komplettera adipogenic differentiering basal medium med 10% fetala nötkreatur serum, 1% glutamin, 1% penicillin-streptomycin och 0,20% insulin.
    6. Beredning av chondrogenic differentiering medium: Komplettera chondrogenic differentiering basal medium med 0,01% Dexametason, 0,30% askorbinsyra, 1% ITS, 0,10% Natrium pyruvat, 0,10% Proline och 1% TGF-β3.
      OBS: Osteogent differentieringsmedium måste förbrukas inom en månad efter konfigurationen. Den effektiva perioden av det konfigurerade chondrogenic differentieringsmediet är 12 h.

2. Isolering och odling av råtta mBMSCs

OBS: Alla experimentella operationer bör utföras på is så mycket som möjligt för att bibehålla cellens livskraft.

  1. Skörda råttmandibles
    1. Avliva två 5 veckor gamla manliga Sprague Dawley råttor genom CO2 kvävning. Se till att djurets andning stoppas innan du fortsätter med experimentet.
    2. Skölj dessa råttor i en bägare som innehåller 75% etanol i 3 min.
    3. Placera råttan i en ren rökhuva för att skörda mandibles.
      OBS: Sterilisera rökhuven med ultraviolett ljusstrålning i 30 minuter före användning.
    4. Placera råttan i ett överläge. Incise skinn och buccinator muskler från bilaterala kant oris till den bakre regionen av underkäken, som är det enda rörliga benet med nedre framtänder.
      OBS: Det rekommenderas att göra ett 2 cm snitt på varje sida av vinkeln oris för att få ett tydligt operationsfält.
    5. Öppna råttans mun genom att trycka maxillary och mandibular framtänder mot motsatt riktning med båda tummarna för att exponera mandibulära tänder, som är fästa vid underkäken.
    6. Koppla helt bort buccalmusklerna och senorna som är fästa vid coracoids och den sämre gränsen av underkäken.
      OBS: En ökad rörlighet hos underdiblen observeras under detta steg på grund av bristen på muskelspänningar.
    7. Tryck på de mandibulära bakre tänderna och rotera tillbaka och nedåt tills kondylarna på båda sidor är tydligt exponerade.
      OBS: Detta steg utförs för att artificiellt öppna råttans mun i största möjliga utsträckning för att rubbda condyle. Underdråman är ansluten till skallen genom bilaterala kondyler, så exponeringen av kondylarna leder till frånkoppling mellan skallen och underdiblen.
    8. Separera underdriskkroppen från skallen.
    9. Rengör den vidhäftande mjukvävnaden på benytan med en våt gasväv.
    10. Placera benet i en 10 cm steril glasform fylld med förkyld minsta essentiella medeldistans α (α-MEM) eller fosfatbufferthydrlina (PBS) på is för att bevara livskraften.
  2. Isolering och odling av mBMSCs
    1. Skär av det främre benet längs den första molarens mesialkant från mandibularkroppen. Ta bort mandibular ramus inklusive coracoid och condyle längs den distala kanten av den tredje molar för att exponera märghålan.
    2. Fyll en 10 cm steril glasform med 10 ml α-MEM (med 10% FBS).
    3. Använd 1 ml spruta för att aspirera α-MEM odlingsmedium. Med sprutnålen insatt i benmärgshålan, spola upprepade gånger benmärgen i skålen. Spola benhålan minst 3 gånger från både mesiala respektive distala sidor av benet tills benet blev vitt.
      OBS: Detta är det mest kritiska steget, eftersom benmärgshålan hos en råttmandible inte är lika uppenbar som i långt ben och rätt punkt för att sätta in nålen måste bestämmas empiriskt. Alla experimentella prover ovan bör förvaras på is för att bibehålla cellens livskraft och drifttiden får därför inte vara längre än 2 timmar.
    4. Överför mediet som innehåller de spolade cellerna till ett 15 ml centrifugeringsrör och centrifuger vid 800 x g i 4 °C i 5 minuter. Kassera supernaten.
    5. Återanvänd cellerna med 3 ml α MEM (med 10% FBS). Plätera cellerna i en ny 10 cm odlingsform och inkubera vid 37 °C i en 5% CO 2-inkubator.
    6. Kontrollera de morfologiska förändringarna och tillväxten av dessa celler på den tredje kulturdagen. Ta bort odlingsmediet med icke-hängande celler och vävnadsfragment. Tillsätt försiktigt 10 ml färskt α-MEM (med 10% FBS).
    7. Efter 7 dagars kultur nådde P0 mBMSCs 70% till 80% sammanflöde.
  3. Sortering av flödesceller
    OBS: P0 mBMSCs identifierades fenotypiskt och främst renas genom flöde cell sortering.
    1. Aspirera och kassera odlingsmediet och tvätta sedan skålen med PBS. Kassera PBS.
    2. Tillsätt 1 ml 0,25% trypsin med 0,02% EDTA i skålen. Smält cellerna vid 37 °C i 5 min och tillsätt sedan 2 ml α-MEM (med 10% FBS) för att stoppa reaktionen.
    3. Överför cellernas suspension till ett 15 ml centrifugeringsrör och centrifugera vid 800 x g i 5 minuter.
    4. Återanvänd cellerna i 120 μL PBS (med 10% FBS) efter centrifugation.
    5. Blockera dessa cellupphängningar med 1 μL antikroppar mot CD16/CD32 vid 4 °C i 15 minuter.
    6. Överför 100 μL av cellfjädringen till ett nytt mikrocentrifugrör. färga cellerna med Phycoerythrin (PE)-konjugerad antikropp mot CD45, fluorescein-isothiocyanate (FITC)-konjugerad antikropp mot CD90 och Allophycocyanin (APC)-antikropp mot CD29 vid 4 °C i 1 h imörker 13,15. Koncentrationen av antikroppar som används i detta experiment visas i tabell 2. Använd de andra 20 μL cellfjädringen som ouppnåebar negativ kontroll.
    7. Centrifugera sedan rören vid 800 x g i 5 minuter, kassera suspensionen och återanvänd cellerna i 0,5 ml PBS (med 10% FBS).
    8. Tillsätt 10 μL 0,01 mg/ml DAPI i 10 minuter före analys.
    9. Använd 40 nm filter placerade på centrifugrör för att filtrera cellerna.
    10. Analysera cellerna på Fluorescence-aktiverad cell Sorter. Ställ in panelerna enligt följande. Ta först bort döda celler från det totala antalet celler genom att gating DAPI- celler, sedan gate CD29+CD90+CD45- i de markerade cellerna som riktade mBMSCs.
    11. Samla in den sorterade CD29+CD90+CD45- cellerna i ett 15 ml centrifugeringsrör med 3 ml α-MEM (med 10% FBS) förberedda.
    12. Centrifugera rören vid 800 x g i 5 min. Ta bort uppsamlingsbufferten och tillsätt 1 ml färsk α-MEM (med 10% FBS) för att återanvända cellerna. Tallrika dem sedan i en 6 cm kulturrätt.

3. Kolonibildningsförmåga

OBS: Det här steget utfördes för att kontrollera om mBMSCs har divisionsförmåga. 15 (på 5)

  1. Välj andra passage mBMSCs (P2) för det här experimentet. När cellkonfluensen nådde 80% till 90%, återförde cellerna i en seriell gradient i en 6 väl platta för att utvärdera deras klonursplikt spridning förmåga.
    OBS: Det rekommenderas att tona övertoningen från 1 x 102 till 1 x 103 celler per brunn, men de slutliga utspädningarna av olika cellinjer av mänskligt eller animaliskt ursprung fastställdes empiriskt.
  2. Odla cellerna i α-MEM (med 10% FBS) i ungefär två veckor tills ett stort antal av koloniformningsenheterna kunde ses under ljusmikroskop. Uppdatera kulturmediet var tredje dag.
  3. Aspirera och kassera odlingsmediet, tvätta brunnarna med PBS två gånger i 5 minuter åt gången. Tillsätt sedan 4% paraformaldehydlösning till varje brunn och fixera i minst 10 min.
  4. Ta bort paraformaldehyden och skölj brunnarna två gånger med PBS.
  5. Färga cellerna med kristallviolett färglösning och inkubera dem i 37 °C i ca 10 min.
    OBS: Färgningstiden justeras på lämpligt sätt tills önskad nyans har uppnåtts.
  6. Ta bort färgningslösningen och tvätta proverna med destillerat vatten för att stoppa reaktionen.
  7. Bild under ett stereomikroskop och räkna spridda cellkolonier som bestod av minst 50 celler.

4. Differentiering av mBMSC:er för flera typer av skikt

OBS: P2 mBMSCs användes för efterföljande experiment om inget annat beskrivs.

  1. Osteogen induktion av mBMSCs
    1. Smält mBMSCs enligt beskrivningen ovan. Fröceller med en densitet av 2,5 x 105/cm2 i en 12 brunnsplatta kompletterad med 1 ml α-MEM (med 10% FBS).
    2. När cellkonfluensen nådde 60-70%, ändra mediet till 30% osteogena induktionsmedier. Odla cellerna med α-MEM (med 10% FBS) som en negativ kontroll och ändra mediet varannan dag.
      OBS: Efter att ett stort antal kalcium härdarna uppträder under osteogenes, rekommenderas att ändra medium utbytesmönstret till en halv volym medium utbyte var 2: e dag, för att förhindra osteoblaster från att flyta.
    3. Efter odling i sju dagar, bedöma förkalkningen av dessa celler genom alkalisk fosfatasfärgning16,17.
    4. Ta bort odlingsmediet och fixera cellerna med 4% paraformaldehyd i 10 min. Skölj cellerna med 1 ml PBS per brunn i 3 minuter två gånger.
    5. Färga sedan cellerna med alkalisk fosfatasfärgningslösning och inkubera vid 37 °C i 10-30 min.
      OBS: Inkubation kan utföras över natten vid rumstemperatur för att få önskad färg.
    6. Tvätta brunnarna med destillerat vatten för att stoppa reaktionen. Fotografera under ljusmikroskop. Röda pigmenterade granulat representerar alkalisk fosfatas (ALP) aktivitet.
    7. Efter att ha odlat de återstående cellerna i ytterligare 7 dagar, utför alizarin röd färgning för att utvärdera cellernas mineraliseringskapacitet.
    8. Färga cellerna med 0,5% alizarin röd färgningslösning efter cellfixering i 10 min16,18. Stoppa den kromogena reaktionen med destillerat vatten efter 3-5 min.
      OBS: Reaktionstiden kan förlängas beroende på vilken färg som utvecklas.
    9. Slutligen placera odlingsplattan under ljusmikroskopet för att observera effekten av osteogen färgning; röda knölar indikerar kalciumavlagringar av dessa celler.
  2. Adipogenic induktion av mBMSCs
    1. Frö P2 mBMSCs i en 12 brunnsplatta enligt beskrivningen ovan.
    2. Efter brunnen blir 90% konfluent, odla cellerna med adipogenic differentiering medium A. Använd celler odlade i α-MEM kulturmedium (med 10% FBS) som negativ kontroll.
    3. Efter 2 dagars induktion, aspirera mediet A från brunnen och tillsätt 1 ml adipogent differentieringsmedium B i varje brunn.
    4. Efter en dag, ta bort medium B och starta cykeln igen med medium A som läggs tillbaka i brunnen. Odla cellerna växelvis med medel A och B.
    5. Applicera differentieringsmediet A och B växelvis i tre cykler och detektera adipogenesis av dessa celler genom oljeröd Ofärgning 16,18.
      OBS: Massor av runda och stora lipiddroppar kan observeras genom att odla dessa celler med differentieringsmedium B i ytterligare 2 till 3 dagar.
    6. Ta bort mediet och fixera cellerna med 4% paraformaldehyd i 10 min. Tvätta cellerna med PBS.
    7. Färga cellerna med oljeröd O färglösning och inkubera vid 37 °C i ca 3 min.
    8. Ta bort färgningslösningen och tvätta brunnarna med destillerat vatten.
    9. Observera adipogenes under ljusmikroskop.
  3. Chondrogenesis induktion av mBMSCs
    1. Frö P2 mBMSCs i 15 mL centrifugeringsrör med en densitet av 5 x 105/cm2.
    2. Centrifugera rören vid 300 x g i 5 min. Kassera supernaten.
    3. Återanvänd cellerna med 0,5 ml kologent differentieringsmedium. Centrifugera cellerna vid 300 x g i 5 min.
    4. Lossa locket på centrifugröret och inkubera det vid 37 °C i en 5% CO 2-inkubator. Förnya mediet varannan dag.
      OBS: Cellerna börjar pelleta efter 24 timmar. Det rekommenderas att inte flytta centrifugröret i 48 timmar. Var försiktig så att du inte aspirerar cellpelleten när du byter medium.
    5. Efter 21 dagars induktion, fixa cellpelletsen med 4% paraformaldehyd, följt av uttorkning, paraffininbäddning och sektionering.
    6. Efter deparaffinisering och hydrering, färga rutschkanorna i alciansk blå lösning i minst 15 min18,19,20,21, tvätta sedan med destillerat vatten för att stoppa reaktionen. Fånga fotografierna under ljusmikroskop.
    7. För immunofluorescerande färgning av kollagen typ II, utför stegen nedan.
      1. Inkubera diabilderna med 5 μg/ml proteinas K i 15 min vid 37 °C efter deparaffiniserings- och hydreringssteget.
      2. Inkubera diabilderna i blockeringsbufferten i 1 timme vid 37 °C.
      3. Applicera 1 μL kollagen typ II-antikroppar i 200 μL blockeringsbuffert på diabilderna och inkubera över natten vid 4 °C.
      4. Nästa dag tvättar du diabilderna med PBS två gånger och inkuberar med sekundära antikroppar vid 37 °C i 1 timme.
      5. Inkubera skivorna med 40,6-diamidino-2-fenylindol (DAPI) i 10 minuter.
    8. Ta fotografier av varje diabilder under fluorescensmikroskopi.

5. PCR i realtid

  1. Extrahera totalt RNA från mBMSCs med hjälp av ett guanidium isothiocyanate baserat kommersiellt tillgängliga reagens.
  2. Utför omvänd transkription av RNA till kompletterande DNA med hjälp av ett kommersiellt tillgängligt kit. Reaktionsförhållandena för omvänd transkription var följande: 65 °C i 5 min, 37 °C i 15 min, 85 °C för 15 s.
  3. Utför PCR i realtid för att upptäcka osteogenes och adipogenesis specifika gener med hjälp av primers listade i tabell 3. Pcr-förstärkningsförfarandet var följande: 95 °C i 5 min. 95 °C för 5 s, 60 °C i 30 s i 40 cykler.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Med hjälp av detta protokoll fastnade en stor andel celler på plattan den tredje dagen efter den ursprungliga kulturen. Vanligtvis, efter ytterligare 3-4 dagars kultur, nådde cellkonfluensen till 70 till 80% (Figur 1B). Med fluorescerande cellsortering renades DAPI-CD29+CD90+CD45 mBMSCs18,22, som stod för cirka 81,1% i P0-cellerna (Figur 1C).

Efter sådd P2 mBMSCs vid 100 celler i varje brunn av 6 brunnsplatta i en vecka observerades en betydande mängd kolonibildande enheter, vilket föreslog den betydande koloniformningskapaciteten hos mBMSCs(figur 1D).

För att bedöma multi-härstamning differentiering förmåga, mBMSCs inducerades till osteo-, chondro- och adipo-härstamning, respektive, i 12 brunn plattor. MBMSCs visade stark osteogenic differentiering kapacitet. Ökad aktivitet av ALP, röda calcific härdarna fördelas sporadiskt under alizarin röd färgning och ökat uttryck för osteogenic specifika gener Runx2, Alp, Bsp och Ocn (Figur 2) anges oestogenic induktion. För adipogenesis, identifieras av olja-röd-O färgning, var många lipid-rika vacuoles uppenbart efter 9 dagar av induktion. På samma sätt visade uttrycket av adipogenic specifika gener Pparγ1 och Cebpa en betydande ökning (figur 3). För mikroskopisk observation av chondrogenic differentiering diabilder, proverna visade positiva färgning för alcian blå. Dessutom visade immunostaining med anti-typ II kollagen antikroppar ökad ackumulering av brosk matris (Figur 4).

Kultur Medium komponent Slutlig koncentration
1.α-MEM kulturmedium (med 10%FBS) α viktigt medium som är minst nödvändigt
Fetala nötkreatur serum 10%
Penicillin och streptomycin 1%
2.Osteogent induktionsmedium α-MEM kulturmedium (med 10%FBS) 70%
Osteogen differentiering differentiering medium 30%
3.Osteogent differentieringsmedium Osteogen differentiering basal medium
Fetala nötkreatur serum 10%
glutamin 1%
Penicillin-Streptomycin 1%
askorbinsyra 0.20%
β-Glycerophosphate 1%
Dexametason 0.01%
4.Adipogenic differentiering medium A Adipogenic differentiering basal medium
Fetala nötkreatur serum 10%
glutamin 1%
Penicillin-Streptomycin 1%
insulin 0.20%
IBMX (IBMX) 0.10%
Rosiglitazon 0.10%
Dexametason 0.01%
5.Adipogenic differentiering medium B: Adipogenic differentiering basal medium
Fetala nötkreatur serum 10%
glutamin 1%
Penicillin-Streptomycin 1%
insulin 0.20%
6.Chondrogenic differentieringsmedium: Kondrogenes differentiering basial medium
Dexametason 0.01%
askorbinsyra 0.30%
dess 1%
Natrium pyruvat 0.10%
prolin 0.10%
TGF-β3 (olika) 1%

Tabell 1: Komponenter i odlingsmedium och differentieringsmedium.

antikropp koncentration
CD90.1 (Thy-1.1) Monoklonal antikropp 0,5 mg/ml
CD45 Monoklonal antikropp 0.2mg/ml
CD29-antikropp 0.2mg/ml
KollagenII kanin polyklonal antikropp 5mg/ml
Get Anti-Rabbit IgG H&L (Alexa Fluor® 488) 1mg/ml

Tabell 2: Antikroppskoncentration som används i denna studie.

abc-bok Sekvens(5' till 3')
GAPDH (2000 Foward: CGGCAAGTTCAACGGCAGTCAAGG
Omvänd: ACGACATACTCAGCACCAGCATCACC
Runx2 (runx2) Foward: GCCTTCAAGGTTGTAGCCCT
Omvänd: TGAACCTGGCCACTTGGTTT
alp Foward: AAACTCGCTTATGGTCCCCG
Omvänd: TGGGTTTGAATTCCTGCGGT
Bps Foward: GCACGGTTGAGTATGGGGAA
Omvänd: ATCCTGACCCTCGTAGCCTT
Ocn (ocn) Framåt:CAACCCCAATTGTGACGAGC
Omvänd:GGCAACACATGCCCTAAACG
Cebpa (på andra) Foward: AGTCGGTGGATAAGAACAGCAACG
Omvänd: CGGTCATTGTCACTGGTCAACTCC
Pparγ1 (på 1000) Foward: CCATCGAGGACATCCAAGACAACC
Omvänd: GTGCTCTGTGACAATCTGCCTGAG

Tabell 3: Primers som används i PCR i realtid.

Figure 1
Figur 1: Isolering och kultur av mBMSCs. (A) Schematiskt diagram över protokollet. mBMSCs isolerades och pläterades på dag 0 och inkuberades med α-MEM kultur medium. Dag 7 renades P0 mBMSCs genom flöde cytometri sortering och de sorterade cellerna pläterades på en ny kultur skål. På dag 14 samlades P1 mBMSCs in och plätering på 12-brunnsplatta. Dag 15 inducerades P2 mBMSCs till osteoblaster, adipogenic celler och chondroblasts under motsvarande induktion medium. B)Schematisk modell av råtta mandibular benmärg och mikroskopisk observation av P0 mBMSCs. (C) Flödescytometri sortering av råtta mBMSCs. Flöde cytometri analys visar dessa celler var positiva för CD29 och CD90, men negativa för CD45, som är kongruent med BMSC egenskaper. Av dessa sorterades 1,4 x 106 celler, vilket stod för lämpligt 80% av de totala cellerna. D)Representativ bild av kristallviolett färgade P2 mBMSC kloner. Klicka här om du vill visa en större version av den här figuren.

Figure 2
Figur 2: Osteogen differentieringspotential hos mBMSCs. A)Efter 7 dagars osteogen induktion visualiserades förändringen av ALP-aktiviteten. Ett stort antal mineraliserade härdarna var färgas under alizarin röd färgning 14 dagar efter induktion av osteogenic differentiering. B,C) Det positiva området ALP och alizarin röd färgning utvärderades med hjälp av Image J programvara. (C-G) MRNA uttryck för osteoblast-specifika markörer Runx2, Alp, Bsp och Ocn ökade avsevärt efter 7 dagar av osteogenesis. Klicka här om du vill visa en större version av den här figuren.

Figure 3
Figur 3: Adipogenic differentiering potential för mBMSCs efter nio dagars induktion. A)En stor mängd lipiddroppar bildas och adipocyter färgades av olja-röd-O. B,C) MRNA uttryck för adipogenic markörer Cebpa och Pparγ1 ökade anmärkningsvärt efter 9 dagar av adipogenesis. Klicka här om du vill visa en större version av den här figuren.

Figure 4
Figur 4: Stereoscopevy av kondrogen differentieringseffekt. (A) mBMSCs efter 21 dagar chondrogenic induktion visade positiva för alcian blå färgning. (B) Immunofluorescens bild av chondrogenic aggregerat färgat med anti-typ II kollagen. Klicka här om du vill visa en större version av den här figuren.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Detta protokoll beskriver en metod för att isolera BMSCs från råtta mandibles in vitro genom att kombinera hela benmärg vidhäftning och fluorescerande cell sortering, vilket är ett enkelt och tillförlitligt sätt att erhålla proliferative mBMSCs med stark differentiering förmåga. Denna metod skulle preliminärt kunna rena mBMSC genom flödescellsortering, men om det finns högre krav på cellhom homogenitet kan mer exakta reningsmetoder krävas.

För närvarande finns det fyra huvudtekniker som används för att isolera mBMSCs, inklusive hela benmärgs vidhäftning, densitetsgradientcentrifugation, fluorescerande cellsortering och magnetisk aktiverad cellsortering22. Hela benmärgs vidhäftning och densitet gradient centrifugation är de vanligaste och enkla metoderna som används för att erhålla mBMSCs på kort tid, men den låga renheten hos skördade mBMSCs är deras främsta nackdel. De två sista metoderna kan isolera mycket renade mBMSCs genom immunologiska tekniker, men har bristerna att vara dyra, tar lång tid och nedsatt cell livskraft. I denna studie kombinerades fördelarna med hela benmärgs vidhäftning och fluorescerande cellsorteringsmetoden för att få tillräckligt många proliferativa mBMSCs på kort tid.

Utan tvekan är ett av de mest kritiska stegen i detta protokoll dissekering av råtta mandible, som är ganska skild från axial och appendicular ben. Det är viktigt att förstå råttmandiblens anatomi för att få ett intakt prov. I likhet med människa sitter råttmandible under maxillan, håller de nedre tänderna på plats och är ansluten till skallen av bilaterala kondyler. Eftersom underkäken är det enda benet som kan röra sig i skallen finns det många muskler fästa vid underkäken, som kontrollerar dess rörelse. Endast genom att ta bort dessa mjuka vävnader helt och vrida munnen öppen maximalt kan kondylarna som ansluter till skallen exponeras. Det är också värt att nämna att kondylarhalsen är en fysisk svaghet i underkäken och är lätt att bryta. Om överdriven resistens uppstår vid vridning av underkäken nedåt, betyder det att masticatoriska musklerna kanske inte är helt borttagna. När detta observeras, rotera det inte begränsat, annars är det lätt att bryta kondylarhalsen och därigenom leda till cellförorening. Andra svårigheter vid separation och odling av mBMSCs inkluderar lågt innehåll i benmärgen, känslig cellaktivitet, låg renhet, låg cellfrekvens och kontaminering av hematopoetiskaceller 18,23. För att erhålla mBMSCs med god tillväxt och relativt hög differentieringspotential är det av avgörande betydelse att säkerställa mBMSCs verksamhet. Det finns flera viktiga steg, inklusive användningen av fyra veckor gamla råttor för detta och efterföljande experiment, eftersom unga råttor föredras för att upprätthålla god livskraft. Många studier har bekräftat att mBMSCs verksamhet är relaterad till försöksdjurens ålder. Dessa mBMSC från äldre givare kan leda till lägre spridningsaktivitet, differentieringspotential och livslängd2. Alla operationer under cellskörden måste slutföras på is och driftstiden ska vara så kort som möjligt, helst inom 2 timmar. Dessutom, håll trypsin matsmältningstiden inte längre än 3 minuter. Slutligen är det fortfarande en annan utmaning i detta protokoll som processen med att skörda mBMSC: er. Det kan vara besvärligt att spola mBMSCs från benhålan eftersom håligheten hos rått underdible är mycket liten, så det är mycket viktigt att vara bekant med den anatomiska strukturen. Micro-CT bilder kan vara till stor hjälp i detta avseende. Dessutom är det värt att notera att eftersom juvenila ben är smala och spröda kan brott leda till förorening.

Med hänvisning till immunophenotypic karakterisering uttrycker BMSCs flera fenotyper, men ingen av dem är specifik för dem24. Det är allmänt accepterat att BMSCs inte uttrycker CD11b, CD14, CD34 eller CD45, men de har ett högt uttryck för Sca-1, CD29, CD90 och CD105. Denna studie valde de allmänt accepterade markörerna cd29, CD90 och CD45 för fluorescerande cellsortering13,14,25. Den fann att CD29+CD90+CD45 cell stod för lämpligt 80% av de totala cellerna, vilket var tillräckligt för efterföljande cellkultur och forskning.

I årtionden används stamcellsterapi ofta vid behandling av olika sjukdomar, såsom immunsystemsjukdomar, hematologiska systemsjukdomar, cancer eller trauma. Utan tvekan kan mBMSCs, som ersättning för BMSCs, användas som ett säkrare och kraftfullare verktyg i stamcellsterapi på grund av deras överlägsna egenskaper. Cellkultur och expansion av mBMSCs blir därför särskilt viktigt för att få tillräckligt många celler för behandling.

Sammanfattningsvis visade denna studie ett lovande och tillförlitligt protokoll för att skörda rikliga mBMSCs med hög homogenitet och multi-differentiering förmåga på kort tid.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Alla författare uppger att de inte har några intressekonflikter.

Acknowledgments

Vi tackar för hjälpen från Laboratoriet för digitaliserad stomatologi och forskningscenter för kraniofacial anomalier i Shanghai Nionde folkets sjukhus. Arbetet med detta manuskript stöds av bidrag från National Natural Science Foundation of China (NSFC) [81570950,81870740,81800949], Shanghai Summit & Plateau Disciplines, SHIPM-mu-fonden från Shanghai Institute of Precision Medicine, Shanghai Nine People's Hospital, Shanghai Jiao Tong University School of Medicine [JC201809], incitamentsprojektet för innovation på hög nivå för Shanghai Jiao Tong University School of Medicine. Och L.J. är en forskare i Outstanding Youth Medical Talents, Shanghai "Rising Stars of Medical Talent" Youth Development Program och "Chen Xing" -projektet från Shanghai Jiaotong University.

Materials

Name Company Catalog Number Comments
0.25% Trypsin-EDTA(1X) Gibco 25200072
10cm culture dish Corning
acutenaculum
Adipogenic differentiation medium Cyagen biosciences inc. MUBMX-90031
Alcian Blue Beyotime Biotechnology
Alizarin red Sigma-Aldrich A5533
Alkaline Phosphatase Color Development Kit Beyotime Biotechnology C3206
alpha-Minimum essential medium GE Healthcare HyClone Cell Culture SH30265.01B
Anti -CollagenII Rabbit pAb Abcam ab34712
Antibodies against CD16/CD32
Antifade Mounting Medium with DAPI Beyotime Biotechnology P0131
APC anti-mouse/rat CD29 Antibody biolegend inc 102215
Biosafety cabinet Esco AC2-4S8-CN
CD45 Monoclonal Antibody (OX1), PE, eBioscience Invitrogen 12-0461-82
CD90.1 (Thy-1.1) Monoclonal Antibody (HIS51), FITC, eBioscience Invitrogen 11-0900-85
Centrifuge cence L500
Chondrogenesis differentiation medium cyagen biosciences inc.
Confocal laser scanning microscope Zeiss LSM880
Countess II FL Automated Cell Counter Invitrogen AMQAF1000
Crystal Violet Staining Solution Beyotime Biotechnology C0121
Fetal Bovine Serum GE Healthcare HyClone Cell Culture SH30084.03
Goat Anti-Rabbit IgG H&L (Alexa Fluor 488) abcam ab150077
Incubator Esco CCL-170B-8
Inverted microscope olympus CKX53
Magzol reagent(Trizol reagent) Magen
micropipettor Eppendorf
Oil Red O
Osteogenic differentiation medium cyagen biosciences inc. MUBMX-90021
Penicillin-Streptomycin Gibco 15070063
Phosphate-buffered saline(1X) Gibco 20012027
PrimeScript RT Master Kit TakaRa Bio Inc RR036A
Proteinase K Sigma-Aldrich P6556
QuickBlock Blocking Buffer Beyotime Biotechnology P0260
scissor
SYBR1 Premix TakaRa Bio Inc
Toluidine Blue Beyotime Biotechnology
Trypan Blue Solution, 0.4% Gibco 15250061

DOWNLOAD MATERIALS LIST

References

  1. Jin, C., et al. Stem cell education for medical students at Tongji University: Primary cell culture and directional differentiation of rat bone marrow mesenchymal stem cells. Biochemistry and Molecular Biology Education. 46, (2), 151-154 (2018).
  2. Chu, D. T., et al. An Update on the Progress of Isolation, Culture, Storage, and Clinical Application of Human Bone Marrow Mesenchymal Stem/Stromal Cells. International Journal of Molecular Sciences. 21, (3), 708 (2020).
  3. Jin, Z., Chen, J., Shu, B., Xiao, Y., Tang, D. Bone mesenchymal stem cell therapy for ovariectomized osteoporotic rats: a systematic review and meta-analysis. BMC Musculoskeleton Disorder. 20, (1), 556 (2019).
  4. Jiang, Y., et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature. 418, (6893), 41-49 (2002).
  5. Musina, R. A., Bekchanova, E. S., Belyavskii, A. V., Sukhikh, G. T. Differentiation potential of mesenchymal stem cells of different origin. Bulletin of Experimental Biology and Medicine. 141, (1), 147-151 (2006).
  6. Lloyd, B., et al. Similarities and differences between porcine mandibular and limb bone marrow mesenchymal stem cells. Archives in Oral Biology. 77, 1-11 (2017).
  7. Zhang, W., et al. Comparison of the use of adipose tissue-derived and bone marrow-derived stem cells for rapid bone regeneration. Journal of Dental Research. 92, (12), 1136-1141 (2013).
  8. Stefanik, D., et al. Disparate osteogenic response of mandible and iliac crest bone marrow stromal cells to pamidronate. Oral Disorders. 14, (5), 465-471 (2008).
  9. Aghaloo, T. L., et al. Osteogenic potential of mandibular vs. long-bone marrow stromal cells. Journal of Dental Research. 89, (11), 1293-1298 (2010).
  10. Kaigler, D., et al. Stem cell therapy for craniofacial bone regeneration: a randomized, controlled feasibility trial. Cell Transplantation. 22, (5), 767-777 (2013).
  11. Li, C., Wang, F., Zhang, R., Qiao, P., Liu, H. Comparison of proliferation and osteogenic differentiation potential of rat mandibular and femoral bone marrow mesenchymal stem cells in vitro. Stem Cells Development. 2020, 1941629 (2020).
  12. Matsubara, T., et al. Alveolar bone marrow as a cell source for regenerative medicine: differences between alveolar and iliac bone marrow stromal cells. Journal of Bone and Mineral Research. 20, (3), 399-409 (2005).
  13. Chan, C. K. F., et al. Identification of the Human Skeletal Stem Cell. Cell. 175, (1), 43-56 (2018).
  14. Bianco, P., Riminucci, M., Gronthos, S., Robey, P. G. Bone marrow stromal stem cells: nature, biology, and potential applications. Stem Cells. 19, (3), 180-192 (2001).
  15. Franken, N. A., Rodermond, H. M., Stap, J., Haveman, J., van Bree, C. Clonogenic assay of cells in vitro. Nature Protocol. 1, (5), 2315-2319 (2006).
  16. Xu, H., et al. Icariin prevents oestrogen deficiency-induced alveolar bone loss through promoting osteogenesis via STAT3. Cell Proliferation. 53, (2), 12743 (2020).
  17. Zhang, P., Wu, Y., Jiang, Z., Jiang, L., Fang, B. Osteogenic response of mesenchymal stem cells to continuous mechanical strain is dependent on ERK1/2-Runx2 signaling. Internation Journal of Molecular Medicine. 29, (6), 1083-1089 (2012).
  18. Zhu, H., et al. A protocol for isolation and culture of mesenchymal stem cells from mouse compact bone. Nature Protocol. 5, (3), 550-560 (2010).
  19. Lach, M. S., et al. Chondrogenic Differentiation of Pluripotent Stem Cells under Controllable Serum-Free Conditions. International Journal of Molecular Sciences. 20, (11), 2711 (2019).
  20. Huang, X., Zhong, L., Hendriks, J., Post, J. N., Karperien, M. The Effects of the WNT-Signaling Modulators BIO and PKF118-310 on the Chondrogenic Differentiation of Human Mesenchymal Stem Cells. International Journal of Molecular Sciences. 19, (2), 561 (2018).
  21. Gale, A. L., Linardi, R. L., McClung, G., Mammone, R. M., Ortved, K. F. Comparison of the Chondrogenic Differentiation Potential of Equine Synovial Membrane-Derived and Bone Marrow-Derived Mesenchymal Stem Cells. Frontiers in Veterinary Sciences. 6, 178 (2019).
  22. Li, X., Zhang, Y., Qi, G. Evaluation of isolation methods and culture conditions for rat bone marrow mesenchymal stem cells. Cytotechnology. 65, (3), 323-334 (2013).
  23. Kagami, H., Agata, H., Tojo, A. Bone marrow stromal cells (bone marrow-derived multipotent mesenchymal stromal cells) for bone tissue engineering: basic science to clinical translation. International Journal of Biochemistry and Cell Biology. 43, (3), 286-289 (2011).
  24. Chamberlain, G., Fox, J., Ashton, B., Middleton, J. Concise review: mesenchymal stem cells: their phenotype, differentiation capacity, immunological features, and potential for homing. Stem Cells. 25, (11), 2739-2749 (2007).
  25. Abdallah, B. M., Alzahrani, A. M., Abdel-Moneim, A. M., Ditzel, N., Kassem, M. A simple and reliable protocol for long-term culture of murine bone marrow stromal(mesenchymal) stem cells that retained their in vitro and in vivo stemness in long-term culture. Biology Proceedings Online. 21, 3 (2019).
Isolering och odling av mandibulära benmärgsmjukelsemjukelsestamceller hos råttor
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Hong, Y., Xu, H., Yang, Y., Zhou, S., Jin, A., Huang, X., Dai, Q., Jiang, L. Isolation and Cultivation of Mandibular Bone Marrow Mesenchymal Stem Cells in Rats. J. Vis. Exp. (162), e61532, doi:10.3791/61532 (2020).More

Hong, Y., Xu, H., Yang, Y., Zhou, S., Jin, A., Huang, X., Dai, Q., Jiang, L. Isolation and Cultivation of Mandibular Bone Marrow Mesenchymal Stem Cells in Rats. J. Vis. Exp. (162), e61532, doi:10.3791/61532 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter