Polimeraz Zincir Reaksiyonu: Temel Protokol Plus, Sorun ve Optimizasyon Stratejileri

Biology
 

Summary

PCR birçok moleküler biyoloji laboratuvarlarında yaygın bir teknik olarak ortaya çıkmıştır. Pek çok geleneksel PCR protokolleri için hızlı bir kılavuzdur burada sağlanan. Her bir reaksiyon benzersiz bir deneyde, bir ürün üretmek için gerekli değişir uygun koşullar olmasıdır. Bir reaksiyonla değişkenlerini anlama büyük ölçüde böylece istenilen sonucu elde etmek şansı artan giderme verimi artıracaktır.

Cite this Article

Copy Citation | Download Citations

Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J. Vis. Exp. (63), e3998, doi:10.3791/3998 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Biyolojik bilimler keşfin altın çağına disiplin mancınık teknolojik gelişmeler olmuştur. Örneğin, mikrobiyoloji alanında bilim adamları ilk kez prokaryotlarda görselleştirmek için izin Anton van Leeuwenhoek en mikroskop, gelişine dönüştürüldü. Polimeraz zincir reaksiyonu (PCR) geliştirilmesi etkisini biyolojinin sayısız alt disiplinleri kapsayan ile moleküler bilimin gidişatını değiştiren bu yeniliklerden biri. Teorik süreci 1971 yılında Keppe ve arkadaşları tarafından ana hatlarıyla ortaya koydu; tam PCR yöntemi Balina Corporation, 1985 yılında ise Kary Mullis tarafından açıklanan ve deneysel olarak uygulanmıştır kadar ancak, başka bir 14 yıl oldu. Bu tekniğin Otomasyon ve arıtma bakteri Thermus aquaticus, dolayısıyla adı Taq DNA polimeraz bir termal dayanıklı DNA polimeraz tanıtımıyla ilerledi.

PCR powe olduğunuBaşlangıç ​​malzemesi sadece küçük bir miktarı (yani, DNA şablonu veya hedef dizisi) DNA (yani, bir amplikon) belirli bir bölümü, zengin bir besleme oluşturabilir rful amplifikasyon tekniği. Basit ve genel olarak sorunsuz olsa da, sahte sonuçlar üreten reaksiyon komplike tuzaklar vardır. PCR başarısız olduğunda bunu agaroz jel üzerindeki bantların bir merdiven ya da smear olarak görünür büyüklü küçüklü birçok non-spesifik DNA ürünlere de yol açabilir. Bazen herhangi bir ürün hiç oluştururlar. Mutasyonlar istemeden PCR ürünlerinin heterojen nüfus sonuçlanan amplikonlar başlatıldığında diğer bir olası sorun oluşur. Sabır ve dikkatli bir sorun giderme sıralamak ve sorun (lar) çözmek için istihdam sürece PCR hataları sinir bozucu hale gelebilir. Bu protokol, PCR temel ilkelerini özetlenmektedir en hedef dizilerinin amplifikasyonu ile sonuçlanacaktır bir yöntem sağlar, ve bir reaksiyon optimize etmek için stratejiler sunar. Bu PCR kılavuzu, st takip ederekudents gerekir:

  • Geleneksel PCR deney için reaksiyonlar ve ısıl koşulları ayarlama
  • Çeşitli reaksiyon bileşenlerinin fonksiyonu ve PCR deney üzerindeki genel etkisi Anlayın
  • Herhangi bir DNA örneğinin bir PCR deney tasarlayın ve optimize
  • Başarısız PCR deneyler giderme

Protocol

1. Tasarımı Astarlar

Uygun primerler tasarlama PCR deney başarılı sonuç için önemlidir. Amplifikasyonu için istenilen DNA'nın belirli bir bölgeye bir primer setinin dizayn ederken, bir astar artı teamül 5 '→ 3' yönünde (aynı zamanda anlamda ya nontemplate strand olarak da bilinir) yönlendirilmiş olan strand, ve gerektiği kadar tav diğer astar 3 '→ 5' yönünde (antisens veya şablon iplikçik) yönlendirileceğini eksi iplikli, tamamlamalıdır. Ziyade, 2) astar birbirine tavlama DNA örneğinin astar oluştururken; 1) kendini tavlama gibi saç tokası döngüler (Şekil 1a) gibi ikincil yapıların oluşumuna yol açan primer: primerler dizayn ederken ortaya çıkan bir kaç ortak sorunları vardır dimerleri (Şekil 1b), her astar 3) büyük ölçüde farklı erime sıcaklıkları (T m), zor bir tavlama sıcaklığı seçtiğiniz olacak tüm yapımow her iki astarın verimli themal bisiklet (Şekil 1c) (T m ler hakkında daha fazla bilgi için BİSİKLET ŞARTLARI ERGİME SICAKLIĞI (T m) ve DEĞİŞİKLİKLER HESAPLANMASI bölümlerine bakınız) sırasında hedef diziyle bağlamak.

  1. Aşağıda primerler tasarlanırken dikkate alınması gereken özelliklerin bir listesidir.
    1. Primer uzunluğu 15-30 nükleotid artıkları (üsler) olmalıdır.
    2. Optimal GC içeriği% 40-60 arasında olmalıdır.
    3. Astar 3 'end emiş etkinliğini arttırır ve astar kelepçe uçlarının "solunum" önlemek amacıyla, bir G veya C içermelidir. Biter ama fray tavlanmış kalmak veya ayrı bölme olmadığında DNA "nefes alma" oluşur. GC çiftler halinde üç hidrojen bağları solunum önlemek değil, aynı zamanda primerlerin erime sıcaklığı artar.
    4. Artı strand astar ve eksi iplikçik astar içeren bir primer setinin 3 'ucu, c olmamalıdır birbirlerine omplementary, ne de, tek bir astar 3 'end astar diğer sekansları tamamlayıcı olabilir. Bu iki senaryolar sırasıyla astar dimerleri ve firkete halka yapılarının oluşturulması ile sonuçlanabilir.
    5. Aralığı 45-65 genişletilebilir rağmen 52-58 ° C arasında primer aralığı için en uygun erime sıcaklıkları (T m), ° C Her iki astarın da nihai T m en fazla 5 göre farklılık ° C'nin
    6. Onlar oluşturmak için DNA ve veya firkete döngü yapıları astarlanmış segmenti boyunca kaymaya neden olabilir Di-nükleotit tekrarları (örneğin, GCGCGCGCGC veya ATATATATAT) veya tek bir baz çalışır (örneğin, AAAAA veya CCCCC) kaçınılmalıdır. DNA örneğinin doğası gereği kaçınılmaz olursa, o zaman sadece tekrarlar içeren veya tek baz 4 baz maksimum çalışır.

Notlar:

  1. Primer çiftleri tasarımı yardımcı olmak için çok sayıda bilgisayar programları tasarlanmış bulunmaktadır. NCBI Astar tasarım aracıw.ncbi.nlm.nih.gov / tools / astar-patlama / "target =" _blank "> http://www.ncbi.nlm.nih.gov/tools/primer-blast/ ve Primer3 http://frodo .wi.mit.edu/primer3 / Bu amaç için tavsiye edilen siteleri vardır.
  2. Ilgili pseudogenes veya homologları amplifikasyonu önlemek için bu primerlerin hedef özgünlüğü kontrol etmek için NCBI bir patlama çalıştırmak için yararlı olabilir.

2. Malzeme ve Reaktifler

  1. PCR deney kurarken, hazırlanan olmak önemlidir. Reaksiyon karışımı veya reaktiflerin kirlenmesini önlemek için eldiven giyin. Bir negatif kontrol içerir, ve bir pozitif kontrol mümkünse.
  2. Taze dolu buz kovasının içinde PCR deney için gerekli tüm reaktifler düzenleyin ve onlara bir reaksiyon (Şekil 2) kurmadan önce tamamen erimesi sağlar. Deney boyunca buz üzerinde reaktifleri tutun.
    • Standart PCR'da bir yerİstenen hedef gen ya da amplifiye edilecek DNA kısmı, DNA polimeraz, belirli bir DNA polimeraz için bir tampon, deoxynucleotides (dNTP), şablon DNA, ve steril su için uygun bir primerlerin ayarlanır.
    • Ek reaktifler Magnezyum tuzu Mg 2 + (0,5-5,0 mM son konsantrasyonda), potasyum tuzu K + (35-100 mM son konsantrasyonda), dimetilsülfoksit (DMSO içerebilir;% 1-10 arasında bir nihai konsantrasyonunda ), formamid (% 1,25-10 bir son konsantrasyonda), sığır (10-100 ug / ml 'lik bir son konsantrasyonda), serum albumin ve betain (2,5 M, 0,5 M bir son konsantrasyonda). Katkı sorun giderme bölümünde açıklanmıştır.
  3. Tezgah üzerinde laboratuvar ekipmanları düzenleyin.
    • 10 ul (P10), - 2 - 20 ul (P20), 20 - 200 ul (P200) Malzeme PCR tüpleri ve kapaklar, bir PCR tüpü rakı, bir etanol dirençli işaretleyici ve 1 arasında dağıtmak micropipettors grubunu içerirve 200 - 1000 ul (P1000) yanı sıra, bir termal döngü cihazı.
    • Hepsi aynı reaktifler kullanan birkaç PCR deney kurarken, onlar uygun ölçeklenebilir ve master karışım (Master Mix) birlikte kombine edilebilir. Bu aşama bileşik (Notlar bakınız) steril bir 1.8 ml mikrosantrifüj tüp içinde yapılabilir.
    • Agaroz jel elektroforez için bir PCR deneyi, reaktifler ve ekipman kaynaklanan amplikonlar analiz etmek için gereklidir. Bir PCR ürünü yaklaşık boyutu için, uygun bir, ticari olarak mevcut moleküler ağırlığı standart boyutta ihtiyaç duyulmaktadır.

3. Bir reaksiyon karışımının kurulması

  1. (Bakınız Tablo 1) reaksiyon karışımına eklenir reaktiflerin bir tablo yaparak başlar.
  2. Daha sonra, etanol-dirençli işaretleyici ile etiketli PCR tüp (s).
  3. Reaksiyon hacmi stok reaktiflerin konsantrasyonları bağlı olarak değişir. Nihai konsantrasyonlar(CF) tipik bir 50 ul reaksiyon için aşağıdaki gibidir.
    • X tamponu (genellikle DNA polimeraz, üretici tarafından sağlanan; MgCl2 15 mM içerebilir). Reaksiyon başına 10X buffer 5 ul ekleyin.
    • 200 uM dNTP (dört nükleotid her birinin 50 uM). Reaksiyon başına 10 mM dNTP (dATP, dCTP, dTTP ve dGTP 2.5 mM her altındadır) 1 ul ekleyin.
    • 1.5 mM Mg 2 +. Bu 10X tampon mevcut değilse ya da PCR optimizasyonu için gereken yalnızca ekleyin. Örneğin, 4.0 mM Mg 2 + bir uncharacterized Mycobacteriophage reaksiyonu (Şekil 3) için 25 mM MgCl2 ve 8 ul ilave bulunan bir korunmuş 566 bp DNA parçası optimum amplikon üretimi için gereklidir elde etmek için.
    • Her bir astar 20 ile 50 pmol. Her 20 uM astar 1 ul ekleyin.
    • 10 Nisan-10 Temmuz molekülleri (veya 1000-1 yaklaşık ng), DNA şablonu ekleyin. 2NG / & mu 0.5 ul ekle; L genomik DNA Mycobacteriophage.
    • Örneğin 50 ul reaksiyon başına DNA polimeraz 0.5 ila 2.5 birim (üreticileri öneriler bakınız) ekle, 0.5 Sigma 0.5 Birimleri ul / ul Taq DNA polimeraz ekleyin.
    • (QS gerekli miktarı anlamına quantum satis için Latince bir kısaltmasıdır) reaktiflerin tabloda önceden belirlenen reaksiyon başına 50 ul son hacim elde etmek için QS steril saf su ekleyin. Böylece, reaksiyon başına 33 ul kadar 50 ul kadar hacmi getirmek için gereklidir. Bununla birlikte, su ilave edilir, ancak ilk başlangıçta reaktiflerin bir tablo yapma ve reaksiyona eklenmiş, diğer tüm reaktif hacimleri belirleyici gerektirir olduğu not edilmelidir.

4. Temel PCR Protokolü

  1. 0.2 ml ince duvarlı PCR tüpleri için bir tutucu olarak buz kovasının içine 96 plaka yerleştirin. PCR'da soğuk 0.2 ml ince duvarlı PCR tüpleri içine eklenmesine izin vererek oynamış önlemeye yardımcı olacaktıre aktivite ve nonspesifik astar.
  2. Steril su, 10X PCR tampon, dNTP, MgCl2, astar ve DNA (Bkz Tablo 1): Aşağıdaki sırayla 0.2 ml ince duvarlı PCR tüpü (Şekil 4) içine aşağıdaki PCR'da Pipeti. Deneyler en az bir negatif kontrol ve muhtemelen pozitif kontrol olmalı bu yana, bir 1.8 ml mikrosantrifüj tüpü Master Mix kurmak (Notlar açıklama bakınız) faydalıdır.
  3. Ayrı bir 0.2 ml ince duvarlı PCR tüpleri (Şekil 4) negatif kontrol için DNA hariç (eksik cildi dengelemek için su artırmak) tüm reaktifler ekleyin. Buna ek olarak, başka bir reaksiyon (reaktifler varsa) ve DNA veya daha önceden deneme PCR tüp ile aynı koşullar altında yükseltmek için bilinen primerler kullanılarak, bir pozitif kontrol içermelidir.
  4. Taq DNA polimeraz tipik olarak% 50 gliserol içinde depolanırreaksiyon karışımı çözüm ve tam yayılma gerektiren en az 20 kez aşağı yukarı pipetleme tarafından PCR'da karıştırma nazik. Karıştırma micropipettor master miks yaklaşık yarısı reaksiyon hacmi ayarlanmış olmalıdır ve bakım kabarcıkları tanıtma önlemek için alınmalıdır.
  5. 0.2 ml ince duvarlı PCR tüpleri üzerinde kapakları koyun ve termal döngü (Şekil 5) içine yerleştirin. Termal döngü için kapağı sıkıca kapatılır sonra (bkz. Tablo 2) programını başlatın.
  6. Program bittiğinde, 0.2 ml ince duvarlı PCR tüpleri 4 ° C de kaldırıldı ve saklanabilir PCR ürünleri daha sonra etidyum bromür ile jel elektroforez aşağıdaki göç etmiş durumda DNA boyama bir agaroz jel kuyulara her bir reaksiyonun alikotları yükleyerek tespit edilebilir. PCR ürün varsa, etidyum bromür bantları UV ışığı ile görüntülenebilir sağlayan DNA iplikçikleri üsleri arasında enterkale olacaktır. </ Li>

Notlar:

  1. Birden fazla PCR deneyler kurarken, tüm reaksiyonlar (yani, Master Mix) ortak reaktiflerin bir karışımı monte avantajlıdır. Genellikle kokteyl, bir 1.8 ml mikrosantrifüj tüp içine monte edilmiş DNA polimeraz, dNTPs, reaksiyon tamponu ve bir su çözeltisi içerir. Her reaktifinin miktarı, ana karışıma yakın tam reaksiyon yuvarlanır toplam reaksiyon numarası artı% 10 eşdeğerdir. Örneğin, varsa 10 x 0.1 = 1 reaksiyon, daha sonra (10 + 1) x 5 ul 10X tampon Master Mix için 10X buffer 55 ul eşittir. Ana Karışım içinde reaktiflerin yukarıda açıklandığı gibi yaklaşık 20 kez yavaşça aşağı micropipettor bir piston kadar pompalama ve iyice karıştırılır. Her tüp PCR DNA şablonu, herhangi bir istenen primerleri, ve deney daha sonra spesifik reaktifleri (Tablo 1 ve 7) eklendi için ana Karışım bir alikotu alır.
  2. Following web sitesi bir DNA (kopya sayısını belirlemek için bir hesap sunar http://www.uri.edu/research/gsc/resources/cndna.html ). Çift şeritli DNA kopyası toplam sayısı, aşağıdaki denklem kullanılarak hesaplanır edilebilir:
    / DNA = kopya sayısı (DNA miktarı (ng) x 6.022x10 23) (DNA x 1x10 9 ng / ml x 650 Daltonluk uzunluğu)
    DNA kopya sayısı hesaplanması şablon reaksiyon başına gerekli miktarını belirlemek için kullanılır.
  3. Yanlış pozitif elektroforez sonra agaroz jel üzerinde birden fazla istenmeyen ürünler olarak görselleştirilmiş olur başka bir PCR reaksiyonu kaçırmayan bir sonucu olarak ortaya çıkabilir. Bu nedenle, uygun tekniği kullanmak için ihtiyatlı olduğunu, (ve pozitif kontrol mümkün olduğunda) bir negatif kontrol içerir.
  4. Etidyum bromid en yaygın leke f ikenveya orada nükleik asitler birçok güvenli ve daha az toksik alternatiflerdir. Aşağıdaki web sitesini kullanmak ve (nihai ürün algılamak nasıl açıklamaları ile birlikte Kırmızı Metilen Blue, Kristal Violet, SYBR Güvenli ve Jel gibi alternatif birkaç açıklanır http://bitesizebio.com/articles/ethidium-bromide-the- alternatif / ).
  5. En modern PCR makineleri 0.2 ml tüpler kullanırken, bazı modellerde 0.5 ml tüpler reaksiyonları gerektirebilir. Uygun boyutta tüp belirlemek için termal cycler cihazları kılavuzuna bakın.

5.. Hesaplama Erime Sıcaklığı (T m)

  1. Primerlerin erime sıcaklığı (T m) bilmek başarılı bir PCR deney için şarttır. Birkaç T m hesap kullanılabilir olmasına rağmen, bu hesaplamalar nedeniyle gerçek T m bir tahmin olduğuna dikkat etmek önemlidir T m hesap kendileri için algoritmalar yapılan belirli bir reaksiyon ve varsayımlar hakkında ayrıntılı bilgi eksikliği. T m ≈ 4 (GC) + 2 (AT): Ancak, en yakın komşu termodinamik modeller daha geleneksel hesaplama tercih edilir. Bunu dikkate komşu baz çiftlerinin istifleme enerji alır çünkü eski daha doğru T m sonuçlar elde edilmesini sağlayacaktır. Hesaplamaları basit ve elle hızlı bir şekilde yapılabilir, çünkü ikincisi daha sık kullanılmaktadır. PCR koşulları ve katkı maddeleri ergime sıcaklığı nasıl etkilediği çeşitli hakkında bilgi için Sorun Giderme bölümüne bakın.
    En yakın komşu termodinamik modeller, aşağıdaki hesap biri tarafından T m değerlerini hesaplamak için tavsiye edilir:
    http://www6.appliedbiosystems.com/support/techtools/calc/
    edu / ~ zimmer / oligoTMcalc.html "target =" _blank "> http://www.cnr.berkeley.edu/ ~ zimmer / oligoTMcalc.html
    http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/
    http://www.finnzymes.com/tm_determination.html~~V
    http://mobyle.pasteur.fr/cgi-bin/portal.py? # formlar :: erime

6. Termal Bisiklet Koşullar Kurma

  1. PCR termal cycler cihazları hızlı bir şekilde ısı ve dupleks DNA (strand ayırma) ısı ile endüklenen denatürasyon için izin reaksiyon karışımının, DNA şablonunun artı ve eksi iplikleri için primerlerin tavlama serin ve PCR ürün uzama. Bisiklete binme kez şablonu ve DNA'nın GC içeriği boyutuna göre hesaplanır. Genel FormülBir 94 bir ilk denatürasyon adımla başlar ° C ile 98 ° C DNA polimeraz aktivitesi ve DNA GC içeriği için optimum sıcaklığa bağlı olarak. Tipik bir reaksiyon 94 bir dakika denatürasyon ile başlayacak ° C Herhangi 3 dakikadan uzun onun enzimatik aktivite yok, DNA polimeraz inaktive olabilir. Hot-start PCR olarak bilinen bir yöntem, büyük ölçüde en fazla 9 dakika ile 3 dakika ilk denatürasyon süresini uzatır. İlk abartılı denatürasyon adım tamamlandıktan sonra, sıcak-başlangıç ​​PCR ile DNA polimeraz eklenir. Bu protokol, modifikasyon DNA polimeraz enzim olasılıkla inaktivasyonu önler. Sıcak başlangıç ​​PCR ve diğer alternatif yöntemler hakkında daha fazla bilgi için bu protokolün Sorun Giderme bölümüne bakın.
  2. Bir sonraki adım üç aşamalı bir sıcaklık döngü 25-35 mermi (Tablo 2) ilk başlatmak için termal döngü koymaktır. Yukarıda 35 devir sayısının artması bir yol açacak ikenPCR ürünleri daha fazla miktarda, çoğunlukla çok sayıda mermi istenmeyen bir ikincil ürünlerin zenginleşmesi ile sonuçlanır. Tek bir döngü içinde üç sıcaklık aşamalarını üç görev vardır: İlk adım şablon (ve daha sonra döngüleri, amplikonlar olarak iyi) denatüre, ikinci adımda optimum primer tavlama sağlar ve üçüncü adımda bağlamak için DNA polimeraz izin DNA şablonu ve PCR ürünü sentezlerler. Bir döngüsü içindeki her aşamanın süresi ve sıcaklığı, istenen amplikon üretimi optimize etmek için değiştirilebilir.
    Denatürasyon adım için zamanı mümkün olduğunca kısa tutulur. Genellikle 10 ila 60 saniye çoğu DNA şablonları için yeterlidir. Denatürasyon süresi ve sıcaklığı, şablon DNA GC içeriğine bağlı olarak değişir, yanı sıra bunun bir sıcaklık olabilir diğerine değiştirmek için termal döngü alır zaman rampa oranı. Bu aşama için bu sıcaklık başlangıç ​​aşaması denatürasyon için kullanıldığı şekliyle, genellikle aynıdır(Adım # 1 yukarıda; örneğin, 94 ° C).
    Bir ikinci 30 tavlama aşamasından yaklaşık 5 ayarlanmış bir sıcaklıkta döngüsü içinde aşağıdaki ° primerlerin belirgin T m aşağıdaki C (ideal olarak 52 ° C arasında 58 ° C).
    Döngüsü bir uzama adım ile son bulur. Sıcaklık deney için seçilmiştir DNA polimeraz bağlıdır. Örneğin, Taq DNA polimeraz 70 arasında optimum bir uzama sıcaklığına sahiptir ° C ila 80 ° C ve daha sonra amplifiye her ek 1 kb için ilave bir dakika gerekir, birinci 2 kb uzamasına 1 dakika gerekir. Pfu DNA polimeraz 75 arasında optimum bir uzama sıcaklığına sahip olan başka bir termostabil enzim ° C'dir Pfu DNA Polimeraz PCR ve yüksek sadakat gerektirir ve amplifiye edilecek her 1 kb için 2 dakika uzatma reaksiyonları gerektirir astar kullanılması tavsiye edilir. Her spesifik DNA polimeraz için belirtilen tam uzama sıcaklık ve uzama süresi için üretici önerilere bakın.
  3. Taq DNA polimeraz durumda, bütün PCR ürünlerinin 3 'uçları için bir adenin kalıntı verir Ayrıca sağlar. Bu değişiklik Taq DNA polimeraz, terminal transferaz aktivitesi tarafından aracılık ve 3'-çıkıntısı gerektirir sonraki moleküler klonlanması prosedürler için yararlıdır.
  4. Reaksiyon sona ermesi 4 ila karışımının soğutulması ile elde edilir ° C ve / veya 10 mM arasında bir nihai konsantrasyona EDTA ilave edilerek.

7. PCR giderme Önemli Hususlar

Standart PCR koşulları istenen amplikon verim yoksa, PCR optimizasyon iyi sonuçlar elde etmek için gereklidir. Bir tepkimenin darlığı (örneğin, özgüllük değiştirerek değişkenleri tarafından ayarlanır böyle modüle olabilir reaktifamplikon profili sonucunu etkileyebilecek konsantrasyonları, bisiklet koşulları). Reaksiyon yeterince katı değilse, örneğin, sahte bir çok amplikonlar değişken uzunlukta ile oluşturulur. Reaksiyon çok sıkı ise, herhangi bir ürün elde edilecektir. Sorun Giderme PCR reaksiyonları zaman sinir bozucu bir çaba olabilir. Ancak, dikkatli analizi ve PCR deneyde kullanılan reaktifler iyi bir anlayış zaman ve istenen sonuçları elde etmek için gerekli çalışmaların miktarını azaltabilirsiniz. Bütün hususlar bu etkinin PCR darlığı, Mg 2 + ve / veya muhtemel en sorunları çözecek tavlama manipüle titrasyonu. Ancak, hiçbir şeyi değiştirmeden önce, hatalı bir sonuç insan hatası yüzünden değildi emin olun. Tüm reaktifler verilen bir reaksiyon eklenir ve reaktiflerin kontamine olmadığını teyit edildi başlayın. Electropho sonra jel görünür astar dimerleri Are: Ayrıca hatalı sonuç dikkat ve şu soruları sorundirenci (küçük çeteler bu dönemde b şeritli alt kısmındaki <100)? Orada non-spesifik ürünler (istenen ürün daha farklı bir boyutta göç bantları) var mı? Herhangi bir ürün eksikliği var mıydı? Bir plazmid veya genomik bir DNA özü hedef DNA mıdır? Ayrıca, istenilen amplikon ile GC içeriğini analiz etmek akıllıca olacaktır.

  1. PCR'da herhangi tepkiniz için felaket olup olmadığını İlk belirler. Bu, (örneğin, taze çalışma stokları, yeni seyreltiler) yeni çözeltiler hazırlamak ve sonra reaksiyon karışımları, sistematik bir her seferinde yeni bir reaktifi ilave edilerek elde edilebilir. Bu süreç, başarısız PCR deney için culprit idi hangi reaktifi belirleyecektir. Genellikle inhibitörleri birikir çok yaşlı DNA, bir durumda, sığır serum albümini ilavesiyle sorunu hafifletmek olabileceği gösterilmiştir.
  2. Primerler tercihen kendini tav veya reaksiyon diğer astar tavlama zaman Primer dimerleri oluşturabilirler. Bu durumda, küçük biraz 100 bp ürünü jelde görünür. Astar şablonu oranını değiştirerek başlayın; astar konsantrasyonu şablonu konsantrasyonu üzerinde aşırı fazla ise, o primerler DNA örneğinin üzerinden kendileri veya birbirlerine tavlama daha çok olacaktır. DMSO ekleme ve ya da sıcak bir başlangıç ​​termal döngü yöntemi kullanarak sorunu çözebilir. Sonuç olarak, yeni primerler tasarlamak için gerekli olabilir.
  3. PCR sıkılığına değişken uzunlukta olan spesifik olmayan PCR bantları ile sonuçlanan aşırı derecede düşük olduğunda spesifik olmayan ürün üretilmektedir. Bu bir agaroz jel üzerinde bir merdiven etkisi yaratır. Daha sonra sıkılığı artırdığını PCR koşulları seçmeniz tavsiye edilir. Genomik DNA yükseltme zaman çeşitli büyüklüklerde bir smear de oldukça tekrarlayıcı sekansları için tasarlanmış primerler kaynaklanabilir. Bununla birlikte, aynı primerler aynı sorun karşılaşmadan bir plazmid bir hedef sekansı amplifiye olabilir.
  4. PCR ürünleri eksikliği olasılığı, reaksiyon koşullarına bağlı olarak birbu çok sıkıdır. Astar veya denatüre DNA yılında oluşmaya Primer dimerleri ve firkete döngü yapıları da PCR ürünlerinin amplifikasyonu engel olabilir, çünkü bu moleküllerin istenen DNA meslektaşı ile baz çifti artık.
  5. GC içeriği analiz değilse, bunu yapmanın zamanı. GC zengini bölgelerin PCR (GC içeriği>% 60) PCR için en büyük zorluklardan bazılarını oluşturmaktadır. Bununla birlikte, zorlukları hafifletmek için kullanılmış olan çok sayıda katkı maddeleri bulunmaktadır.

8. PCR Reaktifler kurgulama

Konvansiyonel PCR kullanılır reaktiflerin işlevlerini anlamada Birinci en iyi istenen ürün elde etmek için reaksiyon şartları değiştirmek ne olduğuna karar verirken kritik önem taşır. Başarı sadece MgCl2, KCl, dNTP, astar, DNA veya DNA polimeraz konsantrasyonu değişen dayanabilir. Bununla birlikte, bu tür reaktiflerin yanlış konsantrasyonu stringenc azaltarak, istenmeyen sonuçlara yol açabilirReaksiyon y. PCR giderme zaman, sadece tek bir reaktif bir kerede manipüle edilmesi gerekir. Bununla birlikte, manipüle reaktifi titre ihtiyatlı olabilir.

  1. Magnezyum tuzu Mg 2 + (0.5 ile 5.0 mm nihai reaksiyon konsantrasyon)
    Termostabil DNA polimerazlar, reaksiyon esnasında bir kofaktör olarak hareket magnezyumun bulunması gerekir. Magnezyum konsantrasyonu değiştirme PCR sıkılığına üzerinde en büyük etkiye sahip belki de işlemek için kolay reaktiflerin biridir. Genel olarak, PCR ürün verimi Mg 2 arasında yüksek derişimlerde ilavesi ile artar +. Bununla birlikte, Mg 2 konsantrasyonlarının artışı +, aynı zamanda DNA polimerazın aslına spesifite ve düşecektir. En çok üreticileri DNA polimeraz ve bir 10X PCR tampon çözeltisi ile birlikte Magnezyum klorid (MgCl2) içindeki bir çözeltisine içerir. 10 x PCR tampon çözeltisi, tipik bir PCR için yeterli olan 15 mM MgCl2, içerebilirlerReaksiyon, ya da, belirli bir reaksiyon için optimize edilmiş bir konsantrasyonda ayrı ayrı ilave edilebilir. Mg 2 + aslında reaksiyon tüketilen değildir, ama reaksiyon bunun mevcut olmadan ilerleyemez. Çok fazla Mg 2 + olduğu zaman, dubleks iplikçik stabilize ederek DNA örneğinin tam denatürasyon önleyebilir. Çok fazla Mg 2 + da yanlıştır şablon siteleri ve istenmeyen PCR ürünleri sonuçlanan azalma özgüllüğü primer tavlama sahte sabitleyebilirsiniz. Yeterli olmadığı zaman Mg 2 +, reaksiyon herhangi bir PCR ürünü ile sonuçlanan, devam etmeyecektir.
  2. Potasyum tuzu K + (35-100 mM nihai konsantrasyonu reaksiyonu)
    Genellikle DMSO ve / veya gliserol ilavesi ile bağlantılı olarak, normal 50 mM reaksiyon konsantrasyonu potasyum tuzu (KCl) azaltarak den daha uzun PCR ürünleri (10-40 kb) yarar. İstediğiniz amplikon altında 1000 bp ve uzun non-spesifik ürünler ise specifici oluştururken,ty 100 mM kadar 10 mm'lik aralıklarla konsantrasyonu arttıkça, KCI titre edilmesidir iyileştirilebilir. Tuz konsantrasyonu arttıkça daha kısa bir DNA molekülü uzun DNA molekülleri, tercihen denatüre izin verir.
  3. Deoksinükleotid 5'-trifosfatlar (20 ve 200 uM, her biri Nihai reaksiyon konsantrasyon)
    Onlar uygun eş konsantrasyonları (yani, [A] = [T] = [C] = [G]) ve / veya istikrarsızlık nedeniyle tekrarlanan den az değilse deoksinükleotid 5'-trifosfatlar (dNTP) PCR için sorunlara neden olabilir dondurma ve çözme. Her zamanki dNTP konsantrasyonu dört dNTP 50 ve uM'dir. Ancak, PCR 20 ve 200 uM her arasındaki konsantrasyonları tolere edebilir. Aşırı dNTP konsantrasyonları, aslında PCR inhibe edebilir ederken dNTP daha düşük konsantrasyonlarda reaksiyon spesifite ve aslına hem artırabilir. Bununla birlikte, uzun PCR-parçaları için, daha yüksek bir konsantrasyonu dNTP gerekli olabilir. DNTP konsantrasyonunda büyük bir değişim, bir karşılık gelmektedir gerektirebilirMg 2 konsantrasyonu değişim göllenen +.
  4. Termal dayanıklı DNA polimeraz
    İlk Taq DNA polimeraz ilk istihdam edildi yana olan enzimler ile ilişkili PCR enzimler ve tamponlar uzun bir yol katettik. Böylece, uygun bir enzim seçerek istenen amplikon ürünler elde etmek için yararlı olabilir. Processivity ve / veya PCR ürün 3 'uçları için bir adenin kalıntı Ayrıca istenirse, örneğin Taq DNA polimeraz kullanılması Pfu DNA polimeraz tercih edilebilir. Bir 3 ilavesiyle timin çıkıntılar 'adenin 3 katiyen TA klonlama vektörleri olarak PCR ürünleri için yararlı bir strateji haline gelmiştir. Aslına daha önemlidir, ancak bu tür Pfu gibi bir enzim, daha iyi bir seçim olabilir. Birkaç özel ihtiyaçları için tasarlanmış özel DNA polimeraz bir dizi var üretmektedir. Reaksiyon koşulları ve istenen amplikon özellikleri bir bak ve daha sonra uygun bir DNA p olan PCR deneyi eşleşecekolymerase. En çok üreten tablo var ki bu sadakat, verim, hız, iyi hedef uzunlukları ve GC zengin büyütme veya sıcak başlangıç ​​PCR için yararlı olup olmadığı gibi özelliklere göre listeleme yardım DNA polimeraz seçimi.
  5. Şablon DNA
    DNA kalite ve saflık başarılı bir PCR deney olasılığı üzerinde önemli bir etkisi olacaktır. DNA ve RNA konsantrasyonu 260 nm (OD 260) da bunların optik yoğunluk ölçümü kullanılarak belirlenebilir. Çözelti içinde nükleik asit saflaştırılmış kütlesi 50 ug / çift dallı DNA ya da 40 ml RNA veya bir OD 260 azından tek şeritli DNA = 1.0 ya için ug / ml 'de elde edilir. DNA ekstraksiyonu kirletici PCR yaygın inhibitörleri ve dikkatle kaçınmak gerekir. PCR ile ortak bir DNA ekstraksiyon inhibitörleri protein, RNA, organik solvent ve deterjan içerir. Nükleik asitler OD 260 maksimum soğurma kullanılarak proteinleri OD280 (OD 260/280) ile karşılaştırıldığında, bu tanımlayabiliriz mümkündüredilen DNA saflığını e bir tahmin. İdeal olarak, OD 260/280 oranı 1.8 ile 2.0 arasındadır. Alt OD 260/280 protein ve / veya büyük bir olasılıkla, PCR için sorunlu olacaktır, solvent kirlenme göstergesidir.
    DNA, DNA miktarının optimizasyonu kalitesinin yanı sıra büyük bir PCR deney sonucu yararlanabilir. Genellikle, modern nanospectrophotometers için olan çıkış ng / ul, in miktarını belirlemek için uygun olmasına rağmen, başarılı bir PCR deney için uygun birim moleküllerinin sayıdır. Bu PCR primerleri tamamlayıcı bir dizi içeren kaç DNA örneğinin kopya, nedir? Optimal hedef moleküllerin 10 Temmuz - 10 Nisan tarihleri ​​arasında moleküllerdir ve yukarıdaki notlarda tarif edildiği şekilde hesaplanabilir.

9. Katkı Reaktifler

Diğer tüm yöntemler başarısız olduğunda Katkı reaktifler sonuçlar verebilir. Reaktifler Anlamakve ne için kullanılan reaktif maddeler, arzu edilen PCR ürünü elde edilmesinde çok etkili olabilen belirlenmesinde kritik önem taşır. Reaksiyonu reaktifler ekleme bir reaktifin manipülasyon başka bir reaktif kullanılabilir konsantrasyonu etkileyebilir gerçeği ile karmaşık. Aşağıda belirtilen reaktif ek olarak, özel bir katkı maddeleri piyasada bulunan bir çok biyoteknoloji firmalardan temin edilebilir.

10. GC Zengin Şablonları yararlanın Katkı

  1. Dimetilsülfoksit (% 1-10 DMSO nihai konsantrasyonu reaksiyonu)
    Şablon DNA, özellikle DMSO baz eşleşmesi bozmakta ve etkili bir T m düşürmek suretiyle reaksiyon artırabilir ekleyerek GC zengin (GC içeriği>% 60), olduğu PCR deneylerinde. Bazı T m hesap PCR deneyde istenen DMSO konsantrasyonu eklenmesi için bir değişken girişini içerir. Ancak, birden fazla% 2 DMSO eklenerek bu demon olduğu gibi daha fazla DNA polimeraz eklenerek gerektirebilirTaq DNA polimeraz inhibe etmek için strated.
  2. Formamid (1,25-10% nihai konsantrasyonu reaksiyonu)
    Daha az spesifik olmayan astar ve artan amplifikasyon verimliliğini sonuçlanır tavlama astar darlığı, artırırken DMSO gibi, formamid da baz eşleşmesi bozar. Formamid, aynı zamanda GC zengin şablon için bir arttırıcı olarak gösterilmiştir.
  3. 7-deaza-2'-deoksiguanozin 5'-trifosfat (dc 7 GTP Nihai reaksiyon konsantrasyonu; 3 dc 7 GTP: 1 dGTP 50 uM)
    1 ya da bir bölümünün 12.5 uM ile birlikte guanozin baz analog dc 7 GTP 3 parça, 37.5 uM, kullanarak, dGTP ürün ikincil yapı oluşmasına kararsız olacaktır. Amplikon veya DNA denatüre olduğu için, genellikle, saç tokası döngüler gibi ikincil yapıları oluşturacak. DNA amplikon içine dc 7 GTP Ortaklığın bu anormal yapıların oluşumuna engel olacaktır.

Not:

7 GTP bu dGTP ile 3:1 oranında kullanılan yüzden etidyum bromür boyama sinyal zayıflar.

  1. Betain (2.5M 0.5M reaksiyon nihai konsantrasyon)
    Betain (N, N, N-Trimethylglycine) azaltır ve hatta nükleotid bileşimine DNA erime sıcaklığına bağımlılığı önlemek olabilen bir zwitteriyonik amino asit analogudur. Bu GC zengin hedeflerin PCR amplifikasyonu yardımcı olmak için bir katkı maddesi olarak kullanılır. Betain genellikle DMSO ile kombinasyon halinde kullanılır ve büyük ölçüde yüksek GC içeriği olan hedef DNA amplifikasyon olasılığını artırabilir.

11. İnhibitörleri Varlığında PCR Yardım Katkı

  1. Non iyonik deterjanlar ikincil yapı oluşumu engellemek ve DNA polimeraz istikrara kavuşturmak için çalışır. Böyle Triton X-100, Tween 20, veya NP-40 gibi non iyonik deterjanlar amplikon üretimi artırmak için 0,1-1% reaksiyon konsantrasyonlarında kullanılabilir. Bununla birlikte, Concentr% 1 Yukarıda ations PCR için inhibitör olabilir. Non iyonik deterjanlar varlığında potansiyel sahte ürünün oluşumuna yol açan, PCR sıkılığına azalır. Ancak, bunların kullanımı, aynı zamanda inhibitör SDS, DNA ekstraksiyon protokoller arada bir kirletici etkiler nötralize edecektir.
  2. Gibi belirli proteinlerin Ayrıca Bovine serum albümini (BSA) gibi FeCl 3, hemin, fülvik asit, humik asit gibi inhibitörlerinin varlığında 150 ul / ng yardımı PCR 'da 400 ul / ng ve / veya T4 geni 32 proteini de kullanılabilir, tannik asit, ya da dışkı, tatlı su ve deniz suyu özler. Bununla birlikte, safra tuzları, bilirubin, EDTA, NaCl, SDS veya Triton X-100 içeren bir PCR inhibitörleri, BSA veya T4 geni 32 proteini ya da eklenmesi ile azaltılabilir değildir.

12. Bisiklete binme Koşullarına Değişiklikler

  1. Tavlama sıcaklığı optimize etmek herhangi bir PCR reaksiyonu artıracaktır ve diğer katkı maddeleri ile ve / veya diğer mo ile kombinasyon halinde dikkate alınmalıdır sürüş koşullarına difications. Böylece, optimal tavlama sıcaklığında hesaplamak için aşağıdaki denklem kullanılmaktadır:
    T OPT = 0.3 T m Astar + 0.7 T m Ürün -14.9
    T m Primer denklemi kullanılarak daha az kararlı çiftinin T m gibi hesaplanır:
    T m Astar = ((ΔH / (ΔS + R x ln (c / 4))) -273,15 + 16,6 log [K +] Nerede ΔH melezler için en yakın komşu entalpi değişimleri toplamı; ΔS toplamıdır en yakın komşu entropi değişimleri; C astar konsantrasyonu;; R Sabit Gaz (1.99 cal K-1 mol-1) ve [K +] potasyum konsantrasyonu.
    Ikinci denklemi aşağıdaki web sitesinde listelenen T m hesap biri kullanılarak hesaplanabilir:
    rs / eritme / sup_mat / servers_list.html "target =" _blank "> http://protein.bio.puc.cl/cardex/servers/melting/sup_mat/servers_list.html
    T m Ürün şu şekilde hesaplanır:
    T m Ürün = 0.41 (% GC) + 16.6 log [K +] - 675/product uzunluğu
    Çoğu PCR reaksiyonları için potasyum konsantrasyonu ([K +]) 50 mM olacak.
  2. Sıcak başlangıç ​​PCR başlangıç ​​denatürasyon süresi (Tablo 4) büyük ölçüde artmış olduğu bir çok yönlü bir modifikasyonudur. Bu değişiklik veya sürüş koşullarına diğer değişiklik olmadan dahil edilebilir. Ayrıca, çoğu zaman mizaç amplikon oluşumu için katkı maddeleri ile birlikte kullanılır. Aslında, sıcak başlangıç ​​PCR giderek genel bisiklet koşulları düzenli bir yönü olarak yer almaktadır. Sıcak başlangıç ​​reaksiyon spesifite ve aslına arttırırken, amplikon verimini arttırmak için gösterilmiştir.Sıcak başlangıç ​​PCR arkasındaki mantığı T m aşağıda tepki kurma bir sonucu olarak meydana gelebilir primer-dimer ve non-spesifik priming ortadan kaldırmaktır. Dolayısıyla, tipik bir sıcak başlangıç ​​reaksiyon, en az bir amplifikasyon meydana edebilmektedir ° C önce 60, optimum T m üzerinde bir sıcaklığa Örnek ısıtır. Genel olarak, DNA polimeraz başlangıç, uzunlamasına, denatüre süre içinde reaksiyondan reddedilmesi. Reaksiyon diğer bileşenler, bazen DNA polimeraz yerine atlanmıştır rağmen, burada DNA polimeraz üzerinde yoğunlaşacaktır. DNA polimeraz inaktif veya ilk denatürasyon süresi tamamlanana kadar fiziksel olarak sağlam bir mum bariyer, anti-DNA polimeraz antikorları ve aksesuar proteinlerin kullanımı dahil, ayrı kalmasına izin çeşitli yöntemler vardır. İlk denatürasyon döngüsü tamamlandıktan sonra Alternatif olarak, DNA polimeraz sadece reaksiyon ilave edilebilir.
  3. Touchdown PCR (TD-PCR) 'dirtahmin bazı braketi hesaplanan tavlama tarafından T m hesaplama sınırlamalar dışında çalışmak alma niyetinde. Konsept bisiklet koşullarının iki aşamadan (Tablo 5) tasarlamaktır. İlk aşamada 10 ° C üzerinde başlayan ve hesaplanan T m terbiye ya da biraz altında, daha düşük tavlama arda her saniye döngüsü (geleneksel olarak 1.0 ° C) kullanır. Faz iki tavlama sıcaklığı 5 ayarlanmış olan standart 3-adım koşulları kullanır ° C başka bir 20 ila 25 devir için hesaplanan T m aşağıda. Ilk aşamasının işlevini doğru ürün için 4 kat avantajı atfetmesi mispriming hafifletmek gerekir. Böylece, 10 döngüsünden sonra, bir 410 kat avantajı, herhangi bir sahte astar üzerine doğru ürünün 4096 kopyalarını doğuracak.
    • Stepdown PCR astarlamak ilk aşamada az artışlarla TD-PCR benzer. Örnek olarak, ilk aşamada tavlama her düşürür3 ° C ile ikinci aşama, ° C 10 yukarıda başlayan ve ° C hesaplanan T m altına 2 terbiyesidir. TD-PCR gibi, faz iki tavlama sıcaklığı 5 ayarlanmış olan standart 3-adım koşulları kullanır ° C başka bir 20 ila 25 devir için hesaplanan T m aşağıda. Bu doğru ürünü yanlış astar üzerinde ürün 256 kat avantaj sağlayacaktır.
    • Düşüşün PCR sadece TD-PCR bir değişiklik ve son derece zengin bir GC (yukarıda% 83) dizileri (Tablo 6) yükseltilmesi için başarılı olmuştur. Kavramı dikkate rampalı hız ayarlama gibi soğutma hızı sağlar Modern termal cycler cihazları ile ilişkili oldukça yeni bir özelliği taşır. Protokolü olabilir reaksiyonu önlememesi 2 ° yapısı oluşumunu azaltmak için dc 7 GTP kullanmaktadır. Rampası hızı 2,5 'ye düşürülmüştür ° tavlama devir için 1.5 ° C s -1 bir soğutma hızı ile C s -1. İlk aşamada bir bir ile başlar70 ° C arasında sıcaklıkta nealing ve 1 ile tavlama sıcaklığında azaltır ° C de, her 3 mermi erişene kadar 58 ° C İkinci faz daha sonra ilave bir 15 döngü süresince 58 ° C arasında bir tavlama sıcaklığında devam eder.
  4. Nested PCR sahte ürünler ortadan kaldırmak için kullanılan güçlü bir araçtır. Tek bir genomun içinde birkaç paralogous genlerinin var olan veya bir hedef sekansının, düşük kopya sayısı orthologous sekansları heterojen bir popülasyon içinde olduğu zaman iç içe primerlerin kullanılması yararlıdır. Temel prosedür, tek bir DNA bölgesi amplifiye primerler iki set içerir. Dış astar ilgi segmenti binme ve genellikle spesifik olmayan 20-30 döngülerinde olan PCR ürünleri üretmek için kullanılır. Küçük bir tablet, ilk 50 ul reaksiyon ile, genellikle yaklaşık 5 ul, daha sonra, bir iç konuma göre üzere tav primerlerin ikinci seti kullanılarak başka bir amplifikasyon 20-30 tur için şablon DNA olarak kullanılmaktadırİlk kümesine.

Diğer PCR protokolleri daha fazla uzman ve bu yazının kapsamını aşar. Örnekler YARIŞ-PCR, Multiplex-PCR, Vectorette-PCR, kantitatif-PCR ve RT-PCR bulunmaktadır.

13. Temsilcisi Sonuçlar

Temsilci PCR sonuçlar bazik PCR protokolleri yukarıda tarif izlenerek elde edildi. Elde edilen sonuçlar, reaksiyon üzerinde çeşitli ayıraçlar ve koşulların etkisini göstermek için çeşitli giderme stratejiler içermektedir. Maya Saccharomyces cerevisiae gelen ve bir uncharacterized Mycobacteriophage gelen genlerin bu deneylerde çoğaltıldı. Tablo 2'de anlatılan standart 3 aşamalı PCR protokolü aşağıda açıklanan tüm üç deney için kullanılmıştır.

S. hem PCR deney, genomik DNA ayarlamadan önce cerevisiae ve Mycobacteriophage olur allo bir konsantrasyona seyreltildi ve nicelReaksiyon başına DNA w 7 4 10 ile 10 arasında moleküller. Çalışma stokları aşağıdaki gibi hazırlanmıştır. A genomik DNA'nın hazırlanması maya ul / 10 ng 4 vermiştir. 10 ng / ml A seyreltme TE pH 8.0 tampon 452 ul içine 48 ul eklenerek oluşturulmuştur. S. beri cerevisiae genomunun 12.5 Mb, ng 7.41 X 10 5 molekülleri içeren yaklaşık 10. Genomik Mycobacteriophage DNA hazırlığı 313 ng / ml vermiştir. 2 ng / ul için bir seyreltme TE pH 8.0 tampon içinde 6.4 ul 993,6 ul ilave edilerek elde edildi. Bu faj DNA 67 Kb ilgilidir. Böylece, 1 ng genellikle bir PCR için kullanılmıştır DNA üst limit olarak ise X 2,73 10 7 molekülleri, içerir. Çalışma stokları sonra Tablo 7'de belirtildiği ana Karışım çözümler üretmek için kullanıldı. Aşağıda açıklandığı gibi deneyler bisiklet koşulları değişmiştir.

S. gelen Şekil 3a, genomik DNA cerevisiae yükseltmek için bir şablon olarak kullanılmıştırgalaktoz metabolizması dahil bir proteini kodlayan geni GAL3,. Bu deney için hedef reaktifler bu set için optimal Mg 2 + konsantrasyonunun belirlenmesi amaçlanmıştır. Hayır MgCl2 orijinal PCR buffer 'da bulunan ve 0.0 mM 5,0 mM test bir dizi ile belirtilen konsantrasyonlarda takviye gerekiyordu. Şekilde gösterildiği gibi, beklenen boyutu (2098 bp) bir PCR ürünü, bir Mg 2 4,0 azından optimal bir konsantrasyon ile 2.5 mM + konsantrasyonu (şeridi 6) mM (şeritli 9) başlayarak görünür. Üretici tarafından tavsiye edilen konsantrasyon sağlanan tipik PCR tampon içinde temin miktarı 1.5 mM, idi. Belki şaşırtıcı olan, bu deneyde ürün oluşumu için ihtiyaç duyulan konsantrasyonu bu miktarı aşmıştır.

Farklı bir DNA şablonu Şekil 3b sunulan deney için kullanılmıştır. Bir Mycobacteriophage genomik DNA, bir korunmuş 566 bp DNA kısmı yükseltmek için kullanılmıştır.Önceki deneyde olduğu gibi, uygun Mg 2 + konsantrasyonunun tespit edilmesi için sahipti. Şekil 3b'de gösterildiği gibi, istenen ürün PCR amplifikasyonu, en azından 2.0 mM Mg gerektirir 2 + (yol 5). MgCl2 artan konsantrasyonları azından oluşan ürünün miktar daha değişkenlik de iken, en PCR ürünü, 4 mM gözlenmiştir Mg 2 + (şeritli 9), maya GAL3 geni için gözlenen aynı konsantrasyonu.

Şekil 3A ve 3B sunulan deneylerde, ayrı bir grup astar tavlama dayalı olarak en uygun olduğu düşünülen bisiklet koşullar kullanılarak elde edilmiştir dikkat edin. Spesifik olarak, denatürasyon sıcaklığı 61 ° C arasında bir sıcaklıkta tavlama ile 95 ° C idi ve uzantısı 72 olan 1 dakika için gerçekleştirilmiştir ° C'de 30 döngü süresince. Nihai 5 dakikalık bir uzantısı daha sonra 72 ° C'de yapıldı Şekil 3C sunulan üçüncü bir deney için Şekil 3c 'de gösterildiği gibi, Şekil 3a bir ayrık grubu ne olduğunu, bu alt-optimal bisiklet koşullar altında spesifik olmayan bir ürün yayma olur. Dahası, azaltılmış reaksiyon genel sıkılığına ile, Mg 2 daha düşük bir miktarda + bir amplikon oluşturmak için gereklidir.

Bütün deneyler üç Mg 2 + konsantrasyonları çok düşük olduğu zaman, hiçbir amplikon üretimi olduğunu göstermektedir. Bu sonuçlar da göstermektedir ki zaman bisiklet koşulları hem dedoğru tasarlanır ve reaktifler optimum konsantrasyonu altındadır edilir, PCR deneyi beklenen boyutuna karşı gelen bir gizli amplikon üretir. Sonuçlar yeterince yüksek darlığı (smear karşı örneğin, sağduyulu bantları) de PCR deneyler önemini göstermektedir. Dahası, deneyler, bir parametre değişen, böylece tepkime sonucu etkileyen başka bir parametre etkileyebilir göstermektedir.

Reaktif Stok çözümleri Konsantrasyon Hacim 13X **
Master Mix
Nihai konsantrasyon
Steril H 2 O 50 ul için QS 650 ul için QS
PCR Tamponu 10X 5 ul 65 ul 1X
dNTP Kullanıcı 10 mM 1 ul 13 ul 200 uM
MgCl2 25 mM 3 ul 39 ul 1.5 mM
İleri Astar 20 uM = 20 pmol / ul 1 ul 13 ul 20 pmol
Astar Ters 20 uM = 20 pmol / ul 1 ul 13 ul 20 pmol
Şablon DNA Değişken Değişken Değişken ~ 10 5 Moleküller
Taq DNA Polimeraz 5 Adet / ul * 0.5 ul Ul 6.5 2.5 Birimler
50 ul / Reaksiyon

Tablo 1 için. PCR reaktifler bunların ilave edilmelidir.

* Birimler üreticiler arasında değişebilir

** Titrasyonu ihtiyacı olan herhangi bir ya da tepki değişken olabilir hariç Master Mix tüm reaktifleri ekleyin. Yukarıdaki tabloda tasvir Master Mix Her reaksiyon tüpüne kısım için yeterli olduğundan eminseniz pipet transfer kaybı karşılamak için 11 tepkiler artı 2 ekstra reaksiyonlar için hesaplanır.

Standart 3 aşamalı PCR Bisiklete binme
Döngü adım Sıcaklık Zaman Döngü sayısı
İlk Denatürasyon 94 ° C ila 98 ° C 1 dakika 1
Denatürasyon
Tavlama
Uzatma
94 ° C
5 ° C T m aşağıya
70 ° C ila 80 ° C
10-60 saniye
30 saniye
Bağımlı Amplikon ve DNA polimeraz
25-35
Final Uzatma 70 & dörneğin; C ila 80 ° C 5 dakika 1
* Tutun 4 ° C 1

Tablo 2. Standart 3 aşamalı PCR Bisiklete binme.

* En termal cycler cihazları ° C süresiz devir sonunda 4 duraklatmak için yeteneği var.

70 ° C ila 80 ° C
2 aşamalı PCR Bisiklete binme
Döngü adım Sıcaklık Zaman Döngü sayısı
İlk Denatürasyon 94 ° C ila 98 ° C 1 dakika 1
Denatürasyon
/ Uzatma Tavlama
10-60 saniye
Bağımlı Amplikon ve DNA polimeraz
25-35
Final Uzatma 70 ° C ila 80 ° C 5 dakika 1

Tablo 3. 2 aşamalı PCR Bisiklete binme.

Sıcak Başlangıç ​​PCR Bisiklete binme
Döngü adım Sıcaklık Zaman Döngüler
İlk Denatürasyon 60 ° C ila 95 ° C 5 dakika sonra DNA polimeraz ekleyin 1
Denatürasyon
Tavlama
Uzatma
94 ° C
5 ° C T m aşağıya
70 ° C ila 80 ° C
10-60 saniye
30 saniye
Bağımlı Amplikon ve DNA polimeraz
25-35
Final Uzatma 70 ° C ila 80 ° C 5 dakika 1

Tablo 4. Sıcak Başlangıç ​​PCR Bisiklete binme.

Touchdown PCR Bisiklete binme
Döngü adım Sıcaklık Zaman Döngüler
İlk Denatürasyon 94 ° C ila 98 ° C 1
Denatürasyon
Tavlama
Uzatma
94 ° C
X = 10 ° C T m yukarıda
70 ° C ila 80 ° C
10-60 saniye
30 saniye
Bağımlı Amplikon ve DNA polimeraz
2
Denatürasyon
Tavlama


Uzatma
94 ° C
X-1 ° C azaltmak 1 ° C diğer her döngüsü
70 ° C ila 80 ° C
10-60 saniye
30 saniye
Amplikon ve bağımlı polimeraz
28
Denatürasyon
Tavlama
Uzatma 94 ° C
5 ° C T m aşağıya
70 ° C ila 80 ° C
10-60 saniye
30 saniye
Bağımlı Amplikon ve DNA polimeraz
20-25
Final Uzatma 70 ° C ila 80 ° C 5 dakika 1

Tablo 5. Touchdown PCR Bisiklete binme.

Yavaşlama PCR Bisiklete binme
Döngü adım TemSıcaklık Zaman Döngüler
İlk Denatürasyon 94 ° C ila 98 ° C 1 dakika 1
Denatürasyon
Tavlama
Uzatma
94 ° C
X ° C = 10 ° C T m üzerinde
70 ° C ila 80 ° C
10-60 saniye
30 saniye
Amplikon ve bağımlı polimeraz
2
Denatürasyon
Tavlama


Uzatma
94 ° C
X-1 ° C azaltmak 1 ° C diğer her döngüsü
70 ° C ila 80 ° C *
10-60 saniye
30 saniye
Amplicon ve bağımlı polimeraz
28
Denatürasyon
Tavlama
Uzatma
94 ° C
5 ° C T m aşağıya
70 ° C ila 80 ° C
10-60 saniye
30 saniye
Amplikon ve bağımlı polimeraz
20-25
Final Uzatma 70 ° C ila 80 ° C 5 dakika 1

Tablo 6. Düşüşün PCR Bisiklete binme.

* Yavaşlama PCR için rampa hızı 2,5 'ye düşürülmüştür ° tavlama devir için 1.5 ° C s -1 bir soğutma hızı ile C s -1.

Stok Çözüm Cilt 50 ul reaksiyon eklendi 13 X Maya Master Mix 13 X Faj Master Mix Nihai konsantrasyon
Steril H 2 O 50 ul için qs = 31 ul veya 30.5 qs 650 ul için = 396.5 520 ul = 403 ul için qs
PCR Tamponu 10X 5 ul 65 ul 65 ul 1X
10 mM 1 ul 13 ul 13 ul 200 uM
MgCl2 Titrasyon Her reaksiyon için eklendi Her reaksiyon için eklendi Her reaksiyon için eklendi Titrasyon bkz değişkenine
İleri Astar 20 uM = 20 pmol / ul 1 ul 13 ul 13 ul 20 pmol
Astar Ters 20 uM = 20 pmol / ul 1 ul 13 ul 13 ul 20 pmol
Şablon DNA 2 ul ng / faj veya 10 ul ng / Maya 0.5 ul Faj veya 1 ul Maya Ul 6.5 13 ul ~ 10 7 Moleküller Faj veya ~ 10 5 Moleküller Maya
Polimeraz 0.5 Birimler / ul ** 0.5 ul Ul 6.5 Ul 6.5 0.5 Birimler / Reaksiyon
40 ul + 10 (Titrasyon) ul / Reaksiyon TİTRASYON
[MgCl2] 0.00 mM 0.5 mM 1.0 mM 1.5mM 2.0 mM 2.5 mM 3.0 mM 3.5 mM 4.0 mM 4.5 mM 5.0 mM
MgCl2 0.00 ul 1.00 ul 2.00 ul 3.0 ul 4.00 ul 5.00 ul 6.00 ul 7.00 ul 8.00 ul 9.00 ul 10.00 ul
H2O 10.00 ul 9.00 ul 8.00 ul 7.00 ul 6.00 ul 5.00 ul 4.00 ul 3.00 ul 2.00 ul 1.00 ul 0.00 ul

<Güçlü> Tablo 7'de. Mg 2 titrasyonu + Şekil 3 'de kullanılır.

Şekil 1
Şekil 1. Astar ve hedef DNA 3 adım PCR ile ortaya çıkan ortak sorunlar. (A) sekonder firkete halka yapısının oluşumu ile sonuçlanarak primerlerin Kendinden tavlama. Primerler her zaman aşırı uçta tav olmayan ve daha küçük döngü yapıları oluşturmak unutmayın. (B) Primer astar dimerleri oluşturmak yerine, DNA şablonu daha birbirine tavlama. Primerler birbirine tavlama bir kez de astar uçlarına uzunlamasına olacaktır. (C) PCR döngüsü, belirli bir amplikon üreten. Standart 3 aşamalı PCR bisiklet şablon DNA denatürasyon, primer tavlama ve DNA polimeraz tarafından hedef DNA (amplikon) uzantısı sayılabilir.

Şekil 2
Reag Şekil 2. Buz kovasıveliler, pipetler ve raflar bir PCR için gerekli. (1). P-200 pipetle, (2). P-1000 pipetle, (3). P-20 pipetle, (4). P-10 pipetle, (5). 96 kuyulu plakanın ve 0.2 ml ince çeperli PCR tüpler , Taq polimeraz, 10X PCR tamponu, MgCl2, steril su, dNTPs, primerler ve şablon DNA, (7). 1.8 ml tüpler ve raf dahil olmak üzere (6). Reaktifler.

Şekil 3
Şekil 3. Standart bir 3 aşamalı PCR protokolü kullanılarak PCR deney optimize etmek için kullanılan bir Mg 2 + titrasyonları örneği. (A) S. cerevisiae genomik DNA, bir 2098 bp GAL3 genini çoğaltmak için bir şablon olarak kullanılmıştır. In şeritlerinin 1-6, Mg 2 + konsantrasyonu çok düşük olduğu durumlarda, ya bir ürün meydana (şeritlerinin 1-5) ya da çok az bir ürünün (şeritli 6) oluşan vardır. Şeritlerinin 7 - 2098 bp amplikon ürünün varlığı ile gösterildiği gibi 11 + Bu deney için PCR Mg 2 optimum konsantrasyonu temsil eder. (B) Bir uncharacterized mycobacteriophage genomik DNA şablon bir 566 bp amplikon yükseltmek için kullanılmıştır. Şeritlerinin 1-4, Mg 2 + konsantrasyonu olarak ürünün yokluğu ile gösterildiği gibi, çok düşüktür. Şeritlerinin 5-11 olarak 566 kb amplikon ürünün varlığı ile gösterilen + Bu PCR için Mg 2 optimum konsantrasyonu temsil eder. (C). S. cerevisiae genomik DNA paneli, bir belirtildiği gibi, bir 2098 bp GAL3 genini çoğaltmak için bir şablon olarak kullanılmıştır. Bununla birlikte, tavlama sıcaklığının 58-61 ° C düşürülmüştür ° C, agaroz jeli üzerine bulaşma etkisi üretmek değişken uzunlukta bir non-spesifik PCR bantları ile sonuçlanır. Lanes 1 - 4, Mg 2 + konsantrasyonunun çok düşük olduğu, herhangi bir ürün yoktur kurdu. Lanes 5 - 8 2098 kb amplikon ürün boyutu etrafında bir karalama ve bant varlığı ile görüldüğü gibi + bu PCR için Mg 2 optimum konsantrasyonu temsil eder. Lanes 9 - 11 oluşan bir ürün ile aşırı derecede zor koşullar göstergesidir. (AA) Lanes 12 negati olduğunuHerhangi bir DNA içermiyordu kontrol ettik. Lane M (işaretleyici) NEB 1kb Merdiven ile yüklendi.

Şekil 4
Şekil 4'e. PCR için kullanılmıştır Steril borular. (1). 1.8 ml tüp (2). 0.2 ml tek tek ince duvarlı PCR tüp, (3). 0.2 ml şeridi ince duvarlı PCR tüpleri ve bereler.

Şekil 5,
Şekil 5. Termal cycler. Termal döngü sol görüntü kapalıdır. Sağ görüntü açık bir termal döngü ile ısıtma bloğu yerleştirilir 0.2 ml ince duvarlı PCR tüpleri içerir.

Discussion

PCR biyolojik bilim cephanelik vazgeçilmez bir araç haline gelmiştir. PCR genomlar ve çeşitliliğin yanı sıra, daha fazla biyokimyasal analiz için sadece klonlama genler ilgili bilgi sağlamak, özel ve doğru bir klinik test sağlayan, biyologlar genomlarını gücü verim ve yeni fonksiyonları ile hibrid genlerin yapmak için izin bilim elbette değiştirdi. PCR uygulaması sadece kendi gücünü kullanır bilim adamı hayal gücü ile sınırlıdır. Orada PCR yeni özel kullanır tanımlayan pek çok kitap ve makaleler, ve daha birçok biyolojik bilim nesil içinde geliştirilecektir. Ancak, ne olursa olsun, beklenen yaklaşımlar, temel çerçeve aynı kalmıştır. PCR, tüm Haşmetli, DNA segment belirli bir miktarda elde etmek için bir in vitro bir uygulamadır.

PCR deney tasarlama düşünce ve sabır gerektirir. Şekil 3'te gösterilen sonuçlar büyük CH biri örneklendirmekPCR için bir optimizasyon stratejisini tasarlarken allenges. PCR ile bir parametre olarak değişir, bu, başka bir etkileyebilir. İlk PCR optimal bir Mg 2 2.0 mM + konsantrasyonu ile optimal tavlama sıcaklığında (58 ° C) gerçekleştirilmiştir halinde, örnek olarak, daha sonra Sonuç Şekil 3c 'de görüldüğü gibi, bir yayma üretecektir. Smear çözmek için bir girişimde 2.0 mM MgCl2 içeren reaksiyonlar PCR koşulları kurma ve 61 ° C'ye tavlama sıcaklığının ayarlanması içerebilir Bununla birlikte, Şekil 3a de görüldüğü gibi, bu herhangi bir ürünü vermek olmaz. Sonuç olarak, daha ziyade istenmeyen sonuçlar giderme olduğunda, tek bir reaksiyon için bir konsantrasyonda eklenmesi dışında, reaktifler titre tavsiye edilir. Ayrıca, bir PCR deneyi optimize etmek için gerekli olan en yaygın ayarlamalar Mg 2 + konsantrasyonu değiştirmek için ve tavlama düzeltmek için bulunmaktadır. Ancak, bu değişiklikler en aza indirmek veya anormal sonuçlar feshetmek, katk titrasyonu yoksaves ve / veya Tablo 2-6 açıklanan bisiklet koşulu protokolleri değiştirerek sorunu hafifletmek olabilir. Tümü başarısız olursa, astar yeniden tasarlamak ve denemek, yeniden deneyin.

Disclosures

Ben ifşa hiçbir şey yok.

Acknowledgments

Reaktifler kurma ve jeller dökme ve UCLA Erin Sanders ilham, rehberlik ve destek için ve yazının redaksiyon için UCLA Kris Reddi özel teşekkürler. Ben de GAL3 gen yükseltmek için maya genomik DNA ve primer temini için teşekkürler Giancarlo Costaguta ve Gregory S. Payne istiyorum. 4 - Ben de laboratuar ekipmanları ve rakamlar 2 yapmak için kullanılan reaktiflerin resmini çekmek için Bhairav ​​Şah teşekkür etmek istiyorum. Bu proje için finansman HHMI (HHMI Hibe No 52.006.944) tarafından sağlandı.

Materials

Name Company Catalog Number Comments
Taq Polymeras Sigma-Aldrich D4545-25UN
dNTPs Qiagen 201225
0.2 ml Thin Wall Tubes PCR tubes Bio-Rad 223-9469
0.2 ml Thin Wall Tube caps Bio-Rad 223-9472
EDTA disodium salt dihydrate Sigma-Aldrich E5134
Trizma-HCl Sigma-Aldrich T-3253
Custom Phage Primer Invitrogen 25441F_RL6_Contig2_68k TACTGCAACGCGATGTTGCG
Custom Phage Primer Invitrogen 26007R_RL6_ Contig2_68k TCACCATCAATCGTGGCGGT
Custom Yeast Primer Integrated DNA Technologies SacI-Gal3(-256) ACCTGGAGCTCCTATTT TAACATGTGGATTTCTTGAAAGAATGAAATCG
Custom Yeast Primer Integrated DNA Technologies Gal3(1848)-SacI CGGATGGAGCTCGCGT GAAGGTAATTTTTTTTTATGTCTCCG
Thermal Cycler Bio-Rad 170-9703 My Cycler
Agarose ISC BioExpress E-3120-500
Gel electrophoresis Hoeffer Scientific Instruments Model HE33
1 kb DNA Ladder New England Biolabs N3232S
Bio Rad Power Pack Bio-Rad 164-5050 PowerPac Basic
Gel Doc system Fotodyne Incorporated FOTO/Analyst Investigator FX Workstation

DOWNLOAD MATERIALS LIST

References

  1. Albert, J., Fenyo, E. M. Simple sensitive, and specific detection of human immunodeficiency virus type 1 in clinical specimens by polymerase chain reaction with nested primers. J. Clin. Microbiol. 28, 1560-1564 (1990).
  2. Baskaran, N., et al. Uniform amplification of a mixture of deoxyribonucleic acids with varying GC content. Genome Res. 6, 633-638 (1996).
  3. Blanchard, M. M., Taillon-Miller, P., Nowotny, P., Nowotny, V. PCR buffer optimization with uniform temperature regimen to facilitate automation. PCR Methods Appl. 2, 234-240 (1993).
  4. Borer, P. N., Dengler, B., Tinoco, I. Jr, Uhlenbeck, O. C. Stability of ribonucleic acid double-stranded helices. J. Mol. Biol. 86, 843-853 (1974).
  5. Breslauer, K. J., Frank, R., Blocker, H., Marky, L. A. Predicting DNA duplex stability from the base sequence. Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750 (1986).
  6. Chou, Q., Russell, M., Birch, D. E., Raymond, J., Bloch, W. Prevention of pre-PCR mis-priming and primer dimerization improves low-copy-number amplifications. Nucleic Acids Res. 20, 1717-1723 (1992).
  7. Coleman, W. B., Tsongalis, G. J. Diagnostics for the clinical laboration. Humana Press. (2005).
  8. D'Aquila, R. T., et al. Maximizing sensitivity and specificity of PCR by pre-amplification heating. Nucleic Acids Res. 19, 3749 (1991).
  9. Dieffenbach, C. W., Lowe, T. M., Dveksler, G. S. General concepts for PCR primer design. PCR Methods Appl. 3, S30-S37 (1993).
  10. Don, R. H., Cox, P. T., Wainwright, B. J., Baker, K., Mattick, J. S. 'Touchdown' PCR to circumvent spurious priming during gene amplification. Nucleic Acids Res. 19, 4008 (1991).
  11. Erlich, H. A., Gelfand, D., Sninsky, J. J. Recent advances in the polymerase chain reaction. Science. 252, 1643-1651 (1991).
  12. Frey, U. H., Bachmann, H. S., Peters, J., Siffert, W. PCR-amplification of GC-rich regions: 'slowdown PCR. Nat. Protoc. 3, 1312-1317 (2008).
  13. Haqqi, T. M., Sarkar, G., David, C. S., Sommer, S. S. Specific amplification with PCR of a refractory segment of genomic DNA. Nucleic Acids Res. 16, 11844 (1988).
  14. Henke, W., Herdel, K., Jung, K., Schnorr, D., Loening, S. A. Betaine improves the PCR amplification of GC-rich DNA sequences. Nucleic Acids Res. 25, 3957-3958 (1997).
  15. Innis, M. A., Gelfand, D. H., Sninsky, J. J., White, T. J. PCR Protocols: A guide to methods and applications. Academic Press, Inc. San Diego. (1990).
  16. King, N. Methods in Molecular Biology. 630, Humana Press. (2010).
  17. Kleppe, K., Ohtsuka, E., Kleppe, R., Molineux, I., Khorana, H. G. Studies on polynucleotides. XCVI. Repair replications of short synthetic DNA's as catalyzed by DNA polymerases. J. Mol. Biol. 56, 341-361 (1971).
  18. Korbie, D. J., Mattick, J. S. Touchdown PCR for increased specificity and sensitivity in PCR amplification. Nat. Protoc. 3, 1452-1456 (2008).
  19. Kramer, M. F., Coen, D. M. Enzymatic amplification of DNA by PCR: standard procedures and optimization. Curr. Protoc. Toxicol. Appendix 3, 1-14 (2001).
  20. Kramer, M. F., Coen, D. M. The polymerase chain reaction. Curr. Protoc. Protein Sci. Appendix 4, Appendix 4J (2002).
  21. Kreader, C. A. Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein. Appl. Environ. Microbiol. 62, 1102-1106 (1996).
  22. Kwok, S., et al. Identification of human immunodeficiency virus sequences by using in vitro enzymatic amplification and oligomer cleavage detection. J. Virol. 61, 1690-1694 (1987).
  23. McConlogue, L., Brow, M. A., Innis, M. A. Structure-independent DNA amplification by PCR using 7-deaza-2'-deoxyguanosine. Nucleic Acids Res. 16, 9869 (1988).
  24. Mullis, K. B. The unusual origin of the polymerase chain reaction. Sci. Am. 262, 56-65 (1990).
  25. Mullis, K. B. Target amplification for DNA analysis by the polymerase chain reaction. Ann. Biol. Clin. (Paris). 48, 579-582 (1990).
  26. Mullis, K. B. The polymerase chain reaction in an anemic mode: how to avoid cold oligodeoxyribonuclear fusion). PCR Methods Appl. 1, 1-4 (1991).
  27. Mullis, K. B., Faloona, F. A. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol. 155, 335-350 (1987).
  28. Paabo, S., Gifford, J. A., Wilson, A. C. Mitochondrial DNA sequences from a 7000-year old brain. Nucleic Acids Res. 16, 9775-9787 (1988).
  29. Rees, W. A., Yager, T. D., Korte, J., von Hippel, P. H. Betaine can eliminate the base pair composition dependence of DNA melting. Biochemistry. 32, 137-144 (1993).
  30. Roux, K. H., Hecker, K. H. One-step optimization using touchdown and stepdown PCR. Methods Mol. Biol. 67, 39-45 (1997).
  31. Rychlik, W., Spencer, W. J., Rhoads, R. E. Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res. 18, 6409-6412 (1990).
  32. Saiki, R. K., et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 239, 487-491 (1988).
  33. Saiki, R. K., et al. Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science. 230, 1350-1354 (1985).
  34. Sambrook, J. A. R., David, W. Molecular Cloning A Laboratory Manual. 2, 3, Cold Spring Harbor Laboratory Press. (2001).
  35. Sarkar, G., Kapelner, S., Sommer, S. S. Formamide can dramatically improve the specificity of PCR. Nucleic Acids Res. 18, 7465 (1990).
  36. Smit, V. T., et al. KRAS codon 12 mutations occur very frequently in pancreatic adenocarcinomas. Nucleic Acids Res. 16, 7773-7782 (1988).
  37. Wilson, I. G. Inhibition and facilitation of nucleic acid amplification. Appl. Environ. Microbiol. 63, 3741-3751 (1997).
  38. Wu, R. Methods in Enzymology. 218, Academic Press, Inc. San Diego. (1993).

Comments

1 Comment

  1. Thanks for the great overview of the all-important PCR procedure. I will no doubt reference it often in the future.

    I have a PCR troubleshooting question...what do to about streaking on the gel after a successful amplification? My bands are nice and bright and where they are supposed to be, but there is a heavily-streaked "path" starting at the wells and following until the end where my bands are. Is there something I can do about my PCR conditions, or the thermocycler settings? Any comments would be appreciated.

    Reply
    Posted by: Doug E.
    September 8, 2013 - 1:23 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics