केन्द्रीय तंत्रिका तंत्र से Transducing कक्ष के लिए lentiviral वैक्टर का उत्पादन

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

इस प्रोटोकॉल में हम उत्पादन, शोधन, और lentiviral वैक्टर का अनुमापन का वर्णन. हम lentiviral वेक्टर की मध्यस्थता प्राथमिक सभ्य न्यूरॉन्स और astrocytes में जीन वितरण का एक उदाहरण प्रदान करते हैं. हमारे तरीकों में भी अन्य प्रकार की कोशिकाओं को लागू कर सकते हैं

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Li, M., Husic, N., Lin, Y., Snider, B. J. Production of Lentiviral Vectors for Transducing Cells from the Central Nervous System. J. Vis. Exp. (63), e4031, doi:10.3791/4031 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Protocol

1. Lentiviral वैक्टर की पैकेजिंग

Lentiviral वैक्टर हैं एक lentiviral हस्तांतरण के वेक्टर और अन्य को 293T कोशिकाओं में कैल्शियम फॉस्फेट अभिकर्मक विधि द्वारा पैकेजिंग के लिए आवश्यक प्लास्मिड का cotransfection से उत्पादित कर रहे हैं. हम इस प्रोटोकॉल में 10 100 मिमी ऊतक संस्कृति बर्तन का उपयोग करें. यह बढ़ाया जा सकता है या नीचे आवेदन पर निर्भर करता है. 293T सेल लाइन है Dulbecco बार संशोधित ईगल्स मध्यम (DMEM) में उच्च ग्लूकोज (4500 मिलीग्राम / एल) के साथ बनाए रखा है, 10% भ्रूण गोजातीय (FBS) सीरम, 100 इकाइयों / एमएल पेनिसिलिन, 100 37 डिग्री सेल्सियस में स्ट्रेप्टोमाइसिन / μg एमएल के साथ पूरक 5% सीओ 2 के साथ इनक्यूबेटर.

  1. बीज 10 मध्यम संस्कृति में 100 मिमी ऊतक संस्कृति व्यंजन (3 एक्स 10 6 कोशिकाओं / पकवान) 293T 30-40% संगम पर कोशिकाओं. इनक्यूबेटर में कोशिकाओं लौटें.
  2. 20-24 घंटे संस्कृति के बाद, सेल घनत्व की जाँच करें. कोशिकाओं अभिकर्मक के समय के बारे में 80% संगम होना चाहिए.
  3. एक 50 मिलीलीटर ट्यूब तैयार. 4.4 TE79/10 मिलीलीटर (1 मिमी TrisHCl है, 0.1 मिमी जोड़ेंEDTA, पीएच 7.9 निम्नलिखित प्लास्मिड डीएनए ऋण की कुल मात्रा). 100 प्लाज्मिड lentiviral हस्तांतरण (चित्रा 1), 58 μg / pMDLg pRRE, 31 μg pCMV, जी, 25 μg pRSV रेव, 600 μl 2M 2 CaCl. Μg जोड़ें धीरे मिश्रण.
  4. एक और 50 मिलीलीटर ट्यूब तैयार. 5 मिलीलीटर 2x HBS (0.05 एम HEPES के, 0.28 एम, NaCl 1.5 मिमी ना 2 4 HPO, 7.12 पीएच) जोड़ें.
  5. 10 मिलीलीटर विंदुक द्वारा डीएनए - CaCl 2 मिश्रण ले लो और 2 एक्स [युनाइटेड स्टेट्स ऑफ अमेरिका, जबकि ट्यूब dropwise vortexing युक्त ट्यूब में जोड़ें.
  6. 30 मिनट के लिए कमरे के तापमान (आर टी) में तेज़ी प्रतिक्रिया रखें.
  7. इनक्यूबेटर से संस्कृति बर्तन निकालें. में वर्षण प्रतिक्रिया अच्छी तरह मिक्स vortexing द्वारा. प्रत्येक 100 मिमी पकवान युक्त कोशिकाओं को निलंबन की 1 मिलीलीटर जोड़ें. निलंबन धीरे धीरे, dropwise जबकि धीरे पकवान में मध्यम घूमता जोड़ा जाना चाहिए. इनक्यूबेटर में इन व्यंजनों लौटें और 5 घंटे के लिए छोड़ दें.
  8. संस्कृति से मध्यम निकालें. 6 मिलीग्राम ताजा संस्कृति 6 मिमी सोडियम बू युक्त मध्यम जोड़ेंप्रत्येक पकवान tyrate. इनक्यूबेटर में संस्कृतियों लौटें. रातोंरात संस्कृति के बाद, अगर वहाँ निर्माण में एक फ्लोरोसेंट रिपोर्टर है, फ्लोरोसेंट खुर्दबीन के नीचे जाँच रिपोर्टर जीन की अभिव्यक्ति. आमतौर पर, कक्षों की 80% से अधिक रिपोर्टर जीन व्यक्त अगर यह एक देशव्यापी प्रमोटर (जैसे सीएमवी प्रमोटर) के द्वारा संचालित है.
  9. दो दिन (40-44 ज) अभिकर्मक के बाद, 10 व्यंजनों से 2 50 मिलीलीटर की ट्यूब (प्रत्येक ट्यूब के बारे में 30 मिलीलीटर) में सतह पर तैरनेवाला इकट्ठा. -80 डिग्री सेल्सियस फ्रीजर में सतह पर तैरनेवाला रुक या अगले चरण पर जाएँ.

2. एकाग्रता और वैक्टर के शोधन

  1. अपकेंद्रित्र हौसले से एकत्र या सतह पर तैरनेवाला सतह पर तैरनेवाला में किसी भी सेल मलबा हटाने के लिए 10 मिनट के लिए 900 ग्राम (2000 rpm के बारे में) से thawed.
  2. 0.2 माइक्रोन SFCA सिरिंज फिल्टर करने के लिए एक 60 मिलीलीटर सिरिंज देते हैं. 50 मिलीलीटर की ट्यूब से सतह पर तैरनेवाला सिरिंज करने के लिए स्थानांतरण. एक polyallomer अपकेंद्रित्र ट्यूब में सतह पर तैरनेवाला फ़िल्टर.
  3. 5 मिलीग्राम 20% (पीबीएस में तैयार) 5 मिलीग्राम पिपेट में sucrose के ऊपर ले लो. सम्मिलित करेंअपकेंद्रित्र सतह पर तैरनेवाला युक्त ट्यूब के नीचे करने के लिए विंदुक. धीरे धीरे वेक्टर सतह पर तैरनेवाला के तहत sucrose के समाधान जोड़ने के. अन्य ट्यूब से सतह पर तैरनेवाला के लिए इन चरणों को दोहराएँ.
  4. Rpm के 11,000 और 4 डिग्री सेल्सियस 4 घंटे के लिए के Beckman SW28 स्विंग रोटर के साथ सतह पर तैरनेवाला अपकेंद्रित्र.
  5. सतह पर तैरनेवाला निकालें. प्रत्येक अपकेंद्रित्र ट्यूब के लिए 150 μl 4% लैक्टोज (पीबीएस में तैयार) जोड़ें. छर्रों Resuspend.
  6. सभी अपकेंद्रित्र ट्यूब से 1.5 मिलीग्राम ट्यूब केंद्रित वेक्टर स्थानांतरण. बर्फ पर 15 मिनट के लिए ट्यूब को छोड़ दें.
  7. Pipetting द्वारा वेक्टर निलंबन मिश्रण. 1 मिनट के लिए पूरी गति (सोलह हज़ार के बारे में छ) पर microcentrifuge साथ स्पिन.
  8. एक नया ट्यूब 1.5 मिलीग्राम से सतह पर तैरनेवाला स्थानांतरण. 20 μl aliquots में अंतिम नमूना फूट डालो और उन्हें -80 ° सी फ्रीजर में संग्रहीत.

3. वैक्टर का अनुमापन

  1. 5 बीज 10 x 4/1 मिलीग्राम DMEM 10% FBS के साथ पूरक मध्यम में 12 अच्छी तरह से थाली में अच्छी तरह से HT1080 कोशिकाओं के.
  2. Overnig के बादht के संस्कृति, अच्छी तरह से कोशिकाओं गिनती और सेल नंबर स्कोर.
  3. संस्कृति के माध्यम से ध्यान केंद्रित वेक्टर: 5 गुना धारावाहिक कमजोर पड़ने, और 1:625 1:125 25 01:05, 1. अलग कुओं मैं प्रत्येक पतला वेक्टर की μl जोड़ें. नमूने सटीकता की वृद्धि करने के लिए दोहराया जा सकता है.
  4. प्रत्येक अच्छी तरह से युक्त वेक्टर में और वेक्टर बिना एक अच्छी तरह से में एक μl 4 मिलीग्राम / एमएल Polybrene (Hexadimethrine ब्रोमाइड) जोड़ें. धीरे थाली झटकों से मिलाएं. 48 ज के लिए इनक्यूबेटर पर लौटें.
  5. सेल संस्कृति कुओं से मध्यम निकालें. पीबीएस के साथ एक अच्छी तरह धो लें. 250 μl 1x trypsine EDTA कोशिकाओं का हल जोड़ें. जब कोशिकाओं को अलग कर रहे हैं (3-5 मिनट), 1 मिलीलीटर संस्कृति के माध्यम जोड़ें. Pipetting द्वारा कोशिकाओं Resuspend. सेल निलंबन 1.5 मिलीग्राम अपकेंद्रित्र ट्यूबों के लिए स्थानांतरण.
  6. 6 मिनट के लिए 900 ग्राम अपकेंद्रित्र. एक फ्लोरोसेंट रिपोर्टर जीन (जैसे GFP) के साथ वैक्टर के लिए, FACS विश्लेषण के लिए 3.7 चरण पर जाएँ. एक पत्रकार के बिना वैक्टर के लिए, वास्तविक समय qPCR के लिए 3.8 चरण पर जाएँ.
  7. एक fluo युक्त वैक्टरrescent रिपोर्टर जीन, सतह पर तैरनेवाला हटाने और को पीबीएस में 3.7% formaldehyde के 300 μl के साथ गोली resuspend. FACS विश्लेषण द्वारा संवाददाता सकारात्मक कोशिकाओं के प्रतिशत का निर्धारण करते हैं. टिटर पारगमन प्रति मिली लीटर केंद्रित वेक्टर (TU / एमएल) की इकाइयों के रूप में प्रतिनिधित्व किया जाएगा.

एक समीकरण

उदाहरण के लिए, अगर 1 x 10 5 कोशिकाओं 1/25 (0.04 μl) μl वेक्टर और 30% की कोशिकाओं के साथ transduced संवाददाता सकारात्मक हैं, अनुमापांक हो जाएगा:

2 समीकरण

केवल dilutions सकारात्मक कोशिकाओं के प्रतिशत और वेक्टर की राशि के लिए अनुमापांक गणना जोड़ी के बीच एक रैखिक संबंध में गिर उपयोग. अंतिम अनुमापांक वेक्टर की कम से कम 2 अलग अलग मात्रा का transductions से प्राप्त titers की एक औसत होना चाहिए.

  1. एक के बिना वैक्टर के लिएफ्लोरोसेंट रिपोर्टर जीन, HT1080 निर्माता प्रोटोकॉल के अनुसार QIAamp डीएनए मिनी किट (क्विएज़न) का उपयोग कोशिकाओं से जीनोमिक डीएनए निकाल सकते हैं. जीनोमिक डीएनए में वेक्टर अनुक्रम के (एचआईवी -1 / पीबीएस साई 17 क्षेत्र में) प्राइमरों 5'-CCGTTGTCAGGCAACGTG-3 'और 5'-AGCTGACAGGTGGTGGCAAT-3' के साथ अबी चश्मे 7000 अनुक्रम जांच प्रणाली (एप्लाइड Biosystems) का उपयोग बढ़ाना, और TaqMan जांच 5 'परिवार के AGCTCTCTCGACGCAGGACTCGGC Tamra 3. Albumin जीन है कि जीनोम में एक भी कॉपी जीन (2 / प्रतियां सेल) है प्राइमरों 5'-TGAAACATACGTTCCCAAAGAGTTT के 3 और 5'-CTCTCCTTCTCAGAAAGTGTGCATAT-3 'के साथ भी परिलक्षित किया गया था, और जांच 5'-परिवार - TGCTGAAACATTCACCTTCCATGCAGA Tamra-3 'के रूप में एक आंतरिक नियंत्रण. 2 मिनट, 95 के लिए 15 सेकंड के लिए 50 डिग्री सेल्सियस ° 10 मिनट और 95 के 35 चक्रों के लिए सी डिग्री सेल्सियस और 96 अच्छी तरह से थाली में वेक्टर की प्रतिलिपि संख्या और पीसीआर द्वारा albumin निर्माण निम्नलिखित प्रोग्राम के साथ अनुदेश के अनुसार निर्धारित 60 डिग्री सी 2 मिनट के लिए. दस गुना में जाना जाता है एकाग्रता की plasmids के धारावाहिक dilutions (प्रतिलिपि के रूप में प्रतिनिधित्वसंख्या) टेम्पलेट दृश्यों से युक्त भी अज्ञात नमूनों की मात्रा का ठहराव के लिए एक मानक वक्र बनाने के लिए प्रवर्धित जाना चाहिए. अनुमापांक एकीकरण प्रति मिली लीटर केंद्रित वेक्टर (IU / मिलीलीटर) इकाइयों के रूप में प्रतिनिधित्व किया जाएगा.

3 समीकरण

4. Neocortical संस्कृति की transduction

Neocortical दोनों न्यूरॉन्स और glia युक्त संस्कृतियों माउस चढ़ाना दो कदम प्रक्रिया का उपयोग कर के रूप में पहले 18 में वर्णित cortices से तैयार हैं. Neocortices 14-16 दिनों के गर्भ में भ्रूण चूहों से प्राप्त एक पहले से स्थापित सदस्य में glial monolayer 10% FBS, 20 मिमी और 24 अच्छी तरह से ऊतक संस्कृति थाली में 2 मिमी glutamine के ग्लूकोज के साथ पूरक पर चढ़ाया जाता है.

  1. इन विट्रो में 5 दिनों के बाद, 10 neoc में माइक्रोन साइटोसिन arabinoside (आरा सी)ortical संस्कृति गैर neuronal सेल विभाजन रोकना. संस्कृति 2 दिनों के लिए कोशिकाओं को जारी रखें.
  2. गर्म संस्कृति के माध्यम में 37 डिग्री सेल्सियस 5-10 मिनट के लिए पानी स्नान. आरा - सी ताजा संस्कृति मध्यम (500 μl / अच्छी तरह से) के साथ मध्यम युक्त बदलें.
  3. संस्कृति करने के लिए, वांछित MOI (वेक्टर कणों की संख्या का लक्ष्य कोशिकाओं की संख्या के अनुपात संक्रमण की बहुलता) के साथ वेक्टर जोड़ें. 24 घंटे के लिए संस्कृति को जारी रखें. हम प्राथमिक cortical संस्कृतियों में 1-10 के MOI के (आमतौर पर 5) का उपयोग करें.
  4. ताजा माध्यम से संस्कृति के माध्यम से बदलें. संस्कृति जारी रखें. यदि वहाँ सदिश निर्माण में एक संवाददाता जीन है, पारगमन के बाद 2 दिन फ्लोरोसेंट खुर्दबीन के नीचे कोशिकाओं की जाँच करें. रिपोर्टर जीन अभिव्यक्ति 2-7 न्यूरॉन्स में पारगमन के बाद दिखाई वेक्टर डिजाइन और प्रयोग किया जाता खुराक के आधार पर होगा,.

5. प्रतिनिधि परिणाम

lentiviral इस प्रोटोकॉल रेंज के साथ उत्पादित वैक्टर की titers 8 -10 10 10 IU / मिलीलीटर है, जोज दोनों इन विट्रो में और vivo में CNS से सेल प्रकार की एक किस्म के पारगमन के लिए उपयुक्त हैं तालिका 1 और 2 अंक एक प्रतिनिधि इस प्रोटोकॉल द्वारा उत्पादित वैक्टर का उपयोग कर परिणाम दिखाते हैं. हम transduced murine वैक्टर lentiviral व्यक्त के साथ neocortical संस्कृतियों हरी फ्लोरोसेंट प्रोटीन (GFP) के synapsin (SYN) प्रमोटर या glial सूक्ष्मतंतु सम्बन्धी अम्लीय प्रोटीन प्रमोटर (GFAP) के द्वारा नियंत्रित है. सात दिन के पारगमन के बाद, हम विरोधी NeuN और विरोधी GFAP एंटीबॉडी के साथ लेबल न्यूरॉन्स और astrocytes Immunostaining, क्रमशः प्रदर्शन किया. के रूप में एक मेज और छवि में दिखाया गया है. 2A, वेक्टर साथ पारगमन synapsin प्रमोटर न्यूरॉन्स (NeuN + कोशिकाओं) के 90% से अधिक, ले जाने के बाद व्यक्त GFP और कोई astrocytes (GFAP + कोशिकाओं) इस रिपोर्टर जीन व्यक्त. जब GFAP प्रमोटर वेक्टर निर्माण (छवि 2B) में प्रयोग किया जाता है, astrocytes के बारे में 80% (GFAP + कोशिकाओं) अभिव्यक्तिGFP, सभी GFP + कोशिकाओं astrocytes के रूप में GFAP साथ colocalization और NeuN लेबल की कोशिकाओं में GFP अभिव्यक्ति के अभाव के द्वारा पुष्टि कर रहे हैं. इन परिणामों दिखाना है कि lentiviral वैक्टर बहुत कुशल हैं सीएनएस से कोशिकाओं और सेल विशिष्ट जीन अभिव्यक्ति के लिए transgenes देने हासिल किया जा सकता है जब उचित प्रमोटरों उपयोग किया जाता है.

चित्रा 1
आकृति 1. एचआईवी आधारित lentiviral वैक्टर और पैकेजिंग प्लास्मिड के योजनाबद्ध प्रतिनिधित्व. एचआईवी - 1 provirus शीर्ष पर दिखाया जाता है. तत्व वेक्टर उत्पादन के लिए चार अलग अलग प्लास्मिड में अलग हो रहे हैं. lentiviral प्लाज्मिड हस्तांतरण एक संकर 5 'लीटर जो में U3 क्षेत्र के cytomegalovirus (सीएमवी) के प्रमोटर, पैकेजिंग संकेत (ψ), आरआरई अनुक्रम के, केंद्रीय polypurine के पथ (cPPT), ब्याज की एक जीन (जैसे के साथ बदल दिया है पसंद का एक प्रमोटर के साथ साथ एक फ्लोरोसेंट) रिपोर्टर, और 3 'लीटर में जोसीआईएस विनियामक दृश्यों हैं U3 क्षेत्र से पूरी तरह से हटा रहे हैं. / pMDLg pRRE है झूठ और नीति जीन और सीएमवी प्रमोटर के नियंत्रण के तहत आरआरई अनुक्रम एचआईवी -1 से शामिल हैं. pRSV - रेव रेव की कोडन अनुक्रम RSV प्रमोटर द्वारा संचालित होता है. pCMV जी VSV जी सीएमवी प्रमोटर के नियंत्रण के तहत प्रोटीन जीन शामिल हैं. पीए मानव जीन β-ग्लोबिन से polyadenylation संकेत इंगित करता है.

चित्रा 2
चित्रा 2. माउस neocortical मिश्रित संस्कृति में रिपोर्टर जीन की अभिव्यक्ति lentiviral वैक्टर सेल प्रकार विशिष्ट प्रमोटरों को ले जाने के साथ transduced संस्कृतियों एल.वी. (ए) - SYN GFP या एक 5 MOI (बी) LV-GFAP GFP वैक्टर साथ transduced थे. पारगमन के बाद सात दिनों, कोशिकाओं विरोधी NeuN या विरोधी GFAP एंटीबॉडी के साथ immunostained गया. ऊपरी पैनल GFP प्रतिदीप्ति दिखाने के लिए, मध्य पैनल Immunostaining दिखाने के लिए और कम पैनल छवियों को विलय कर रहे हैं (GFP: हरी, NeuN या GFAP: लाल). वेक्टर GFP + कोशिकाओं न्यूरॉन्स में Astrocytes में GFP से अधिक LV-SYN - GFP 92.2 ± 7.3 0 LV-GFAP - GFP 0 78.3 ± 11.5

तालिका 1. Murine neocortical संस्कृतियों में GFP अभिव्यक्ति की तुलना lentiviral वैक्टर अलग प्रमोटरों को ले जाने के साथ transduced.
murine neocortical संस्कृतियों (5 x 10/5 अच्छी तरह से में 24 अच्छी तरह से थाली) LV-SYN GFP या एल.वी. GFAP - GFP के साथ एक 5 के MOI में transduced गया. पारगमन के सात दिन बाद, संस्कृतियों और तय NeuN या GFAP के लिए immunostained. GFP और / NeuN GFAP व्यक्त कोशिकाओं की संख्या प्रयोगात्मक हालत प्रति 10 क्षेत्रों से छवियों में गिना रहे थे. मान न्यूरॉन्स की प्रतिशतता (NeuN + कोशिकाओं) या का प्रतिनिधित्व करते हैं(GFAP + कोशिकाओं) astrocytes कि GFP रिपोर्टर जीन व्यक्त की. दिखाया मान ± तीन स्वतंत्र प्रयोगों से मतलब है एसडी हैं.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

इस प्रोटोकॉल में, हम neocortical संस्कृतियों में इन वैक्टर lentiviral वैक्टर और आवेदन का उत्पादन दिखाया गया है. हम इन तरीकों द्वारा उत्पादित वैक्टर के साथ कुशल और सेल transduction टाइप विशिष्ट प्रदर्शन किया. जब synapsin प्रमोटर प्रयोग किया जाता है, GFP अभिव्यक्ति सख्ती से न्यूरॉन विशिष्ट है. जब GFAP प्रमोटर प्रयोग किया जाता है, GFP अभिव्यक्ति astrocytes में विशेष रूप से है. यदि कोई सेल प्रकार विशिष्ट अभिव्यक्ति की आवश्यकता है, एक देशव्यापी प्रमोटर इस्तेमाल किया जा सकता है. हम दोनों ubiqutin और phosphoglycerate kinase (PGK) प्रमोटरों neocortical 6 संस्कृतियों में उच्च स्तर जीन अभिव्यक्ति ड्राइव कर सकते हैं पाया. Lentiviral वैक्टर द्वारा संचालित जीन अभिव्यक्ति प्रवर्तकों में से एक विकल्प (जैसे, सर्वव्यापक या प्रकार विशिष्ट सेल) या अलग लिफाफा प्रोटीन या वेक्टर pseudotypes का उपयोग करने के लिए विशिष्ट ऊतकों या अनुप्रयोगों लक्ष्य अभिव्यक्ति या सेल प्रकार के विशिष्ट स्तर के लिए अनुकूलित किया जा सकता है. उदाहरण के लिए, रेबीज जी प्रोटीन या VSV जी की एक संलयन के साथ pseudotypingd रेबीज प्रोटीन पतित axonal 19,20 परिवहन का समर्थन करता है. क्षणिक अभिकर्मक प्रोटोकॉल अलग लिफाफा प्रोटीन के साथ वेक्टर पैकेजिंग की अनुमति देता है.

Lentiviral वैक्टर सामान्यतः बिना शोधन चरणों से ultracentrifugation द्वारा ध्यान केंद्रित कर रहे हैं. इन unpurified वैक्टर कई प्रकार की कोशिकाओं के लिए उपयुक्त हैं. हालांकि, प्राथमिक neuronal संस्कृतियों उत्पादक कोशिकाओं से contaminants के लिए संवेदनशील हैं, बैच में cytotoxicity लिए बैच विभिन्नता के परिणामस्वरूप. 20% sucrose के तकिया शुद्धि कदम वैक्टर प्राथमिक न्यूरॉन्स में गैर विषैले लगातार बनाता है. हम पशुओं में प्राथमिक न्यूरॉन्स और इंजेक्शन के पारगमन के लिए शुद्ध वैक्टर का उपयोग करने की सलाह देते हैं. यदि बड़ी या वेक्टर तैयारी के उच्च शुद्धता पैमाने पर की आवश्यकता है, अन्य शोधन तकनीक, आत्मीयता क्रोमैटोग्राफी और 21 आयनों विनिमय झिल्ली क्रोमैटोग्राफी 22 के रूप में इस्तेमाल किया जा सकता है. के रूप में लंबे समय तक पारगमन प्राथमिक neuronal संस्कृतियों में आम तौर पर आवश्यक है, विशेष सावधानी वैक्टर की तैयारी के दौरान प्रदूषण कम करने के लिए लिया जाना चाहिए. 0.2 माइक्रोन फिल्टर के साथ वेक्टर सतह पर तैरनेवाला पासिंग और वेक्टर की एकाग्रता के दौरान autoclavable polyallomer अपकेंद्रित्र ट्यूबों का उपयोग इस उद्देश्य की सेवा करेंगे. बोतल के शीर्ष फिल्टर अगर सतह पर तैरनेवाला की एक बड़ी मात्रा में फ़िल्टर्ड किया जाना चाहिए इस्तेमाल किया जा सकता है. सोडियम butyrate 23 प्रमोटरों की गतिविधि को प्रोत्साहित करने के लिए सूचित किया गया है. संस्कृति के माध्यम से सोडियम butyrate उत्पादक कोशिकाओं के अभिकर्मक के बाद इसके अलावा 10 से अधिक परतों 24 वेक्टर अनुमापांक वृद्धि कर सकते हैं. Polybrene (hexadimethrine ब्रोमाइड) व्यापक रूप से किया गया है जीन स्थानांतरण प्रोटोकॉल के लिए इस्तेमाल किया नकारात्मक आरोप को निष्क्रिय कर रेट्रोवायरल जीन स्थानांतरण की दक्षता बढ़ाने के लिए, जिससे की वेक्टर सेल 25 बातचीत की सुविधा. हमारे हाथ में polybrene neocortical संस्कृतियों में न्यूरॉन्स को विषाक्त है. इसलिए, polybrene प्राथमिक तंत्रिका संस्कृतियों transducing करने में बचा जाना चाहिए. अगर वहाँ हैवेक्टर में एक फ्लोरोसेंट संवाददाता, FACS विश्लेषण वेक्टर अनुमापांक द्वारा निर्धारित करने के लिए सुविधाजनक है. जब कोई पत्रकार उपलब्ध है या एक संवाददाता जीन लक्ष्य कोशिकाओं में वेक्टर के एकीकरण का पता लगाने के लिए एक ऊतक के विशिष्ट प्रमोटर qPCR, द्वारा संचालित है वेक्टर के एकीकरण transgene अभिव्यक्ति की स्वतंत्र रूप में एक बेहतर विकल्प होना चाहिए. विशिष्ट FACS विश्लेषण द्वारा निर्धारित वैक्टर अनुमापांक qPCR की तुलना में वेक्टर के एकीकृत नहीं सभी प्रतियों के रूप में कार्य कर रहे हैं कम हो जाएगा. वेक्टर titers भी एचआईवी वेक्टर तैयारी में ELESA या qRT-पीसीआर द्वारा वेक्टर जीनोमिक शाही सेना द्वारा p24 प्रोटीन को मापने के द्वारा निर्धारित किया जा सकता है. हालांकि, इन तरीकों के कारण दोषपूर्ण वायरल अनिवार्यत: पैकेजिंग प्रक्रिया और कार्यात्मक कणों कि सफलतापूर्वक लक्ष्य कोशिकाओं नहीं 26 transduce करते दौरान उत्पन्न कणों के महत्वपूर्ण संख्या कम सही कर रहे हैं. इस प्रोटोकॉल के द्वारा बनाई गई वैक्टर दोनों में इन विट्रो में और vivo में किया गया है सफलतापूर्वक भूमिका में इस्तेमाल कियासेंध मस्तिष्क 27. जांचकर्ता अपने सिस्टम में व्यक्तिगत रूप से परीक्षण करना चाहिए, सदिश की मध्यस्थता जीन की अभिव्यक्ति के रूप में सेल संस्कृतियों में और vivo प्रणाली में एक ही सेल प्रकार 6,28 में भी जरूरी समान नहीं है. Lentiviral वैक्टर व्यापक रूप से किया गया है overexpressing के लिए या नीचे CNS में सेल प्रकार की एक किस्म में ब्याज की जीन दस्तक इस्तेमाल किया. हमारे प्रोटोकॉल के लिए तंत्रिका विज्ञान जांचकर्ताओं उनके अनुसंधान अनुप्रयोगों में lentiviral वैक्टर विकसित करने के लिए सहायक हो सकता है चाहिए.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

ब्याज की कोई संघर्ष की घोषणा की.

Acknowledgments

इस काम में NIH न्यूरोसाइंस खाका कोर वाशिंगटन विश्वविद्यालय, प्रोग्राम परियोजना अनुदान NS032636 (BJS) के लिए अनुदान (NS057105 p30, BJS) के द्वारा और मस्तिष्क संबंधी विकार के लिए आशा है कि केंद्र द्वारा समर्थित किया गया.

Materials

Name Company Catalog Number Comments
DMEM Sigma-Aldrich D5796
MEM Invitrogen 11090-081
Fetal bovine serum Hyclone SV3001403
PBS Mediatech, Inc. 21-040-CM
Trypsin-EDTA Sigma-Aldrich T3924
Sodium butyrate Sigma-Aldrich B5887
Hexadimethrine bromide (Polybrene) Sigma-Aldrich H9268
293T cells ATCC CRL-11268
HT1080 cells ATCC CCL-121
Falcon 100 x 20 mm tissue culture dish BD Biosciences 353003
1 x 3 ½ in polyallom–r centrifuge tube Beckman Coulter Inc. 326823
0.2-micron syringe filter Corning 431219
QIAamp DNA Mini Kit Qiagen 51304

DOWNLOAD MATERIALS LIST

References

  1. Naldini, L. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science. 272, 263-267 (1996).
  2. Zufferey, R. Self-inactivating lentivirus vector for safe and efficient in vivo gene delivery. J. Virol. 72, 9873-9880 (1998).
  3. Davidson, B. L., Breakefield, X. O. Viral vectors for gene delivery to the nervous system. Nat. Rev. Neurosci. 4, 353-364 (2003).
  4. Gascon, S., Paez-Gomez, J. A., Diaz-Guerra, M., Scheiffele, P., Scholl, F. G. Dual-promoter lentiviral vectors for constitutive and regulated gene expression in neurons. J. Neurosci. Methods. 168, 104-1012 (2008).
  5. Hioki, H. Efficient gene transduction of neurons by lentivirus with enhanced neuron-specific promoters. Gene Ther. 14, 872-882 (2007).
  6. Li, M. Optimal promoter usage for lentiviral vector-mediated transduction of cultured central nervous system cells. J. Neurosci. Methods. 189, 56-64 (2010).
  7. Naldini, L., Blomer, U., Gage, F. H., Trono, D., Verma, I. M. Efficient transfer, integration, and sustained long-term expression of the transgene in adult rat brains injected with a lentiviral vector. Proc. Natl. Acad. Sci. U.S.A. 93, 11382-11388 (1996).
  8. Blomer, U. Highly efficient and sustained gene transfer in adult neurons with a lentivirus vector. J. Virol. 71, 6641-6649 (1997).
  9. Consiglio, A. Robust in vivo gene transfer into adult mammalian neural stem cells by lentiviral vectors. Proc. Natl. Acad. Sci. U.S.A. 101, 14835-14840 (2004).
  10. Jakobsson, J., Ericson, C., Jansson, M., Bjork, E., Lundberg, C. Targeted transgene expression in rat brain using lentiviral vectors. J. Neurosci. Res. 73, 876-885 (2003).
  11. Arya, S. K., Guo, C., Josephs, S. F., Wong-Staal, F. Trans-activator gene of human T-lymphotropic virus type III (HTLV-III). Science. 229, 69-73 (1985).
  12. Sirven, A. The human immunodeficiency virus type-1 central DNA flap is a crucial determinant for lentiviral vector nuclear import and gene transduction of human hematopoietic stem cells. Blood. 96, 4103-4110 (2000).
  13. Burns, J. C., Friedmann, T., Driever, W., Burrascano, M., Yee, J. K. Vesicular stomatitis virus G glycoprotein pseudotyped retroviral vectors: concentration to very high titer and efficient gene transfer into mammalian and nonmammalian cells. Proc. Natl. Acad. Sci. U.S.A. 90, 8033-8037 (1993).
  14. Farson, D. A new-generation stable inducible packaging cell line for lentiviral vectors. Hum. Gene Ther. 12, 981-997 (2001).
  15. Broussau, S. Inducible packaging cells for large-scale production of lentiviral vectors in serum-free suspension culture. Mol. Ther. 16, 500-507 (2008).
  16. Wang, X., McManus, M. Lentivirus production. J. Vis. Exp. (32), e1499 (2009).
  17. Sastry, L., Johnson, T., Hobson, M. J., Smucker, B., Cornetta, K. Titering lentiviral vectors: comparison of DNA, RNA and marker expression methods. Gene Ther. 9, 1155-1162 (2002).
  18. Snider, B. J., Lobner, D., Yamada, K. A., Choi, D. W. Conditioning heat stress reduces excitotoxic and apoptotic components of oxygen-glucose deprivation-induced neuronal death in vitro. J. Neurochem. 70, 120-129 (1998).
  19. Mazarakis, N. D. Rabies virus glycoprotein pseudotyping of lentiviral vectors enables retrograde axonal transport and access to the nervous system after peripheral delivery. Hum. Mol. Genet. 10, 2109-2121 (2001).
  20. Kato, S. Neuron-specific gene transfer through retrograde transport of lentiviral vector pseudotyped with a novel type of fusion envelope glycoprotein. Hum. Gene Ther. 22, 1511-1523 (2011).
  21. Segura, M. M., Garnier, A., Durocher, Y., Ansorge, S., Kamen, A. New protocol for lentiviral vector mass production. Methods Mol. Biol. 614, 39-52 (2010).
  22. Kutner, R. H., Puthli, S., Marino, M. P., Reiser, J. Simplified production and concentration of HIV-1-based lentiviral vectors using HYPERFlask vessels and anion exchange membrane chromatography. BMC Biotechnol. 9, 10 (2009).
  23. Laughlin, M. A., Chang, G. Y., Oakes, J. W., Gonzalez-Scarano, F., Pomerantz, R. J. Sodium butyrate stimulation of HIV-1 gene expression: a novel mechanism of induction independent of NF-kappa B. J Acquir Immune Defic Syndr Hum Retrovirol. 9, 332-339 (1995).
  24. Gasmi, M. Requirements for efficient production and transduction of human immunodeficiency virus type 1-based vectors. J. Virol. 73, 1828-1834 (1999).
  25. Palsson, B., Andreadis, S. The physico-chemical factors that govern retrovirus-mediated gene transfer. Exp. Hematol. 25, 94-102 (1997).
  26. Lizee, G. Real-time quantitative reverse transcriptase-polymerase chain reaction as a method for determining lentiviral vector titers and measuring transgene expression. Hum. Gene Ther. 14, 497-507 (2003).
  27. Lee, J. K., Chung, J., McAlpine, F. E., Tansey, M. G. Regulator of G-Protein Signaling-10 Negatively Regulates NF-{kappa}B in Microglia and Neuroprotects Dopaminergic Neurons in Hemiparkinsonian Rats. J. Neurosci. 31, 11879-11888 (2011).
  28. Shevtsova, Z., Malik, J. M., Michel, U., Bahr, M., Kugler, S. Promoters and serotypes: targeting of adeno-associated virus vectors for gene transfer in the rat central nervous system in vitro and in vivo. Exp. Physiol. 90, 53-59 (2005).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics