Ein Toolkit zur Umwandlung von Kohlenwasserstoffen in wässrigen Umgebungen aktivieren

Bioengineering
 

Summary

Eine nachhaltige auto Regulierung bakteriellen System für die Sanierung von Ölverschmutzungen wurde entwickelt, unter Verwendung von Standard austauschbare DNA Teile (BioBricks). Ein ausgereiftes

Cite this Article

Copy Citation | Download Citations

Brinkman, E. K., Schipper, K., Bongaerts, N., Voges, M. J., Abate, A., Wahl, S. A. A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments. J. Vis. Exp. (68), e4182, doi:10.3791/4182 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Diese Arbeit schlägt eine Toolkit, das die Umwandlung von Alkanen ermöglicht durch Escherichia coli und präsentiert ein Beweis für das Prinzip ihrer Anwendbarkeit. Das Toolkit besteht aus mehreren Standard-austauschbare Teile (BioBricks) 9 Bewältigung der Umwandlung von Alkanen, Regulation der Genexpression und Überleben in giftige Kohlenwasserstoff-reiche Umgebungen.

Ein Drei-Schritt-Weg für Alkan-Abbau wurde in E. implementiert coli, die Umwandlung von mittel-und langkettige Alkane, ihre jeweiligen Alkanole, Alkanale und letztlich Alkan-Säuren ermöglichen. Letztere wurden über die native β-Oxidationsweg metabolisiert. Um die Oxidation des Mediums Alkane (C5-C13) und Cycloalkanen (C5-C8), vier Gene (alkB2, rubA3, rubA4 und Rubb) der Alkanhydroxylase-System von Gordonia sp erleichtern. TF6 8,21 wurden in E. transformierten coli. Für die Umwandlung vonlangkettige Alkane (C15-C36) wurde der Lada-Gen aus Geobacillus thermodenitrificans umgesetzt. Für die erforderlichen weiteren Schritte des Abbauprozesses wurden ADH und ALDH (aus G. thermodenitrificans) 10,11 eingeführt. Die Aktivität wurde durch ruhende Zelle Assays gemessen. Für jede oxidative Schritt wurde Enzymaktivität beobachtet.

Um den Prozess zu optimieren, wurde die Expression nur unter Bedingungen induziert niedrigen Glucose: ein Substrat-regulierte Promotor, pCaiF, wurde verwendet. pCaiF ist in E. coli K12 und reguliert die Expression der Gene in den Abbau von Nicht-Glucose-Kohlenstoffquelle beteiligt.

Der letzte Teil des Toolkits - Targeting Überleben - umgesetzt wurde unter Verwendung von Lösungsmittel Toleranz Gene, PhPFDα und β, die beide aus Pyrococcus horikoshii OT3. Organische Lösemittel induzieren können Zellstress und verringerte Überlebensfähigkeit durch negativ affecting Proteinfaltung. Als Chaperone, verbessern PhPFDα und β das Protein Faltvorgang zB unter Anwesenheit von Alkanen. Die Expression dieser Gene führte zu einer verbesserten Toleranz Kohlenwasserstoff durch eine erhöhte Wachstumsrate (bis 50%) in den Anwesenheiten von 10% n-Hexan im Kulturmedium dargestellt beobachtet.

Zusammenfassend zeigen die Ergebnisse, dass das Toolkit E. ermöglicht coli zu konvertieren und tolerieren Kohlenwasserstoffe in wässriger Umgebung. Als solche ist sie ein erster Schritt hin zu einer nachhaltigen Lösung für die Öl-Sanierung mit Hilfe eines synthetischen Biologie Ansatz.

Protocol

Ein. BioBrick Assembly

  1. BioBricks aus der Registry von Standard Biological Teile sind durch iGEM Hauptquartier zur Verfügung gestellt. Um eine neue BioBrick aus bestehenden BioBricks konstruieren, verdauen den Spender BioBrick (bis zu 1,0 ug) mit den Enzymen EcoRI und SpeI zur Positionierung der Donor Teil stromabwärts des Akzeptors Teil. Digest mit XbaI und PstI für die Positionierung des Spenders Teil stromaufwärts des Akzeptors Teil. Hinzufügen eines dritten entsprechenden Restriktionsenzym, das in der Hauptkette des Spenders schneidet. Führen Verdauungen in einem Gesamtvolumen von 20-25 ml mit dem geeigneten Puffer, nach dem Lieferanten (Endkonzentration 1x). Verwenden Sie 5 Einheiten / ug DNA für die Restriktionsenzyme.
  2. Verdauen Akzeptor BioBrick entweder mit EcoRI und XbaI oder SpeI und PstI.
  3. Inkubieren der Verdauungen für (mindestens) eine Stunde bei 37 ° C. Inaktivieren die Restriktionsendonukleasen durch Hitze, Inkubation bei 80 ° C für 10 min und zentrifugieren kurz.
  4. Ligieren der verdauten BioBrickTeile (Donor und Akzeptor) zusammen. Da XbaI und SpeI generieren kompatible DNA-Enden wird ein gemischtes Website erstellt, die nicht mit einem Restriktionsenzym zu einem neuen "kombinierte" BioBrick, dass von den 4 Standard-Restriktionsstellen flankiert geschnitten werden. In dem Ligationsgemisch die endgültige DNA-Konzentration ist vorzugsweise ~ 100 ng / ul. Führen die Ligationsreaktion in einem Gesamtvolumen von 10-15 ml mit der T4 Ligationspuffer (Endkonzentration 1x) und T4-Ligase (1 Unit / ug DNA).
  5. Inkubieren der Ligationsansatz bei 16 ° C für mindestens 3 Stunden.
  6. Führen Transformation Reaktion mit circa die Hälfte der Ligationsgemisch.
  7. Bestätigen Sie die BioBrick korrekt zu sein mit Sequenzierung.
  8. Um eine neue BioBrick aus synthetisierten DNA-Konstrukt, ändern die Gene für die Synthese für eine optimale Expression in E. coli mittels der Website JCat Werkzeug ( http://www.jcat.de/ ). Weitere Änderungen in Übereinstimmung mit den Anforderungen des B ioBrick Standard. Diese Standardisierung impliziert, dass jeder BioBrick einer DNA-Sequenz von Interesse durch ein Präfix und gefolgt von einem Zusatz besteht. Das Präfix und Suffix sind Sequenzen, die vordefinierte Restriktionsstellen, die abwesend sind in den verbleibenden Plasmid-Sequenz enthalten. Diese Standard-Restriktionsstellen machen es möglich, austauschen und erweitern die BioBrick Einsätze flexibel 9. Das Präfix und Suffix haben die folgenden Sequenzen:
Name Folge Kommentar
Präfix 5 'GAATTCGCGGCCGCTTCTAG3'
5 'GAATTCGCGGCCGCTTCTAGAG 3' Wenn das folgende Teil eine kodierende Sequenz oder ein Teil, der mit "ATG" beginnt
Suffix 5 'TACTAGTAGCGGCCGCTGCAG 3'
ove_title "> 2. Alkane Conversion Resting Zell-Assay, In Vivo

Dieser Assay wurde basierend auf der Methode von Fujii et al. (2004) beschriebenen Verfahren durchgeführt.

  1. Kultur E. coli Zellen, die das Alkanhydroxylase-System ( BBa_K398014 ) und Zellen, die einen leeren Vektor ( BBa_J13002 ) in 5 ml LB-Medium mit den entsprechenden Antibiotika über Nacht.
  2. Übertragen 500 ul der Übernachtkultur in 50 ml frisches LB (mit Antibiotikum) und inkubieren, bis die Zelle Trübung eine OD (optische Dichte) von 0,3 bei 600 nm.
  3. Zentrifuge für 10 min bei 4.000 rpm und das Pellet in 5 ml 0,1 M Phosphatpuffer (pH 7,4).
  4. Zentrifugieren für 10 min bei 4.000 rpm und das Pellet in 5 ml 0,1 M Phosphatpuffer nun enthaltenden E2 Salze und 0,66% v / v Glycerin (Stickstoff-Mangelerscheinungent medium).
  5. Messung der Trübung Zelle (OD 600).
  6. Planen Zell-Gemisch von 6 ml Aliquots in 25 ml geschlossenen Kappe Glaskolben und No-Zellkontrollen (E2 Salze + 0,66% v / v Glycerol).
  7. Fügen Sie 100 nmol von Alkan zu jeder Flasche.
  8. Inkubieren der Mischungen bei 37 ° C für 24 h (verkürzen, wenn höhere Raten erzielt werden).
  9. Messen Sie die OD 600 nach Inkubation.
  10. Extrahieren der Kohlenwasserstoffe in den Kulturmedien durch Ethylacetat und bestimmen Kohlenwasserstoffkonzentration in Zellkultur durch Gaschromatographie (siehe Protokoll 3).
  11. Berechnen den Abbau von Biomasse pro Zeiteinheit durch Teilen der Gesamtmenge des Alkans durch die gesamte Biomasse in jedem Kolben (konvertieren OD 600 auf Trockenmasse) umgerechnet. Teilen des Ergebnisses durch die Versuchsdauer ergibt die Abbauaktivität pro Biomasse pro Zeiteinheit. Der Durchschnitt wird aus drei einzelnen Läufe genommen.

3. Alkan Conversion-Enzym-Assay, InVitro

Dieser Assay wurde im Wesentlichen nach der Methode von Li et al. (2008) beschriebenen Verfahren durchgeführt.

  1. Kultur E. coli-Zellen, die Lada-Gen ( BBa_K398017 ) und Zellen, die einen leeren Vektor ( BBa_J13002 ) in 50 ml LB-Medium mit entsprechenden Antibiotika über Nacht.
  2. Übertragen 500 ul der Übernachtkultur in 50 ml frisches LB (mit Antibiotikum) und inkubieren, bis die Zelle Trübung erreicht eine optische Dichte von 0,6 bei 600 nm.
  3. Zentrifuge 10 min bei 4000 rpm (4 ° C) und das Pellet in 5 ml 50 mM Tris-Puffer.
  4. Beschallen (Cell Disruptor, LA Biosystems) wurden die Zellen bei 40% Einschaltdauer mit einer Leistung Steuerung von 4, halten Sie die Lösung auf Eis für die gesamte Dauer.
  5. Zentrifugieren der resultierenden Mischung für 5 Minuten bei 4000 rpm bei 4 & dzB, C, um die Zelltrümmer zu entfernen. Den Überstand in ein frisches Röhrchen.
  6. Bestimmen die Gesamtproteinkonzentration der Zellextrakte nach Bradford. Hinweis: Verwenden Sie Glasfläschchen, die Erhöhung der Hintergrund und / oder Verlust des Proteins zu verhindern.
  7. Vorbereiten einer Mischung, enthaltend 100 ml 0,1% v / v Alkan und 50 mM Tris-HCl-Puffer.
  8. Das Gemisch wird bei 100 ° C für 5 min. Hinweis: Führen Sie diesen Schritt nur für mittel-bis langfristige Alkane mit hohem Siedepunkt. (ZB C 16: 287 ° C).
  9. Um eine optimale Löslichkeit des Alkans zu erreichen, für 1 min und noch warm, bis eine homogene, viskose Mischung erhalten beschallen.
  10. Hinzufügen 1mM von NADH, 1 mM FMN, 1 mM MgSO 4 und 0,01 v / v Triton X-100.
  11. Bereiten Sie 6 ml Aliquots in 25 ml geschlossener Kappe Kolben.
  12. Hinzufügen ausreichender Mengen von Zellextrakt (abhängig von Bradford-Assays, Endkonzentration von 5 mg Protein / l). Bereiten Sie eine nicht-Protein-Kontrolle.
  13. Inkubieren bei 60 ° C (für eine optimale Enzymatic Aktivität) für 24 Stunden.
  14. Extrahieren der Kohlenwasserstoffe in den Kulturmedien durch Ethylacetat und bestimmen Kohlenwasserstoffkonzentration in Zellkultur durch Gaschromatographie (siehe Protokoll 3).
  15. Berechnen den Abbau von Biomasse pro Zeiteinheit durch Teilen der Gesamtmenge des Alkans durch Gesamtprotein umgewandelt hinzugefügt zu jedem Kolben (durch Bradford Eichkurve). Weitere Division durch Versuchsdauer ergibt die Abbauaktivität pro Einheit des zellulären Proteins pro Zeiteinheit. Der Durchschnitt wird aus drei einzelnen Läufe genommen.

4. Ethylacetat Hydrocarbon Extraction und Konzentrationsmessung

  1. Alkane werden aus der wässrigen Lösung durch Zugabe von 2,5 ml Ethylacetat (apolaren solvant) bis 6 ml experimentelle Lösung extrahiert. Ein interner Standard wird zum Lösungsmittel in einer Konzentration von 0,1% (v / v) zugegeben. Der Standard (z. B. Cyclo-decan) variiert in Abhängigkeit von der erwarteten Bereich der Spitzen von Interesse.
  2. Optional: Add TritonX-100 zu der wässrigen Mischung und Zentrifugieren der Proben für 10 min bei 4.000 UpM, um eine ordnungsgemäße zweiphasige System zu erhalten.
  3. Vortex die Mischung für 5 sec (1.500 rpm) und bei Raumtemperatur inkubieren, bis die beiden Phasen getrennt.
  4. Entfernen einer maximalen Menge der organischen Schicht (oben) und Trocknen des Lösungsmittels unter Verwendung von wasserfreiem Magnesiumsulfat getrocknet.
  5. Entfernen MgSO 4 durch Filtration (0,2 pm) und übertragen das Filtrat in Gaschromatographen Fläschchen für Messungen oder bei -20 ° C.
  6. Bestimmen Sie die Konzentration durch Gaschromatographie unter Verwendung einer CP-SIL 5CB Säule (Länge = 5 m). Jeweils 10 ul Probe im Split-Modus (1:10, 230 ° C). Setzen der Säule Gasströmung auf 1 ml / min (Helium). Im folgenden Ofentemperatur Programm wird verwendet:
    Rate Temperatur [° C] Zeit [min]
    0 50 7,5
    50 90 1,0
    50 110 2,0
    50 130 2,0
    50 145 2,0
    50 160 2,0
    50 170 2,0
    50 185 2,0
    50 210 2,0
    50 250 2,0
    50 320 2,0
  7. Integrieren Gipfeln und korrigieren die Konzentrationen gegenüber dem internen Standard.

5. Alkohol / Aldehyd-Dehydrogenase-Aktivitäts-Assay

Dieser Assay wurde im Wesentlichen nach der Methode von Kato et al beschriebenen Verfahren durchgeführt.(2010).

  1. Kultur E. coli Zellen, die das ADH ( BBa_K398018 ) oder ALDH ( BBa_K398030 )-Gen und Zellen, die einen leeren Vektor ( BBa_J13002 ) in 50 ml LB-Medium mit den entsprechenden Antibiotika über Nacht.
  2. Übertragen 500 ul der Übernachtkultur in 50 ml frisches LB (mit Antibiotikum) und inkubieren, bis die Zelle Trübung erreicht eine optische Dichte von 0,6 bei 600 nm.
  3. Zentrifuge 10 min bei 4000 rpm bei 4 ° C und das Pellet in 5 ml 50 mM Tris-Puffer.
  4. Beschallen die Zelle bei 40% Einschaltdauer mit einer Leistung Kontrolle 4 (halten Sie die Lösung auf Eis während der Ultraschallbehandlung).
  5. Zentrifugieren der resultierenden Mischung für 5 Minuten bei 4000 rpm bei 4 ° C, um Zelltrümmer zu entfernen.
  6. Bestimmen Sie die zutal Proteinkonzentration der Zellextrakte nach Bradford (Hinweis: Verwenden Sie ein Glasfläschchen, um Protein-Bindung zu verhindern).
  7. Legen Sie eine 96-Well-Platte mit 180 ul 57 mM Glycin-Puffer, der NAD (Endkonzentration 1 mM, pH 9,5) in jedes Well.
  8. Hinzufügen 5 ul des Alkohols (Aldehyd), um in die Vertiefungen getestet werden. Anmerkung: Wärme langkettige Alkohole vor Beginn des Assays, um eine Flüssigkeit haben. Für jede Alkohol (Aldehyd) eine Kontrolle ohne Substrat sollte hinzugefügt (negative Kontrolle) werden. Zusätzlich wird eine Blindlösung, die eine Mischung aus Puffer und dem Substrat ohne Zellextrakt.
  9. Vorheizen Platte des Plattenlesers (Tecan Magellan v7.0) für 15 min bei 37 ° C bis Äquilibrierung des Systems zu ermöglichen.
  10. Hinzufügen ausreichender Mengen von Zellextrakt (abhängig von Bradford-Assays, Endkonzentration von 5 mg Protein / l). Bereiten Sie eine nicht-Protein-Kontrolle.
  11. Messung der NADH-Produktion mit einem Spektralphotometer bei einer Wellenlänge von 340 nm alle 2-3 Min. für 1 Stunde bei 37 ° C </ Li>
  12. Berechnen den NADH-Produktionsrate von der Steigung der OD (340 nm). Berücksichtigen Sie das Licht Weglänge und des Extinktionskoeffizienten von NADH von 6220 M -1 cm -1. Unterteilen den NADH-Produktionsrate von der Gesamtmenge an Protein hinzugefügt, um die Aktivität des Dehydrogenaseumsetzung im Zellextrakt (U / mg gesamten Zellproteins) exprimieren. Berechnen des Mittelwertes und der Standardabweichung aus drei unabhängigen Läufen.

6. pCaiF Charakterisierung

  1. Kultur E. coli Zellen, die das Konstrukt pCaiF-GFP ( BBa_K398331 ) und Zellen, die den Promotor alleine ( BBa_K398326 ) über Nacht in 5 ml LB-Medium über Nacht die entsprechenden Antibiotika.
  2. Beimpfen 5 ml M9 mit 10 g / l Glukose und Antibiotika mit 50 ul der Übernachtkultur und wachsen über Nacht. Subkultur 50 ul der Übernacht-Auswuchs in 5 ml frisches M9 mit 10 g / l und inkubieren, bis die Zelle Trübung erreicht eine optische Dichte von 0,2 bei 600 nm aufweist.
  3. Laden einer Platte mit 96 Vertiefungen mit 100 ml frisches M9-Medium, das die gewünschte Menge an Kohlenstoffquelle zum Prüfen in jeder Vertiefung. Führen Dreifachversuche der statistischen Auswertung und fügen Sie die entsprechenden negativen Kontrollen (Wildtyp E. coli K12).
  4. Fügen Sie 5 ul der Übernachtkultur den Medium mit Brunnen.
  5. Messung der Wachstumskurve (OD 600) und GFP-Fluoreszenz (485 nm Anregung und 520 Emission) unter Verwendung eines Plattenlesegeräts alle 10 min für 18 Stunden bei 37 ° C unter konstantem Schütteln inkubiert.
  6. Berechnen Sie die Wachstumsrate und die spezifische GFP Inhalte aus den jeweiligen Messungen und vergleichen Sie die Kontrolle. Berechnen des Mittelwertes und der Standardabweichung von mindestens drei unabhängigen Experimenten.

7. Toleranz Assay

  1. KulturE. coli, PhPFDα und β-Gen ( BBa_K398406 ) über Nacht in 5 ml LB-Medium und den entsprechenden Antibiotika. E. coli exprimierenden Lada Gen ( BBa_K398017 ) als negative Kontrolle verwendet.
  2. Subkultur 10 ul der Übernacht-Auswuchs in frisches 5 ml LB (mit Antibiotikum) und inkubieren, bis die Zelle Trübung erreicht eine optische Dichte von 0,3 bis 0,4 bei 600 nm aufweist.
  3. Verdünnen Sie die Kulturen mit frischem Medium, bis eine OD 600 von 0,1 erreicht ist.
  4. Laden einer Platte mit 96 Vertiefungen mit 180 ul M9 Medium mit den entsprechenden Antibiotika und die korrekte Endkonzentration der toxischen Verbindung (zB 0, 4, 8, 10% n-Hexan) in dreifacher Ausfertigung. Weil Alkan-Wasser-Gemischen zu zweiphasigen Systemen führen können ist es notwendig, geeignete Bedienelemente auf der Platte haben (zB dUNTERSCHIEDLICHE Stämme und die jeweiligen leere Experimente).
  5. Fügen Sie 20 ul der Kultur (Kontrolle) in die Vertiefungen.
  6. Messung der Biomassekonzentration (OD 600) unter Verwendung eines Plattenlesegeräts alle 10 min für 24 Stunden bei 37 ° C unter konstantem Schütteln inkubiert.
  7. Berechnen Sie die Wachstumsraten aus den jeweiligen Messungen für die verschiedenen Wirkstoffkonzentrationen und im Vergleich zu der negativen Kontrolle. Berechnen des Mittelwertes und der Standardabweichung von mindestens drei unabhängigen Läufen.

8. Homolog Interaction Mapping

  1. Die Anwendung HIM wurde entwickelt, um Protein-Abfragen auf einer PostgreSQL-Server mit dem STRING-Datenbank (kostenlos für den akademischen Gebrauch) 20 durchzuführen. Das Homologe Interaktion Mapping-Anwendung identifiziert interagierende Proteine ​​in der ursprünglichen Wirtsorganismus mit dem STRING-Datenbank. Die Sequenzen der entsprechenden Gene sind in Wechselwirkung einer BLAST-Suche, um homologe Gene in den Zielorganismus finden verwendet. Cytoscape 4 https://github.com/jcnossen/InteractionHomologMapping.
  2. Um eine Zuordnung durchführen, (1) geben Sie die BioBrick ID und die Anwendung wird automatisch die Teilsequenz Daten aus der Registry von Standard Biological Parts 9 oder (2) Geben (Paste) der Sequenzdaten in der Anwendung.
  3. Verwenden Sie den STRING Database Website, um die String-Protein-ID für die eingegebenen Aminosäuresequenz zu finden.
  4. Ein Protein mit hoher Homologie wird unter Verwendung BLAST. Anschließend wird die Anwendung listet jeden bekannten interagierende Protein in der Quelle Organismus und sucht nach Homologen im Wirtsorganismus (zB E. coli).
  5. Export resultierenden vermeintlichen Interaktion Liste Text oder Cytoscape.

Discussion

Die BioBrick Prinzip wird ein Fahrwerk für den Abbau von Alkanen zu konstruieren und einen Beweis des Prinzips für die einzelnen Komponenten des Toolkits wurde erhalten. Mehrere Tests werden vorgeschlagen, um die in vivo und in-vitro-Aktivität von Alkan abbauenden Stoffwechselenzyme messen. Die vorliegende Arbeit demonstriert erfolgreich eine Reihe von Methoden, die verwendet werden, um Enzymaktivitäten und Ausdruck in der Wirtsorganismus E. bestimmt werden kann coli nach der Implementierung von geeigneten BioBricks. Weiterhin wird gezeigt, dass die BioBrick Prinzip verwendet werden, um einen Organismus, die Proteine, die für den Abbau von Alkanen drückt entwerfen kann, bietet ein Regulierungssystem, die diese Enzyme produziert nur bei Bedarf und steigert die Toleranz des Wirtsorganismus in Gegenwart von Kohlenwasserstoffen . Sobald weiterentwickelt, könnte dieses Fahrwerk für den biologischen Abbau von restlichem Öl verwendet werden, zB in Ölsand Tailing Wasser, oder für die Behandlungvon Abwasser aus der Ölindustrie.

Mit Hinsicht auf die Alkan Abbaus, wurden Tests zur Charakterisierung der Enzyme in der ersten Stufe des Abbaus Alkan (AH-System und Lada) beteiligt durchgeführt. Es wurde gezeigt, dass ein E. coli Stamm, der das AH-System Gordonia sp. TF6 konnte octan in vivo zu konvertieren. Dieser Befund steht im Einklang mit den Ergebnissen der Fujii et. al. 8, wo Biotransformation von n-Alkanen mit E. coli, die minimalen Komponente Gene des AH-System wurde erreicht. Die Aktivität wurde durch Umwandlung einer vergleichenden Studie (Wildtyp Mutante vs) nach einer bestimmten Zeit gemessen. Für eine vollständige Charakterisierung, haben zusätzliche Studien auf die Aktivität des AH-Systems über die Zeit und die Kinetik des Systems durchgeführt werden.

Für die Umwandlung von langkettige Alkane (C 15-C 36), der Lada-Gen aus Geobacillus thermodenitrificans umgesetzt wurde. Die Enzymaktivität wurde in vitro getestet Hexadecan als langkettigen Kohlenwasserstoff-Quelle. Dieses modifizierte E. coli-Stamm zeigte eine erhöhte Enzymaktivität im Vergleich zum Kontrollstamm, was zeigt, das rekombinante Protein Lada ermöglicht die Umwandlung von Hexadecan von E. coli. Neben der Eigenschaft des Umwandelns Alkanen zu Alkanolen, E. coli-Stämme wurden mit einer verbesserten Abbauprozess der Alkohole und Aldehyde durch die Umsetzung der ADH und ALDH Gene bzw. entwickelt. Die Enzymaktivität in Zellextrakten wurde in vitro durch Messung der Produktion von NADH aus NAD + getestet. Die E. coli Stamm exprimieren ADH zeigte eine zweifache Zunahme in Alkohol-Dehydrogenase-Aktivität im Vergleich zur Wildtyp-Aktivität. Im Vergleich zum Kontrollstamm steigerte die Expression von ALDH Protein die Dodecanal Dehydrogenase-Aktivität in E. coli cell extrahiert das Dreifache. Da diese Assays deutlich gezeigt Enzym-Aktivität in vitro erhöht wird, kann spekuliert werden, dass die transformierten E. coli-Stämme haben erhöhten Aktivität in vivo als auch.

Um die Möglichkeit einer Host-induzierte Expression (z. B.: Nicht-Abhängigkeit Induktion Chemikalien und geringer Belastung während des Wachstums) zu erforschen, wurde der Abbauweg unter der Kontrolle des Promotors exprimiert pCaiF. Dieser Promotor aktiviert die Genexpression, wenn Blutzuckerspiegel niedrig, z. B. sind. am Ende einer Partie Wachstumsphase. Als proof of principle, wurde dieser Promotor über die Produktion von GFP unter Unterschied Glukose Regimes getestet. Es wurde gezeigt, dass die pCaiF-GFP transformierte E. coli produziert mehr GFP während der stationären (Glucose-limited) Phase als in der exponentiellen Phase (High Glukose). In Gegenwart eines sekundären Kohlenstoffquelle (zB. Laurinsäure), verringerte sich die GFP Produktionsrate again aufgrund der Katabolismus des sekundären Kohlenstoff-Quelle.

Das Experiment zeigte, dass dieser Promotor effektiv genutzt werden kann, um Verschiebungen katabolischen aus Glucose, neue Abbauwege aktivieren. Dies ermöglicht ein rasches Wachstum eine große Menge von Organismen in einem reichen Medium, bevor der Abbauweg aktiviert. Wir schlagen vor, verwenden Sie den pCaiF Promotor stromaufwärts der AlkS Transkriptionsregulator. In Pseudomonas putida, erkennt AlkS C 5-C 10-n-Alkane als Effektoren. Anschließend hohe AlkS-Alkan komplexen aktivieren PalkB Promotor, was zur Expression der Proteine ​​kodiert alkBFGHJKL Operon in der Umwandlung von n-Alkanen zu 19 Fettsäuren involviert.

Sensing and Umwandlung von Kohlenwasserstoffen ist nicht genug für die Zelle lebensfähig zu sein. Mit zunehmender Kohlenwasserstoff-Konzentrationen in der Umwelt, das Wachstum von Wildtyp E. coli wird durch die Anwesenheit von Wasserstoff gehemmtKohlenstoffen in der Membran und in der Zelle, die Proteinfehlfaltung verursachen können. P. horikoshii prefoldin ein Chaperon Unterstützen der korrekten Faltung des Proteins in Gegenwart von Alkanen 17. Mit ihm war es vorausgesagt, dass dieses Protein mit Homolog E. interagiert coli Chaperon-Proteine, was darauf hindeutet, dass die Überexpression von prefoldin in E. coli verbessern könnte Lösungsmittel Toleranz. Mit dem BioBrick BBa_K398406 (bestehend aus phPFDα und phPFDβ Gene), die Überlebensfähigkeit von E. coli in Gegenwart von Alkanen wurde bis zu 50% verbessert. HIM ist ein geeignetes Instrument, um potenzielle funktionelle Homologe zu wählen.

In Anbetracht der Toolbox als Ganzes, kann gefolgert werden, dass es einen ersten Schritt bei der Konstruktion eines Chassis für die biologische Sanierung von Kohlenwasserstoffen in wässrigen Umgebungen bereitstellt. Dies stellt ein kleines, autonomes, sich selbst reproduzierende und relatively kostengünstige Methode. Die Ergebnisse wurden vor allem durch Enzymtests erworben und schütteln Flash Kulturen und müssen daher in einem größeren Maßstab validiert werden. Weitere Forschung auf diesem System sollte auf der Kopplung der verschiedenen Enzyme, die gezeigt haben hier individuell zu arbeiten, um die vorgesehen für Kohlenwasserstoff-Abbau zu generieren konzentrieren. Weiterhin könnte zusätzlich von alternativen Pfaden für den Abbau von anderen Schadstoffen sowie die erweiterte Nutzung dieses Chassis über den biologischen Abbau von Kohlenwasserstoffen allein an einen breiteren Anwendungsbereich von Schadstoffen und gegebenenfalls die Umsetzung des Produkts Signalwege könnte sogar nutzen dieses System zur Erzeugung von wertvolle Chemikalien. Unsere Ergebnisse unterstreichen die Eignung des BioBricks Montage-Strategie in der Synthetischen Biologie, um neue Organismen, die mit Ölverschmutzung umzugehen, und kann zusätzlich nützlich sein, um eine Vielzahl von anderen Anwendungen entwickeln und bauen.

Disclosures

Keine Interessenskonflikte erklärt.

Acknowledgments

Die Experimente in diesem Video-Artikel ausgeführt wurden für den internationalen Genetically Engineered Machine Wettbewerb 9 entwickelt. Die Autoren danken iGEM Teammitglieder Luke Bergwerff, Pieter TM van Boheemen, Jelmer Cnossen, Hugo F. Cueto Rojas und Ramon van der Valk für die Unterstützung in der Forschung. Wir danken Han de Winde, Stefan de Kok und Esengül Yıldırım für hilfreiche Diskussionen und Hosting dieser Forschung. Diese Arbeit wurde von der TU Delft University Department of Biotechnology, The Delft Bioinformatik-Labor, TU Delft Department of Bionanoscience, Oil Sands Leadership Initiative (OSLI), Stud studentenuitzendbureau, Niederlande Genomics Initiative, Kluyver Centre, Nederlandse Vereniging Biotechnologische (Stichting Biotechnology Nederland) unterstützt , DSM, Geneart, Greiner Bio-One und Genencor.

Materials

Name Company Catalog Number Comments
E. coli K12 New England Biolabs C2523H
Octane Fluka 74822
Hexadecane Fluka 52209
octanol-1 Fluka 95446
dodecanol-1 Sigma-Aldrich 126799
Hexane Sigma-Aldrich 296090
NADH Sigma-Aldrich N4505
FMN Sigma-Aldrich F2253
MgSO4 J.T. Baker Casno 7487 889
Triton X-100 Sigma-Aldrich T8787
T4 ligase New England Biolabs M0202L
Gas chromatograph
Cell disrupter LA Biosystems CD-019
Spectrophotometer Amersham pharmacia spec 2000
Plate reader Tecan Group Ltd. Magellan v7.0
Incubator Innova, 44
BioBrickTM K398014: BBa_J23100-BBa_J61100-alkB2-BBa_J61100-rubA3-BBa_J61100-rubA4- BBa_J61100-rubB Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398014 Alkane Hydroxylase System
Resistance: Chloramphenicol
BioBrickTM K398027: BBa_R0040-BBa_B0034-ladA Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398027 ladA Protein Generator
Resistance: Chloramphenicol
BioBrickTM K398018: BBa_J23100-BBa_J61101-ADH Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398018 ADH generator
Resistance: Chloramphenicol
BioBrickTM K398030: BBa_R0040-BBa_B0034-ALDH Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398030 ALDH generator
Resistance: Chloramphenicol
BioBrickTM K398326: pCaiF Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398326 pCaiF promoter
Resistance: Chloramphenicol
BioBrickTM K398331: pCaiF-BBa_B0032-BBa_I13401 Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398331 pCaiF measurement device
Resistance: Chloramphenicol
BioBrickTM K398406: BBa_J23002-BBa_J61107-phPFDα-BBa_J61107- Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398406 Solvent tolerance cluster
Resistance: Chloramphenicol

DOWNLOAD MATERIALS LIST

References

  1. Allen, E. W. Process water treatment in Canada's oil sands industry: I: Target pollutants and treatment objectives. J. Environ. Eng. Sci. 7, 123-138 (2008).
  2. Alon, U. An Introduction to Systems Biology: Design Principles of Biological Circuits. CRC Press. (2007).
  3. Center, O. P. Understanding Oil Spills and Oil Spill Response. (1999).
  4. Cytoscape. An Open Source Platform for Complex Network Analysis and Visualization [Internet]. Available from: http://www.cytoscape.org (2012).
  5. Non-Invasive Biomass Monitor with Wide Linear Range [Internet]. Available from: http://www.buglab.com/docs/OnLineODMeasurement.pdf (2012).
  6. Eichler, K., Buchet, A., Lemke, R., Kleber, H. P., Mandrand-Berthelot, M. A. Identification and characterization of the caiF gene encoding a potential transcriptional activator of carnitine metabolism in Escherichia coli. J. Bacteriol. 178, 1248-1257 (1995).
  7. Feng, L., Wang, W., Cheng, J., Ren, Y., Zhao, G., Gao, C., Tang, Y., Liu, X., Han, W., Peng, X., et al. Genome and proteome of long-chain alkane degrading Geobacillus thermodenitrificans NG80-2 isolated from a deep-subsurface oil reservoir. Proc. Natl. Acad. Sci. U.S.A. 104, (13), 5602-5607 (2007).
  8. Fujii, T., Narikawa, T., Takeda, K., Kato, J. Biotransformation of various alkanes using the Escherichia coli expressing an alkane hydroxylase system from Gordonia sp. TF6. Biosci. Biotechnol. Biochem. 68, (10), 2171-2177 (2004).
  9. iGEM. Registry of Standard Biological Parts [Internet]. Available from: http://partsregistry.org/Main_Page (2012).
  10. Kato, T., Miyanaga, A., Haruki, M., Imanaka, T., Morikawa, M., Gene Kanaya, S. cloning of an alcohol dehydrogenase from thermophilic alkane-degrading Bacillus thermoleovorans B23. J. Biosci. Bioeng. 91, (1), 100-102 (2001).
  11. Kato, T., Miyanaga, A., Kanaya, S., Morikawa, M. Gene cloning and characterization of an aldehyde dehydrogenase from long-chain alkane-degrading Geobacillus thermoleovorans B23. Extremophiles. 14, 33-39 (2010).
  12. Kieboom, J., De Bont, J. aM. Bacterial Stress Responses. ASM Press. Washington, D.C. (2000).
  13. Kotte, O., Zaugg, J. B., Heinemann, M. Bacterial adaptation through distributed sensing of metabolic fluxes. Mol Syst Biol. 6, 355 (2010).
  14. Kremling, A., Bettenbrock, K., Gilles, E. D. Analysis of global control of Escherichia coli carbohydrate uptake. BMC Syst. Biol. 1, (2007).
  15. Li, L., Liu, X., Yang, W., Xu, F., Wang, W., Feng, L., Bartlam, M., Wang, L., Rao, Z. Crystal structure of long-chain alkane monooxygenase (LadA) in complex with coenzyme FMN: unveiling the long-chain alkane hydroxylase. J. Mol. Biol. 376, (2), 453-465 (2008).
  16. Lin, H. Y., Mathiszik, B., Xu, B., Enfors, S. O., Neubauer, P. Determination of the maximum specific uptake capacities for glucose and oxygen in glucose-limited fed-batch cultivations of Escherichia coli. Biotechnol. Bioeng. 73, (5), 347-357 (2001).
  17. Okochi, M., Kanie, K., Kurimoto, M., Yohda, M., Honda, H. Overexpression of prefoldin from the hyperthermophilic archaeum Pyrococcus horikoshii OT3 endowed Escherichia coli with organic solvent tolerance. Appl. Microbiol. Biotechnol. 79, (3), 443-449 (2008).
  18. Rehm, H. J., Reiff, I. Mechanisms and occurrence of microbial oxidation of long-chain alkanes. Adv. Biochem. Eng. / Biotechnol. 19, 175-215 (1981).
  19. Rojo, F. Degradation of alkanes by bacteria. Environ. Microbiol. 11, (10), 2477-2490 (2009).
  20. STRING 9.0 Known and Predicted Protein-Protein Interactions [Internet]. Available from: http://string-db.org/newstring_cgi/show_download_page.pl (2012).
  21. Van Beilen, J. B., Panke, S., Lucchini, S., Franchini, A. G., Rothlisberger, M., Witholt, B. Analysis of Pseudomonas putida alkane-degradation gene clusters and flanking insertion sequences: evolution and regulation of the alk genes. Microbiology. 147, 1621-1630 (2001).
  22. Wang, L., Tang, Y., Wang, S., Liu, R. L., Liu, M. Z., Zhang, Y., Liang, F. L., Feng, L. Isolation and characterization of a novel thermophilic Bacillus strain degrading long-chain n-alkanes. Extremophiles. 10, (4), 347-356 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics