En verktygslåda så att kolväteomvandling i vattenhaltiga miljöer

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

En hållbar automatisk reglering bakteriell system för sanering av olja föroreningar ritades med vanliga utbytbara DNA delar (BioBricks). Konstruerad

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Brinkman, E. K., Schipper, K., Bongaerts, N., Voges, M. J., Abate, A., Wahl, S. A. A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments. J. Vis. Exp. (68), e4182, doi:10.3791/4182 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Detta arbete lägger fram en verktygslåda som möjliggör omvandlingen av alkaner av Escherichia coli och presenterar ett bevis på principen för dess tillämplighet. Verktygslådan består av flera vanliga utbytbara delar (BioBricks) 9 behandlar omvandlingen av alkaner, reglering av genuttryck och överlevnad i giftiga kolväterika miljöer.

Ett tre steg väg för alkan nedbrytning genomfördes i E. E. coli för att möjliggöra omvandlingen av medellång och lång kedja alkaner till deras respektive alkanoler, alkanals och i slutändan alkansyra-syror. De sistnämnda metaboliseras via nativa β-oxidation vägen. För att underlätta oxidationen av medellånga kedja alkaner (C5-C13) och cykloalkaner (C5-C8), fyra gener (alkB2, rubA3, rubA4 och Rubb) i alkan hydroxylas systemet från Gordonia sp. TF6 8,21 transformerades in i E. coli. För omvandling avlångkedjiga alkaner (C15-C36), fick lada genen från Geobacillus thermodenitrificans genomförts. För de nödvändiga ytterligare steg i nedbrytningsprocessen fick ADH och ALDH (ursprung från G. thermodenitrificans) infördes 10,11. Aktiviteten mättes genom vilande cellanalyser. För varje oxidativa steget, var enzymaktiviteten observerades.

För att optimera processens effektivitet, var uttrycket endast induceras under låga glukos betingelser: ett substrat-reglerad promotor, pCaiF, användes. pCaiF finns i E. coli K12 och reglerar uttrycket av gener som är involverade i nedbrytningen av icke-glukos kolkällor.

Den sista delen av verktygslådan - inriktning överlevnad - genomfördes med användning av lösningsmedel tolerans gener, PhPFDα och β, båda från Pyrococcus horikoshii OT3. Organiska lösningsmedel kan inducera cell-stress och minskad överlevnad med negativt affecting. proteinveckning. Som chaperones, PhPFDα och β förbättra proteinveckning processen t.ex. under närvaron av alkaner. Uttrycket av dessa gener ledde till en förbättrad kolväte tolerans visas genom en ökad tillväxthastighet (upp till 50%) i närvaro av 10% n-hexan i odlingsmediet observerades.

Sammanfatta, tyder resultaten på att det verktygslådan gör E. E. coli att konvertera och tolerera kolväten i vattenbaserade miljöer. Som sådan utgör den ett första steg mot en hållbar lösning för olje-sanering med hjälp av en syntetisk biologi strategi.

Protocol

1. BioBrick församling

  1. BioBricks från registret av Standard biologiska delar från iGEM högkvarter. För att konstruera en ny BioBrick från befintliga BioBricks, smälta givaren BioBrick (upp till 1,0 g) med EcoRI och Spel för placering nedströms givare del av acceptor delen. Digerering med Xbal och PstI för att positionera givaren delen uppströms acceptor delen. Lägg tredjedel lämplig restriktionsenzym som klipper i ryggraden hos givaren. Utför spjälkningar i en total volym av 20-25 ml med lämplig buffert, enligt leverantören (slutlig koncentration 1x). Använd 5 enheter / | ig DNA för restriktionsenzymerna.
  2. Digerera acceptorn BioBrick med antingen EcoRI och Xbal eller Spel och Pstl.
  3. Inkubera spjälkningar för (åtminstone) en timme vid 37 ° C. Inaktivera restriktionsendonukleaserna genom värme, inkubering vid 80 ° C under 10 minuter och centrifugera kort.
  4. Ligera den digererade BioBrickdelar (donator och acceptor) tillsammans. Eftersom Xbal och Spel genererar kompatibla DNA-ändar, är en blandad plats skapas som inte kan skäras med någon restriktionsenzym resulterande i en ny "kombinerad" BioBrick som flankerad av 4 standard restriktionsställena. I ligeringsblandningen den slutliga DNA-koncentrationen är företrädesvis ~ 100 ng / | il. Utför ligeringsreaktionen i en total volym av 10-15 ml med T4-ligeringsbuffert (slutlig koncentration 1x) och T4-ligas (1 enhet / pg DNA).
  5. Inkubera ligeringsblandningen vid 16 ° C under minst 3 timmar.
  6. Utför transformation reaktion med ca hälften av ligeringsblandningen.
  7. Bekräfta BioBrick vara korrekt med sekvensering.
  8. För att konstruera en ny BioBrick från syntetiserat DNA, ändra gener för syntes för optimal uttryck i E. E. coli med hjälp av den JCat webbplatsen verktyget ( http://www.jcat.de/ ). Göra ytterligare modifieringar i enlighet med kraven i B- ioBrick standarden. Denna standardisering innebär att varje BioBrick är sammansatt av en DNA-sekvens av intresse föregås av ett prefix och följs av ett suffix. Den prefix och suffix är sekvenser som innehåller fördefinierade restriktionsställen, som är frånvarande i den återstående plasmiden sekvens. Dessa vanliga restriktionsställen gör det möjligt att byta och utvidga BioBrick skär flexibelt 9. Den prefix och suffix har följande sekvenser:
Namn Sekvens Kommentar
Prefix 5 'GAATTCGCGGCCGCTTCTAG3'
5 'GAATTCGCGGCCGCTTCTAGAG 3' Om följande delen är en kodande sekvens eller en del som börjar med "ATG"
Suffix 5 'TACTAGTAGCGGCCGCTGCAG 3'
ove_title "> 2. Alkane Konvertering Resting cellanalys, in vivo

Denna analys utfördes baserat på metoden beskriven av Fujii et al. (2004).

  1. Kultur E. E. coli-celler som uttrycker alkan hydroxylasaktivitet systemet ( BBa_K398014 ) och celler som bär en tom vektor ( BBa_J13002 ) i 5 ml LB-medium med lämpliga antibiotika över natten.
  2. Överför 500 | il av den över natten odlade kulturen i 50 ml färskt LB (med antibiotika) och inkubera tills cellen grumlighet nådde ett OD (optisk densitet) av 0,3 vid 600 nm.
  3. Centrifugera i 10 minuter vid 4.000 rpm och återsuspendera pelleten i 5 ml 0,1 M fosfatbuffert (pH 7,4).
  4. Centrifugera igen under 10 minuter vid 4.000 rpm och återsuspendera pelleten i 5 ml 0,1 M fosfatbuffert nu innehållande E2 salter och 0,66% vol / vol glycerol (kväve-brist-medium).
  5. Mät cellen grumlighet (OD 600).
  6. Förbered cell-blandning alikvoter av 6 ml i 25 ml sluten cap glaskolvar och ingen cell kontroller (E2 salter + 0,66% vol / vol glycerol).
  7. Tillsätt 100 nmol alkan till varje kolv.
  8. Inkubera blandningarna vid 37 ° C i 24 timmar (kortare när högre erhålls).
  9. Mät OD 600 efter inkubering.
  10. Extrahera kolvätena i odlingsmediet med etylacetat och bestämma kolvätekoncentrationen i cellkultur med gaskromatografi (se protokoll 3).
  11. Beräkna nedbrytningen per biomassa genom att dividera den totala mängden alkan omvandlas av den totala biomassan närvarande i varje kolv (konvertera OD 600 till torrvikt). Dividera resultatet med den experimentella varaktighet ger nedbrytningen aktivitet per enhet biomassa per tidsenhet. Den genomsnittliga tas från tre individuella körningar.

3. Alkan Omvandling enzymanalys, IVitro

Denna analys utfördes väsentligen enligt metoden beskriven av Li et al. (2008).

  1. Kultur E. E. coli-celler som uttrycker genen Lada ( BBa_K398017 ) och celler som bär en tom vektor ( BBa_J13002 ) i 50 ml LB-medium med lämpliga antibiotika över natten.
  2. Överför 500 | il av den över natten odlade kulturen i 50 ml färskt LB (med antibiotika) och inkubera tills cellen grumlighet nådde en optisk densitet av 0,6 vid 600 nm.
  3. Centrifugera 10 min vid 4.000 rpm (4 ° C) och återsuspendera pelleten i 5 ml 50 mM Tris-buffert.
  4. Sonikat (Cell Disrupter, LA Biosystems) cellerna vid 40% intermittens med en uteffekt kontroll över 4, hålla lösningen på is under hela.
  5. Centrifugera den resulterande blandningen under 5 minuter vid 4.000 rpm vid 4 & dt.ex., C för att avlägsna celldebris. Överför supernatanten till ett nytt flaska.
  6. Bestämma den totala proteinkoncentrationen av cellextrakt från Bradford-analys. Notera: Använd glasampuller för att förhindra ökningen av bakgrund och / eller förlust av protein.
  7. Bered en 100 ml blandning innehållande 0,1% volym / volym alkan och 50 mM Tris-HCl-buffert.
  8. Värm blandningen vid 100 ° C under 5 minuter. Obs: Utför det här steget endast för medellånga kedjor alkaner med hög kokpunkt. (T.ex. C 16: 287 ° C).
  9. För att uppnå en optimal löslighet av alkanen, sonikera under 1 min medan fortfarande varm tills en homogen, viskös blandning erhålls.
  10. Lägg 1 mM NADH, 1 mM FMN, 1 mM MgSO 4 och 0,01 vol / vol Triton X-100.
  11. Förbered 6 ml portioner i 25 ml sluten cap kolvar.
  12. Lägg tillräckliga mängder av cell-extrakt (beroende på Bradford-analyser, slutkoncentration av 5 mg protein / liter). Förbered en no-protein kontroll.
  13. Inkubera vid 60 ° C (för optimal enzymatic aktivitet) under 24 timmar.
  14. Extrahera kolvätena i odlingsmediet med etylacetat och bestämma kolvätekoncentrationen i cellkultur med gaskromatografi (se protokoll 3).
  15. Beräkna nedbrytningen per biomassa genom att dividera den totala mängden alkan omvandlas genom totalt protein sattes till varje kolv (genom Bradford kalibreringskurva). Ytterligare dividera med experimentets varaktighet ger nedbrytningen aktiviteten per enhet av cellulärt protein per tidsenhet. Den genomsnittliga tas från tre individuella körningar.

4. Etylacetat Kolväte Utsug och Mått Koncentration

  1. Alkaner extraheras från den vattenhaltiga lösningen genom tillsats av 2,5 ml etylacetat (opolära solvant) till 6 ml experimentell lösning. En intern standard tillsätts till lösningsmedlet vid en koncentration av 0,1% (vol / vol). Standarden (t.ex. cyklo-dekan) varieras beroende på den förväntade intervallet för topparna av intresse.
  2. Tillval: Lägg TritonX-100 till den vattenhaltiga blandningen och centrifugera proverna under 10 minuter vid 4.000 rpm för att få en ordentlig dubbelriktat fasisk systemet.
  3. Vortexa blandningen under 5 sekunder (1.500 rpm) och inkubera vid rumstemperatur tills de två faserna separerar.
  4. Avlägsna en maximal mängd av det organiska skiktet (överst) och torka lösningsmedlet med användning av vattenfri magnesiumsulfat.
  5. Ta MgSO 4 genom filtrering (0,2 um) och överför filtratet till gaskromatograf ampuller för mätningar, eller förvara vid -20 ° C.
  6. Bestäm koncentrationen genom gaskromatografi med användning av en CP-SIL 5CB kolonn (längd = 5 m). Injicera 10 ul av provet i delat läge (1:10, 230 ° C). Ställ flödet kolumnen gasen till 1 ml / min (helium). Följande ugnstemperaturen programmet används:
    Betygsätt Temperatur [° C] Tid [min]
    0 50 7,5
    50 90 1,0
    50 110 2,0
    50 130 2,0
    50 145 2,0
    50 160 2,0
    50 170 2,0
    50 185 2,0
    50 210 2,0
    50 250 2,0
    50 320 2,0
  7. Integrera toppar och korrigera koncentrationer med avseende på den inre standarden.

5. Alkohol / aldehyd dehydrogenas aktivitetsanalys

Denna analys utfördes väsentligen enligt metoden beskriven av Kato et al.(2010).

  1. Kultur E. E. coli-celler som uttrycker ADH ( BBa_K398018 ) eller ALDH ( BBa_K398030 ) genen och celler som bär en tom vektor ( BBa_J13002 ) i 50 ml LB-medium med lämpliga antibiotika över natten.
  2. Överför 500 | il av den över natten odlade kulturen i 50 ml färskt LB (med antibiotika) och inkubera tills cellen grumlighet nådde en optisk densitet av 0,6 vid 600 nm.
  3. Centrifugera 10 min vid 4.000 rpm vid 4 ° C och återsuspendera pelleten i 5 ml 50 mM Tris-buffert.
  4. Sonikera cellen lösningen vid 40% intermittens med en uteffekt kontroll av 4 (hålla lösningen på is under sonikering).
  5. Centrifugera den resulterande blandningen under 5 minuter vid 4.000 rpm vid 4 ° C för att avlägsna celldebris.
  6. Bestäm tilltal proteinkoncentration av cellextrakt från Bradford-analys (Obs: använd en glasflaska för att förhindra proteinbindning).
  7. Ladda en 96-brunnsplatta med 180 | il 57 mM glycinbuffert innehållande NAD (slutlig koncentration 1 mM, pH 9,5) i varje brunn.
  8. Tillsätt 5 pl av alkoholen (aldehyden) som skall testas till brunnarna. Obs: Värme långkedjiga alkoholer före starten av analysen att ha en vätska. För varje alkohol (aldehyd) en kontroll utan substrat bör läggas (negativ kontroll). Bered dessutom ett ämne innehållande en blandning av buffert och substratet utan cellextraktet.
  9. Förvärm platta plattläsare (Tecan Magellan v7.0) under 15 min vid 37 ° C för att tillåta ekvilibrering av systemet.
  10. Lägg tillräckliga mängder av cell-extrakt (beroende på Bradford-analyser, slutkoncentration av 5 mg protein / liter). Förbered en no-protein kontroll.
  11. Mät NADH produktionen med hjälp av en spektrofotometer vid våglängden 340 nm, var 2-3 minut i 1 timme vid 37 ° C. </ Li>
  12. Beräkna NADH produktionshastigheten från lutningen av OD (340 nm). Ta hänsyn till ljusbanan längd och extinktionskoefficienten för NADH av 6220 M -1 cm -1. Dividera NADH produktionshastigheten av den totala mängden tillsatt protein för att uttrycka aktiviteten hos dehydrogenas reaktionen i cellextraktet (U / mg hela cellprotein). Beräkna medelvärdet och standardavvikelsen från tre oberoende försök.

6. pCaiF Karakterisering

  1. Kultur E. E. coli-celler som uttrycker pCaiF-GFP konstruktet ( BBa_K398331 ) och celler som bär promotorn ensam ( BBa_K398326 ) över natten i 5 ml LB-medium lämpliga antibiotika över natten.
  2. Ympa 5 ml M9 innehållande 10 g / liter glukos och antibiotika med 50 | il av övernattskultur och växa över natten. Subkultur 50 il av den över natten utväxt i 5 ml färskt M9 with10 g / l och inkubera tills cellen grumlighet nådde en optisk densitet av 0,2 vid 600 nm.
  3. Ladda en 96-brunnsplatta med 100 | il färskt M9-medium innehållande den önskade mängden av kolkälla för testning i varje brunn. Utför tredubbla experiment för statistisk utvärdering och lägga de respektive negativa kontroller (vildtyp E. coli K12).
  4. Tillsätt 5 | il av den över natten odlade kulturen till mediet innehållande brunnarna.
  5. Mät tillväxtkurvan (OD 600) och GFP-fluorescens (485 nm excitation och 520 emission) med användning av en plattläsare varje 10 min under 18 h vid 37 ° C med konstant skakning.
  6. Beräkna tillväxttakten och den specifika GFP innehåll från respektive mätningar och jämföra med kontrollen. Beräkna medelvärdet och standardavvikelsen för åtminstone tre oberoende experiment.

7. Tolerans analys

  1. KulturE. coli som uttrycker PhPFDα och β gen ( BBa_K398406 ) över natten i 5 ml LB-medium och de lämpliga antibiotika. E. coli som uttrycker lada genen ( BBa_K398017 ) användes som negativ kontroll.
  2. Subkultur 10 il av den över natten utväxt i färskt 5 ml LB (med antibiotika) och inkubera tills cellen grumlighet nådde en optisk densitet av 0,3 till 0,4 vid 600 nm.
  3. Späd kulturerna med färskt medium tills en OD 600 av 0,1 uppnås.
  4. Ladda en 96-brunnsplatta med 180 | il M9-medium innehållande lämpliga antibiotika och korrekt slutlig koncentration av den toxiska föreningen (t.ex. 0, 4, 8, 10% n-hexan) i triplikat. Eftersom alkan-vattenblandningar kan leda till två-fas system är det viktigt att ha lämpliga kontroller på plattan (t.ex. Different stammar och de respektive tomma experiment).
  5. Tillsätt 20 | il av odlingen (kontroll) i brunnarna.
  6. Mät biomassa koncentrationen (OD 600) med användning av en plattläsare varje 10 min under 24 h vid 37 ° C med konstant skakning.
  7. Beräkna tillväxttakten från respektive mätningarna för de olika agenskoncentrationer och jämför den negativa kontrollen. Beräkna medelvärdet och standardavvikelsen för åtminstone tre oberoende körningar.

8. Homolog Interaktion Kartläggning

  1. Ansökan HIM har utvecklats för att utföra protein frågor på en PostgreSQL-server som kör STRING databasen (gratis för akademisk användning) 20. Den homolog interaktion kartläggning Programmet identifierar interagerande proteiner i den ursprungliga värdorganism med STRING-databasen. Sekvenserna för de respektive interagerande generna används i en BLAST-sökning för att hitta homologa gener i målorganismen. Cytoscape 4 https://github.com/jcnossen/InteractionHomologMapping.
  2. För att utföra en kartläggning, (1) Ange BioBrick ID och programmet kommer automatiskt hämta data delen sekvens från kansli Standard biologiska delarna 9, eller (2) Ange (pasta) datasekvensen i programmet.
  3. Använda webbplatsen STRING databas för att hitta ID-sträng proteinet för den angivna aminosyrasekvensen.
  4. Ett protein med hög homologi bestäms med BLAST. Därefter ansökan listar varje känt interagerande protein i källan organismen och söker efter homologer i värdorganismen (t.ex. E. coli).
  5. Exportera som följer förmodade interaktion listan till text eller Cytoscape.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Den BioBrick Principen används för att konstruera ett chassi för nedbrytning av alkaner och ett bevis på principen för de enskilda komponenterna i verktygslådan erhölls. Flera analyser föreslås att mäta in vivo-och in vitro-aktivitet av alkan nedbrytande enzymer pathway. Den presenterade arbete visar framgångsrikt ett antal metoder som kan användas för att bestämma enzymaktiviteter och uttryck i värdorganismen E. E. coli efter genomförandet av lämpliga BioBricks. Vidare visas det att BioBrick princip kan användas för att konstruera en organism som uttrycker proteiner som är nödvändiga för nedbrytningen av alkaner, tillhandahåller ett regelverk som producerar dessa enzymer endast när det är nödvändigt och förstärker tolerans av värdorganismen i närvaro av kolväten . När vidare utvecklas, skulle detta chassi användas för biologisk nedbrytning av restolja, t.ex. i oljesand avfallsdammar vatten, eller för behandlingav avloppsvatten från oljeindustrin.

Med avseende på alkanen nedbrytning, var analyser utfördes för karakterisering av de enzymer som är involverade i det första steget av nedbrytning alkan (AH-system och LADA). Det visades att en E. coli stam bär AH-systemet i Gordonia sp. TF6 kunde omvandla oktan in vivo. Denna slutsats är i överensstämmelse med resultaten från Fujii et. al. 8, där biotransformation av n-alkaner med användning av E. E. coli som uttrycker de minimala komponenter gener i AH-systemet uppnåddes. Omvandlingen aktiviteten mättes genom en jämförande studie (vildtyp kontra mutant) efter en given tid. För en fullständig karakterisering, ytterligare studier måste utföras på aktiviteten av AH-systemet över tiden och kinetiken i systemet.

För omvandlingen av långkedjiga alkaner (C 15-C 36), LADA genen från Geobacillus thermodenitrificans genomfördes. Enzymaktiviteten testades in vitro med användning av hexadekan såsom långkedjig kolväte källa. Denna modifierat E. coli-stam visade en ökad enzymaktivitet jämfört med kontrollgruppen stam, visar det rekombinanta LADA proteinet möjliggör omvandlingen av hexadekan av E. E. coli. Förutom egenskapen omvandla alkaner till alkanoler, E. coli-stammar utvecklades med en förbättrad nedbrytningsprocessen för alkoholer och aldehyder med genomförandet av ADH och ALDH gener respektive. Enzymaktiviteten i cellextrakt testades in vitro genom mätning av produktionen av NADH från NAD +. E. coli-stam som uttrycker ADH uppvisade en tvåfaldig ökning i alkoholdehydrogenas aktivitet jämfört med vildtypen aktiviteten. Jämfört med kontrollstammen, ökade expressionen av ALDH-proteinet dodekanal dehydrogenasaktivitet i E. E. coli celL extraherar tre gånger. Eftersom dessa analyser visade tydligt ökad enzymaktivitet in vitro, kan det spekuleras i att den transformerade E. coli-stammar har förhöjda nivåer av aktivitet in vivo samt.

Att undersöka möjligheten av värd-inducerad uttryck (till exempel: icke-beroende induktion kemikalier och låg belastning under tillväxt) var nedbrytningsvägen uttryckt under kontroll av pCaiF promotorn. Denna promotor aktiverar genuttryck då glukosnivåerna är låga, till exempel. vid slutet av en satsvis tillväxtfas. Som bevis på principen, denna promotor testades genom produktion av GFP i regimer skillnad glukos. Det visades att den pCaiF-GFP transformerades E. E. coli producerade mer GFP under stillastående (glukos-begränsad) fas än i den exponentiella fasen (högt blodsocker). I närvaro av en sekundär kolkälla (t ex. Laurinsyra), minskade GFP produktionshastigheten again grund katabolismen av den sekundära kol-källa.

Experimentet visade att denna promotor effektivt kan användas för att aktivera katabola skiftar från glukos till nya nedbrytningsvägar. Detta gör det möjligt att snabbt växa en stor mängd organismer i rikt medium innan nedbrytningsvägen aktiveras. Vi föreslår att använda pCaiF promotorn uppströms ALKs transkriptionsregulator. I Pseudomonas putida, erkänner ALKs C 5-C 10 n-alkaner som effektorer. Därefter höga nivåer av ALKs-alkan komplexet aktiverar PalkB promotorn resulterar i uttrycket av de alkBFGHJKL operon som kodar för proteiner involverade i omvandlingen av n-alkaner till fettsyror 19.

Avkänning och omvandling av kolväten är inte tillräckligt för cellen att vara livskraftig. Vid ökande kolväte i miljön, tillväxten av vildtyp E. coli inhiberas genom närvaron av vattenkraftkolatomer i membranet och i cellen, vilket kan orsaka protein-felveckning. P. horikoshii prefoldin är en chaperon medhjälp korrekt veckning av proteinet i närvaro av alkaner 17. Med hjälp av honom var det förutspått att detta protein interagerar med homolog E. coli eskortering proteiner, vilket tyder på att överuttryck av prefoldin i E. E. coli skulle kunna förbättra lösningsmedel tolerans. Med BioBrick BBa_K398406 (bestående av phPFDα och phPFDβ gener), överlevnadsförmågan för E. coli i närvaro av alkaner förbättrades upp till 50%. HIM är ett lämpligt verktyg för att välja potentiella funktionella homologer.

Med tanke på verktygslådan som helhet, kan man dra slutsatsen att den ger ett första steg vid konstruktionen av ett chassi för bioremediering av kolväten i vattenhaltiga miljöer. Detta innebär en liten, självständig, självreplikerande och relatively billig metod. Resultaten i huvudsak förvärvats genom enzymanalyser och skaka flash kulturer och måste därför valideras i större skala. Ytterligare forskning om detta system bör fokusera på kopplingen mellan de olika enzymer, som har visats här för att arbeta individuellt för att generera tänkt för kolväten nedbrytning. Dessutom kan tillägg av alternativa vägar för nedbrytning av andra föroreningar samt öka användningen av detta chassi bortom bioremediering av kolväten ensam till ett bredare spektrum av föroreningar och eventuellt genomförande av produktens vägar kan även använda detta system för produktion av värdefulla kemikalier. Våra resultat understryker lämplighet BioBricks montering strategi syntetisk biologi för att bygga nya organismer som kan hantera oljeföroreningar, och kan dessutom vara bra att utveckla ett brett utbud av andra applikationer.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Inga intressekonflikter deklareras.

Acknowledgments

De experiment som utförts i denna video-artikeln har utvecklats för den internationella Genmanipulerade Maskin tävling 9. Vill tacka iGEM gruppmedlemmar Luke Bergwerff, Pieter TM van Boheemen, Jelmer Cnossen, Hugo F. Cueto Rojas och Ramon van der Valk för författarna stödet i forskningen. Vi tackar Han de Winde, Stefan de Kok och Esengül Yıldırım för hjälp diskussioner och hosting denna forskning. Detta arbete stöddes av TU Delft University Institutionen för bioteknik, Delft Bioinformatics lab, TU Delft Institutionen för Bionanoscience, Oil Sands Ledarskap Initiative (OSLI), Stud studentenuitzendbureau, Nederländerna Genomics Initiative, Kluyver Centre Nederlandse Biotechnologische Vereniging (Stichting Biotechnology Nederland) , DSM, Geneart, Greiner Bio-One och Genencor.

Materials

Name Company Catalog Number Comments
E. coli K12 New England Biolabs C2523H
Octane Fluka 74822
Hexadecane Fluka 52209
octanol-1 Fluka 95446
dodecanol-1 Sigma-Aldrich 126799
Hexane Sigma-Aldrich 296090
NADH Sigma-Aldrich N4505
FMN Sigma-Aldrich F2253
MgSO4 J.T. Baker Casno 7487 889
Triton X-100 Sigma-Aldrich T8787
T4 ligase New England Biolabs M0202L
Gas chromatograph
Cell disrupter LA Biosystems CD-019
Spectrophotometer Amersham pharmacia spec 2000
Plate reader Tecan Group Ltd. Magellan v7.0
Incubator Innova, 44
BioBrickTM K398014: BBa_J23100-BBa_J61100-alkB2-BBa_J61100-rubA3-BBa_J61100-rubA4- BBa_J61100-rubB Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398014 Alkane Hydroxylase System
Resistance: Chloramphenicol
BioBrickTM K398027: BBa_R0040-BBa_B0034-ladA Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398027 ladA Protein Generator
Resistance: Chloramphenicol
BioBrickTM K398018: BBa_J23100-BBa_J61101-ADH Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398018 ADH generator
Resistance: Chloramphenicol
BioBrickTM K398030: BBa_R0040-BBa_B0034-ALDH Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398030 ALDH generator
Resistance: Chloramphenicol
BioBrickTM K398326: pCaiF Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398326 pCaiF promoter
Resistance: Chloramphenicol
BioBrickTM K398331: pCaiF-BBa_B0032-BBa_I13401 Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398331 pCaiF measurement device
Resistance: Chloramphenicol
BioBrickTM K398406: BBa_J23002-BBa_J61107-phPFDα-BBa_J61107- Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398406 Solvent tolerance cluster
Resistance: Chloramphenicol

DOWNLOAD MATERIALS LIST

References

  1. Allen, E. W. Process water treatment in Canada's oil sands industry: I: Target pollutants and treatment objectives. J. Environ. Eng. Sci. 7, 123-138 (2008).
  2. Alon, U. An Introduction to Systems Biology: Design Principles of Biological Circuits. CRC Press. (2007).
  3. Center, O. P. Understanding Oil Spills and Oil Spill Response. (1999).
  4. Cytoscape. An Open Source Platform for Complex Network Analysis and Visualization [Internet]. Available from: http://www.cytoscape.org (2012).
  5. Non-Invasive Biomass Monitor with Wide Linear Range [Internet]. Available from: http://www.buglab.com/docs/OnLineODMeasurement.pdf (2012).
  6. Eichler, K., Buchet, A., Lemke, R., Kleber, H. P., Mandrand-Berthelot, M. A. Identification and characterization of the caiF gene encoding a potential transcriptional activator of carnitine metabolism in Escherichia coli. J. Bacteriol. 178, 1248-1257 (1995).
  7. Feng, L., Wang, W., Cheng, J., Ren, Y., Zhao, G., Gao, C., Tang, Y., Liu, X., Han, W., Peng, X., et al. Genome and proteome of long-chain alkane degrading Geobacillus thermodenitrificans NG80-2 isolated from a deep-subsurface oil reservoir. Proc. Natl. Acad. Sci. U.S.A. 104, (13), 5602-5607 (2007).
  8. Fujii, T., Narikawa, T., Takeda, K., Kato, J. Biotransformation of various alkanes using the Escherichia coli expressing an alkane hydroxylase system from Gordonia sp. TF6. Biosci. Biotechnol. Biochem. 68, (10), 2171-2177 (2004).
  9. iGEM. Registry of Standard Biological Parts [Internet]. Available from: http://partsregistry.org/Main_Page (2012).
  10. Kato, T., Miyanaga, A., Haruki, M., Imanaka, T., Morikawa, M., Gene Kanaya, S. cloning of an alcohol dehydrogenase from thermophilic alkane-degrading Bacillus thermoleovorans B23. J. Biosci. Bioeng. 91, (1), 100-102 (2001).
  11. Kato, T., Miyanaga, A., Kanaya, S., Morikawa, M. Gene cloning and characterization of an aldehyde dehydrogenase from long-chain alkane-degrading Geobacillus thermoleovorans B23. Extremophiles. 14, 33-39 (2010).
  12. Kieboom, J., De Bont, J. aM. Bacterial Stress Responses. ASM Press. Washington, D.C. (2000).
  13. Kotte, O., Zaugg, J. B., Heinemann, M. Bacterial adaptation through distributed sensing of metabolic fluxes. Mol Syst Biol. 6, 355 (2010).
  14. Kremling, A., Bettenbrock, K., Gilles, E. D. Analysis of global control of Escherichia coli carbohydrate uptake. BMC Syst. Biol. 1, (2007).
  15. Li, L., Liu, X., Yang, W., Xu, F., Wang, W., Feng, L., Bartlam, M., Wang, L., Rao, Z. Crystal structure of long-chain alkane monooxygenase (LadA) in complex with coenzyme FMN: unveiling the long-chain alkane hydroxylase. J. Mol. Biol. 376, (2), 453-465 (2008).
  16. Lin, H. Y., Mathiszik, B., Xu, B., Enfors, S. O., Neubauer, P. Determination of the maximum specific uptake capacities for glucose and oxygen in glucose-limited fed-batch cultivations of Escherichia coli. Biotechnol. Bioeng. 73, (5), 347-357 (2001).
  17. Okochi, M., Kanie, K., Kurimoto, M., Yohda, M., Honda, H. Overexpression of prefoldin from the hyperthermophilic archaeum Pyrococcus horikoshii OT3 endowed Escherichia coli with organic solvent tolerance. Appl. Microbiol. Biotechnol. 79, (3), 443-449 (2008).
  18. Rehm, H. J., Reiff, I. Mechanisms and occurrence of microbial oxidation of long-chain alkanes. Adv. Biochem. Eng. / Biotechnol. 19, 175-215 (1981).
  19. Rojo, F. Degradation of alkanes by bacteria. Environ. Microbiol. 11, (10), 2477-2490 (2009).
  20. STRING 9.0 Known and Predicted Protein-Protein Interactions [Internet]. Available from: http://string-db.org/newstring_cgi/show_download_page.pl (2012).
  21. Van Beilen, J. B., Panke, S., Lucchini, S., Franchini, A. G., Rothlisberger, M., Witholt, B. Analysis of Pseudomonas putida alkane-degradation gene clusters and flanking insertion sequences: evolution and regulation of the alk genes. Microbiology. 147, 1621-1630 (2001).
  22. Wang, L., Tang, Y., Wang, S., Liu, R. L., Liu, M. Z., Zhang, Y., Liang, F. L., Feng, L. Isolation and characterization of a novel thermophilic Bacillus strain degrading long-chain n-alkanes. Extremophiles. 10, (4), 347-356 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics