प्रतिदीप्ति

Immunology and Infection
 

Summary

तीन मच्छर पीढ़ी, अर्थात् के अलावा

Cite this Article

Copy Citation | Download Citations

Timoshevskiy, V. A., Sharma, A., Sharakhov, I. V., Sharakhova, M. V. Fluorescent in situ Hybridization on Mitotic Chromosomes of Mosquitoes. J. Vis. Exp. (67), e4215, doi:10.3791/4215 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Protocol

1. क्रोमोजोम तैयारी

मच्छर लार्वा एनोफ़ेलीज़ उपलब्ध अनुसंधान में एक मानक तरीके में मलेरिया अनुसंधान और संदर्भ अभिकर्मक संसाधन केंद्र की वेबसाइट पर वर्णित प्रोटोकॉल का उपयोग कर पाला थे (MR4) 13. मच्छर के पालन के तापमान imaginal डिस्क और लार्वा के सबसे कम मृत्यु दर में गुणसूत्रों की सबसे बड़ी संख्या प्रदान करने के लिए संशोधित किया गया है. मच्छरों का लार्वा के विकास के चरणों उनके सिर 13 कैप्सूल के आकार के आधार पर निर्धारित किया गया है.

  1. हैच 28 में मच्छर अंडे डिग्री सेल्सियस, और 2-3 दिनों, स्थानांतरण 2 एन डी या के लिए 3 Rd instar लार्वा 16 डिग्री सेल्सियस के बाद. aegypti और Cx. और एक के लिए 22 डिग्री सेल्सियस quinquefasciatus. gambiae.
  2. 4 वें प्लेस स्थिरीकरण के लिए कई मिनट के लिए बर्फ पर instar लार्वा.
  3. एक स्लाइड ठंड hypotonic समाधान की एक बूंद (0.5% तो लार्वा स्थानांतरणdium साइट्रेट या .075 एम पोटेशियम क्लोराइड), और स्टीरियो माइक्रोस्कोप के तहत जगह.
  4. अंडाकार आईडी (चित्रा 1 बी) के साथ आगे विच्छेदन के लिए लार्वा का चयन करें.
  5. लार्वा सिर काटना, और लार्वा विदारक कैंची (2 चित्रा) का उपयोग करते हुए छाती के उदर की ओर से छल्ली काट. दूसरे या तीसरे पेट खंड में अतिरिक्त कटौती लार्वा से पेट टुकड़े करना. कटौती की दिशा तीर से दिखाए जाते हैं.
  6. छल्ली खोलें, और पेट और लार्वा से शरीर में वसा को हटा दें. फिल्टर पेपर का उपयोग कर स्लाइड से hypotonic समाधान निकालें, और सीधे आईडी hypotonic समाधान (चित्रा 2B) के एक ताजा बूंद जोड़ें. Hypotonic समाधान में लार्वा आरटी पर 10 मिनट के लिए रखें.
  7. फिल्टर पेपर का उपयोग करते हुए hypotonic समाधान निकालें, और Carnoy समाधान (इथेनॉल / 3:1 के अनुपात में एसिटिक एसिड) लागू. लगानेवाला समाधान जोड़ने के बाद तुरंत सफेद बारी आईडी और आसानी से खुर्दबीन के नीचे दिखाई हो जाते हैं (चित्रा 2C
  8. विदारक सुइयों का उपयोग, लार्वा (चित्रा 2 डी) से आईडी निकालने के लिए, और उन्हें 50% propionic एसिड की एक बूंद के लिए स्थानांतरण. पेट और शरीर में वसा के रूप में किसी भी अन्य ऊतकों, स्लाइड से निकालें. एक unsiliconized 22x22 कवर पर्ची के साथ आईडी कवर, और आरटी पर 10 मिनट के लिए रहते हैं.
  9. फिल्टर पेपर के साथ स्लाइड, और कवर कवर पर्ची की परिधि पर एक पेंसिल के रबड़ दोहन द्वारा ऊतक स्क्वैश.
  10. संक्षेप में खुर्दबीन चरण विपरीत 100x या 200x बढ़ाई (चित्रा 3) का उपयोग स्लाइड की गुणवत्ता का विश्लेषण. > 50 गुणसूत्र फैलता के साथ तैयारी मछली के लिए उपयुक्त माना जा सकता है.
  11. डुबकी और तरल नाइट्रोजन में स्लाइड पकड़ जब तक यह बुदबुदाती बंद हो जाता है. एक रेजर ब्लेड का उपयोग कर स्लाइड से कवर पर्ची निकालें, और स्लाइड 70% इथेनॉल के एक कंटेनर -20 डिग्री सेल्सियस में ठंडा करने के लिए तुरंत हस्तांतरण 4 में स्टोर ° सी सबसे अच्छा निर्जलीकरण परिणाम (यदि आवश्यक के लिए कम से कम 1 घंटे के लिए, स्लाइड्स टी में संग्रहित किया जा सकता हैअपने कई मिनट से कई दिनों के लिए कदम).
  12. इथेनॉल की एक श्रृंखला (70%, 80%, 100%) 4 डिग्री सेल्सियस में 5 मिनट प्रत्येक, और आरटी शुष्क हवा के लिए स्लाइड निर्जलीकरण.
  13. -20 डिग्री सेल्सियस में उन्हें मछली के लिए उपयोग करने से पहले सूखे स्लाइड स्टोर.

2. दोहरावदार डीएनए भिन्नों का निष्कर्षण

से गुणसूत्रों पर बीएसी क्लोन डीएनए जांच की मछली प्रदर्शन. aegypti और Cx. quinquefasciatus unlabeled दोहराए डीएनए fractions का उपयोग करने के लिए क्रोमोसोम डीएनए दोहराता unspecific संकरण ब्लॉक की आवश्यकता है. कई सौ बीपी के टुकड़ों में खंडित एकल भूग्रस्त डीएनए के reassociation एक सी 0 टी वक्र जहां सी 0 एकल असहाय डीएनए के प्रारंभिक एकाग्रता और टी reannealing समय है इस प्रकार है. C0t 10 -4 -10 -1 या 10 के बराबर मूल्यों ° 2 -10 के साथ डीएनए भिन्न के रूप में उच्च और मध्यम दोहराव माना जाता है, क्रमशः.

  1. 40 निकालेंपूरे वयस्क Qiagen रक्त और सेल संस्कृति Maxikit का उपयोग मच्छर से जीनोमिक डीएनए के 0-500 ग्राम, और एनजी 100-1,000 / 1.2x एसएससी में μl डीएनए समाधान तैयार.
  2. जीनोमिक डीएनए के साथ एक हीटिंग ब्लॉक में एक सुरक्षित लॉक ट्यूब डाल द्वारा denature डीएनए ° 2 मिनट के लिए C 120 prewarmed. उच्च तापमान 200-500 बीपी टुकड़ों में डीएनए को लेकर करने में मदद करता है.
  3. डीएनए एकाग्रता पर निर्भर करता है, तो 60 डिग्री सेल्सियस में 15-150 मिनट के लिए ट्यूब सी 0 टी डीएनए fractions सी 0 (1 टेबल) t3 करने के लिए प्राप्त करने के लिए रखने के द्वारा डीएनए reassociate.
  4. बर्फ पर 2 मिनट के लिए डीएनए के साथ ट्यूब रखें.
  5. 42 करने के लिए डीएनए स्थानांतरित ° सी, डीएनए के 1 मिलीग्राम प्रति 100 यू के एक अंतिम एकाग्रता preheated 10x S1 nuclease बफर और S1 nuclease जोड़ने के लिए, और 1 घंटे के लिए सेते हैं.
  6. पेंदी में बैठ जाना डीएनए 3 एम सोडियम एसीटेट और आरटी पर 1 isopropanol की मात्रा 0.1 मात्रा जोड़कर.
  7. 4 डिग्री सेल्सियस पर 20 मिनट के लिए 14,000 rpm पर अपकेंद्रित्र
  8. 70% इथेनॉल में डीएनए को धो, और फिर 10 मिनट के लिए 14,000 rpm पर अपकेंद्रित्र4 डिग्री सेल्सियस
  9. एयर सूखी और ते बफर में डीएनए गोली भंग.
  10. डीएनए की एकाग्रता को मापने, और जेल वैद्युतकणसंचलन द्वारा कल्पना. आमतौर पर दोहरावदार डीएनए fractions के अंतिम मात्रा मूल डीएनए राशि के 35-50% का प्रतिनिधित्व करता है.

3. डीएनए जांच लेबल

दो अलग अलग प्रोटोकॉल लेबलिंग बीएसी क्लोन डीएनए जांच और IGS rDNA जांच के लिए इस्तेमाल किया गया.

3.1 बीएसी क्लोन निक अनुवाद का उपयोग लेबलिंग

  1. Qiagen बड़े निर्माण किट का उपयोग बीएसी पुस्तकालय से बीएसी क्लोन डीएनए निकालने.
  2. , Cy3 dUTP की 1 μl (या किसी अन्य ग्राम 1 पृथक बीएसी क्लोन डीएनए, 0.05 मिमी unlabeled dATP, dCTP, और dGTP प्रत्येक और dTTP की 0.015 मिमी: निक अनुवाद 50 μl के अंतिम मात्रा के साथ बर्फ पर लेबलिंग के लिए प्रतिक्रिया मिश्रण तैयार ) fluorochrome, 0.05 मिलीग्राम / एमएल BSA के, 10x बफर निक अनुवाद के 5 μl, डीएनए पोलीमरेज़ की 20 यू मैं, और DNase की .0012 यू.
  3. 2 के लिए 15 डिग्री सेल्सियस पर सेते.5 घंटा.
  4. 0.5 एम EDTA के 1 μl जोड़कर प्रतिक्रिया बंद करो.
  5. एक अंधेरी जगह में -20 डिग्री सेल्सियस पर स्टोर जांच.

3.2 IGS rDNA पीसीआर का उपयोग कर लेबलिंग

  1. , 0.05 मिमी unlabeled dATP, dCTP, और dGTP प्रत्येक, dTTP की 0.015 मिमी, Cy3 dUTP (या एक और fluorochrome) की 1 μl, 5 μl जीनोमिक डीएनए के 200 एनजी: 50 μl के अंतिम मात्रा के साथ बर्फ पर प्रतिक्रिया मिश्रण तैयार आगे की 50 pmol; 10x पीसीआर बफर संयुक्त राष्ट्र (GTGTGCCCCTTCCTCGATGT) और रिवर्स, GA IGS प्रवर्धन के लिए (CTGGTTTGGTCGGCACGTTT) प्राइमरों, और Taq डीएनए पोलीमरेज़ 14 के 10 यू.
  2. (95 ° सेकंड / 30 सी, 50 डिग्री सेल्सियस / 30 सेकंड, 72 डिग्री सेल्सियस / सेकंड 30) x 30 चक्र, 72 C ° 95 ° सी / 5 मिनट x 1 चक्र: पीसीआर प्रतिक्रिया IGS प्रवर्धन के लिए मानक पीसीआर मापदंडों का उपयोग कर प्रदर्शन / 5 मिनट x 1 चक्र, और 4 डिग्री सेल्सियस 14 पकड़.
  3. एक अंधेरी जगह में -20 डिग्री सेल्सियस पर स्टोर जांच.

4. स्वस्थानी संकरण में प्रतिदीप्त

और Cx. quinquefasciatus और एक की mitotic गुणसूत्रों पर IGS rDNA का उपयोग करने के लिए 2. gambiae. बीएसी क्लोन डीएनए जांच का उपयोग अगर, छोड़ RNase उपचार चरण 4.4 4.3, और एक साथ विकृतीकरण / स्लाइड जांच 4.19 कदम. IGS rDNA जांच का उपयोग अगर, सी 0 टी डीएनए fractions बिना संकरण मिश्रण तैयार करते हैं, और अलग स्लाइड / जांच चरणों का 4.10, 4.11, 4.16, और 4.17 denaturing छोड़.

  1. 30 मिनट के लिए 37 में 2x एसएससी में स्लाइड्स सेते डिग्री सेल्सियस
  2. RT 5 मिनट के प्रत्येक, और शुष्क हवा के लिए 70% की श्रृंखला, 80%, और 100% इथेनॉल में स्लाइड्स निर्जलीकरण बीएसी क्लोन डीएनए के साथ मछली प्रदर्शन अगर, सीधे आगे बढ़ने के लिए 4.5 कदम.
  3. 0.1 मिलीग्राम / parafilm तहत मिलीग्राम RNase समाधान में 37 डिग्री सेल्सियस पर 30 मिनट के लिए गुणसूत्र तैयारी सेते हैं.
  4. 2x एसएससी में दो बार 37 पर 5 मिनट के लिए धो डिग्री सेल्सियस
  5. स्लाइड्स मैं डालना 37 में 0.01% पेप्सिन और 0.037% एचसीएल समाधान, और 5 मिनट के लिए सेते के साथ जार ° सी.
  6. आरटी पर 5 मिनट के लिए स्लाइड 1x पीबीएस में धो लें.
  7. 1% 1x पीबीएस में 10% से तैयार formalin आरटी पर 10 मिनट के लिए तटस्थ बफर formalin के साथ एक जार में गुणसूत्र तैयारी फिक्स.
  8. आरटी पर 5 मिनट के लिए स्लाइड 1x पीबीएस में धो लें.
  9. RT 5 मिनट के प्रत्येक, और शुष्क हवा की तैयारी के लिए 70% की श्रृंखला, 80%, और 100% इथेनॉल में स्लाइड 37 ° निर्जलीकरण IGS साथ मछली प्रदर्शन सी., सीधे आगे बढ़ने के लिए 4.12 कदम
  10. 72 डिग्री सेल्सियस से कम 2 मिनट के लिए prewarmed Formamide 70% के साथ एक जार में denature स्लाइड
  11. ठंड (-20 ° C) 70%, 80%, 37 और 5 मिनट प्रत्येक और शुष्क हवा के लिए 100% इथेनॉल डिग्री सेल्सियस की श्रृंखला में स्लाइड निर्जलीकरण
  12. IGS साथ मछली के लिए लेबल चरण 3, सी 0 1 ग्राम / μl sonicated सामन शुक्राणु डीएनए के 0.5 एनजी / μl, और 5 μl के अंतिम एकाग्रता के साथ 2 कदम से डीएनए के 10 μl से डीएनए जांच की 5 μl. संकरण मिश्रण तैयार rDNA तैयार करते हैं,सी 0 टी डीएनए fractions बिना संकरण मिश्रण.
  13. पेंदी में बैठ जाना डीएनए 3 एम सोडियम एसीटेट और इथेनॉल के 2 संस्करणों के 0.1 मात्रा जोड़कर. -20 डिग्री सेल्सियस में 1-3 घंटे के लिए रखें.
  14. +१४००० Rpm पर अपकेंद्रित्र ° 4 बजे 20 मिनट के लिए सी, इथेनॉल निकालने के लिए, और हवा सूखी आरटी पर गोली.
  15. संकरण बफर के 10 μl में अच्छी तरह से गोली भंग: 50% Formamide, 20% dextran सल्फेट, 2x एसएससी IGS के साथ मछली प्रदर्शन यदि सीधे आगे बढ़ने के लिए 4.18 कदम
  16. 7 मिनट में 97 डिग्री सेल्सियस, और तुरंत के लिए denature संकरण मिश्रण 1 मिनट के लिए बर्फ पर डाल दिया.
  17. गुणसूत्रों को दोहराव डीएनए के unspecific संकरण को रोकने के लिए 30 मिनट के लिए 37 डिग्री सेल्सियस पर मिश्रण Prehybridize.
  18. स्लाइड पर संकरण मिश्रण के 10 μl, और एक 22x22 कवर पर्ची के साथ कवर रखें. बुलबुला गठन को रोकने के हवाई बुलबुले coverslip कोमल दबाव के साथ हटा दिया जाना चाहिए यदि बीएसी क्लोन डीएनए के साथ मछली का प्रदर्शन, आगे बढ़ने के लिए सीधे कदम 4.20 <./ Em>
  19. जांच और गुणसूत्र डीएनए एक साथ 5 मिनट के लिए 75 पर एक हीटिंग ब्लॉक डिग्री सेल्सियस का उपयोग denature.
  20. गोंद रबर सीमेंट का उपयोग परिधि के आसपास कवर पर्ची.
  21. एक नम चैम्बर में 37 में रातोंरात संकरण प्रदर्शन डिग्री सेल्सियस
  22. रबर और स्लाइड से सीमेंट coverslip निकालें.
  23. Prewarmed समाधान 1 (0.4x एसएससी, 0.3%-P40 Nonidet) में 73 डिग्री सेल्सियस पर स्लाइड 2 मिनट धो
  24. आरटी पर 5 मिनट के लिए समाधान 2 (2x एसएससी, 0.1%-P40 Nonidet) में स्लाइड्स धो लें.
  25. 1x पीबीएस में आरटी पर नम कक्ष में 10 मिनट के लिए 0.001 मिमी YOYO-1 का उपयोग कर स्लाइड Counterstain.
  26. एक कवर पर्ची के साथ गोल्ड antifade अभिकर्मक लम्बा की एक छोटी राशि में माउंट.
  27. हज़ार x बढ़ाई (4 चित्रा) में उपयुक्त फिल्टर सेट का उपयोग कर एक फ्लोरोसेंट खुर्दबीन के नीचे तैयारी विश्लेषण.

5. प्रतिनिधि परिणाम

कीट आईडी लार्वा के प्रत्येक खंड में स्थित हैं. स्थिति पर निर्भर करता है, वेंey कीट के वयस्क चरण में विभिन्न ऊतकों में बदलना. आईडी, जो इस प्रोटोकॉल में गुणसूत्र तैयारी के लिए उपयोग किया जाता है, मच्छर के वयस्क अवस्था में पैरों में विकसित करना. इन आईडी लार्वा छाती के उदर पक्ष पर स्थित हैं और (1 चित्रा) खुर्दबीन के नीचे छल्ली के माध्यम से स्पष्ट रूप से दिखाई दे रहे हैं. जल्दी 4 वें instar लार्वा चरण में, आईडी एक गोल आकार (चित्रा 1 ए) है. पिंजरे का बँटवारा की सबसे बड़ी संख्या एक में 175 आईडी 9, बाद में "अंडाकार आकार" चरण (चित्रा 1 बी), है जो स्लाइड तैयार करने के लिए इष्टतम मंच विचार किया जाना चाहिए पर जमा कर रहे हैं. इस समय, मध्यवर्ती ID दो में विभाजन: एक पैर में एक बदल देती है और एक दूसरे के एक पंख में बदल देती है. हम "अंडाकार आकार" चरण में गुणसूत्र स्लाइड तैयार करने के लिए बड़े पैर आईडी का उपयोग कर पसंद करते हैं चित्रा 1C 4 वें instar लार्वा के विकास के नवीनतम चरण में आईडी का प्रतिनिधित्व करता है. इस स्तर पर,आईडी पहले से ही पैर और पंखों में विकसित कर रहे हैं, और विभेदित ऊतकों की एक महत्वपूर्ण राशि और पिंजरे का बँटवारा की एक कम संख्या में होते हैं. आईडी विकास के इस चरण गुणसूत्र स्लाइड तैयार करने के लिए बचा जाना चाहिए. हम भी पालन कम तापमान पर मच्छरों का लार्वा की सिफारिश: 16 डिग्री सेल्सियस एनोफ़ेलीज़ लिए एडीज और क्युलेक्स और 22 डिग्री सेल्सियस के लिए यह 9 आईडी में पिंजरे का बँटवारा की राशि में वृद्धि करने में मदद करता है.

चित्रा 2 4 वें instar लार्वा की छाती से आईडी विच्छेदन दिखाता है. क्योंकि एक जीवित कीट की छल्ली को काटना मुश्किल है, हम विदारक के बजाय कैंची सामान्यतः लार्वा तैयार करने के लिए इस्तेमाल किया सुइयों का उपयोग करने की सलाह देते हैं. उच्च गुणवत्ता वाले गुणसूत्र तैयारी प्राप्त करने के लिए सबसे महत्वपूर्ण प्रक्रिया hypotonic समाधान उपचार है. सर्वोत्तम परिणामों के लिए, हम और इस उपचार से पहले लार्वा छाती से पेट और शरीर में वसा को हटा दें. इस प्रक्रिया के दौरान आईडी कोशिकाओं की सूजन गुणसूत्र का प्रसार करने में मदद करता हैएक स्लाइड (चित्रा 3A) पर है. hypotonic समाधान उपचार की उचित गुणवत्ता तैयारी में कोशिकाओं के गोल आकार (चित्रा 3 ए, बी) के द्वारा आसानी से पहचाना जा सकता है. एक अंडाकार आकार के साथ कोशिकाओं अपर्याप्त hypotonic समाधान उपचार (चित्रा 3C) से संकेत मिलता है. मछली के लिए चुना जा, गुणसूत्र तैयारी कम से कम 50 उच्च गुणवत्ता वाले गुणसूत्र फैलता शामिल करना चाहिए. आम तौर पर, इस प्रोटोकॉल का उपयोग कर तैयार स्लाइड की 90% 9 मछली के लिए पर्याप्त गुणवत्ता की है.

एडीज और क्युलेक्स की mitotic गुणसूत्रों पर जीनोमिक बीएसी क्लोन डीएनए जांच का उपयोग कर मछली और एनोफ़ेलीज़ की mitotic गुणसूत्रों पर IGS rDNA जांच के लिए एक सरल मछली प्रोटोकॉल के लिए एक उन्नत प्रोटोकॉल: हम दो अलग मछली प्रोटोकॉल उपस्थित थे. एडीज और क्युलेक्स की जीनोम अत्यधिक क्योंकि transposable 7,8 तत्वों की overrepresentation की दोहराए हैं. इस प्रकार, प्रदर्शन, मछली, जो utएक जांच के रूप में जीनोमिक बीएसी क्लोन डीएनए ilizes, जांच करने के लिए unlabeled दोहराए डीएनए fractions जोड़ने गुणसूत्रों के डीएनए दोहराता unspecific संकरण ब्लॉक की आवश्यकता है. दोहरावदार डीएनए fractions की निकासी के लिए, जीनोमिक डीएनए 2 मिनट के लिए 120 डिग्री सेल्सियस पर विकृत है. एक उच्च तापमान पर उबलते डीएनए भी 200-500 बीपी के टुकड़े में डीएनए प्राप्त करने में मदद करता है. डीएनए के लिए इस इलाज के बाद reassociate करने के लिए अनुमति दी है. अत्यधिक दोहराव डीएनए टुकड़े reassociation के लिए अपने दोस्त के तेजी से अद्वितीय दृश्यों के साथ डीएनए करता मिल जाते हैं. नतीजतन, डीएनए के reassociation एक टी सी 0 x वक्र प्रकार जहां सी 0 एकल असहाय डीएनए के प्रारंभिक एकाग्रता, और टी reannealing समय है. सी 0 टी 10-4 के बराबर मूल्यों के साथ डीएनए fractions - 10-1 या 100-102 उच्च और मध्यम दोहराव माना जाता है, क्रमशः. अलग सी 0 टी डीएनए fractions लिए reassociation के समय वें का उपयोग कर गणना की जा सकती हैई टी सूत्र = 0 सी टी एक्स 4.98 × 0 / सी, टी, जहां ऊष्मायन के समय, सी 0 टी एक्स - सी टी 0 अंश (1 C0t = 1, सी 0 2 टी = 2, आदि) और सी 0 - ग्राम / 15 μl में प्रारंभिक डीएनए एकाग्रता (1 टेबल). Reassociation बाद, एकल असहाय डीएनए S1 nuclease का उपयोग पच जाता है. हम सभी सी 0 टी डीएनए भिन्न करने के लिए उपयोग कर पसंद सी 0 3 एक साथ टी के बजाय आमतौर पर इस्तेमाल किया सी 0 टी 1 डीएनए अंश. इन सी 0 टी fractions मामूली दोहरावदार डीएनए दृश्यों के कुछ शामिल हैं और आमतौर पर एक साथ में जीनोमिक डीएनए के मूल राशि का 35-50% का प्रतिनिधित्व करते हैं. aegypti. लेबल डीएनए जांच और unlabeled सी 0 टी डीएनए अंश के बीच सही अनुपात प्रत्येक विशेष बीएसी क्लोन में दोहरावदार डीएनए घटक पर निर्भर करता है. औसत पर, हम सी 0 टी 1:20 जांच का उपयोग करेंएक स्वीकार्य संकेत / मछली परिणाम की पृष्ठभूमि अनुपात प्राप्त करने के लिए डीएनए अंश अनुपात. टी 0 सी स्लाइड पर वास्तविक संकरण से पहले 30 मिनट के लिए एक ट्यूब में डीएनए के साथ fractions डीएनए जांच की Prehybridization भी पृष्ठभूमि को कम करने में मदद करता है. लेबलिंग, खुद संकरण, और इस प्रोटोकॉल में धुलाई मानक स्थितियों 12 का उपयोग करते हुए प्रदर्शन कर रहे हैं.

मछली दो अलग ढंग से लेबल की mitotic गुणसूत्रों पर बीएसी क्लोन डीएनए जांच के परिणाम है. aegypti और Cx. quinquefasciatus आंकड़े -4 ए और बी में दिखाया जाता है, क्रमशः. बीएसी क्लोन डीएनए जांच गुणसूत्रों पर एक ही स्थिति में मजबूत संकेतों का उत्पादन. चित्र 1 में दिखाया गुणसूत्रों YOYO एक आयोडाइड के साथ counterstained हैं. इस डाई पर सबसे अच्छा बैंडिंग पैटर्न पैदा करता है. aegypti गुणसूत्रों 9. वैकल्पिक रूप से, DAPI या propidium आयोडाइड के रूप में अन्य फ्लोरोसेंट रंजक, वीं के लिए उपयोग किया जा सकता हैई गुणसूत्र counterstaining. स्लाइड्स की दबा photobleaching के लिए, हम गोल्ड antifade बढ़ते मध्यम लम्बा का उपयोग करें. यह अभिकर्मक अच्छा संकेत संरक्षण क्षमता है और भी आसानी से 1x पीबीएस में rinsing अगर यह कई hybridizations के लिए एक ही स्लाइड का उपयोग करने के लिए आवश्यक है स्लाइड से हटाया जा सकता है.

मछली प्रोटोकॉल का एक सरल संस्करण IGS rDNA जांच की एनोफ़ेलीज़ की mitotic गुणसूत्रों पर संकरण के लिए बनाया गया है. एनोफ़ेलीज़ में Ribosomal जीन सेक्स क्रोमोसोम 16 पर स्थित जीन के एक बहुरूपी क्लस्टर के रूप में प्रतिनिधित्व कर रहे हैं. इस प्रोटोकॉल में एक डीएनए जांच मानक पीसीआर प्रतिक्रिया का उपयोग fluorescently लेबल Cy3 या Cy5 dNTPs जोड़कर लेबल है. क्योंकि euchromatin में दोहराव डीएनए के unspecific संकरण अवरुद्ध की जरूरत नहीं है, सभी सी 0 टी डीएनए fractions का उपयोग करने के लिए संबंधित कदम छोड़े गए हैं. इसके बजाय, गुणसूत्र की तैयारी RNase साथ IGS rDNA जांच के संकरण को रोकने के लिए pretreatednucleolus. क्रोमोसोम और डीएनए जांच के साथ स्लाइड एक साथ एक संकरण प्रणाली में एक जांच के साथ 75 डिग्री सेल्सियस पर 5 मिनट के लिए गर्म द्वारा विकृत कर रहे हैं. इस प्रोटोकॉल में संकरण धोने भी 12 मछली के लिए मानक स्थितियों का उपयोग किया जाता है. मछली का परिणाम चित्रा 4C में प्रदर्शन किया है: दो एक्स क्रोमोसोम के बीच IGS rDNA संकरण के बहुरूपता स्पष्ट रूप से दिखाई देता है.

0 टी 3 rowspan
डीएनए / एकाग्रता ग्राम μl समय Reannealing मिनट,
सी 0 2 टी 0.1 100
0.3 33
0.5 20
0.7 14
0.9 11
1 10
0.1 150
0.3 50
0.5 30
0.7 21
0.9 17
1 15

टेबल डीएनए 1. एकाग्रता और सी टी 2 और सी 0 t3 fractions 0 की तैयारी के लिए reannealing बार.

चित्रा 1
चित्रा 1 4 वें instar लार्वा में आईडी के विकास के चरणों: ए) एक प्रारंभिक "गोल आकार" मंच, बी) एक मध्यवर्ती "अंडाकार आकार" मंच - गुणसूत्र तैयारी के लिए इष्टतम, सी) एक देर मंच - गुणसूत्र की तैयारी के लिए अनुपयुक्त हैं. . आईडी के पदों लार्वा छाती के उदर पक्ष पर तीर द्वारा संकेत कर रहे हैं.

चित्रा 2
चित्रा 2 आईडी विच्छेदन के कदम: ए) decapitated लार्वा (कटौती की दिशा में तीर से संकेत कर रहे हैं), बी) hypotonic समाधान उपचार के तहत dissected पेट (आईडी फूल और लगभग अदृश्य हो जाते हैं) के साथ लार्वा, सी) Carnoy समाधान आवेदन के बाद लार्वा (. आईडी सफेद और स्पष्ट रूप से दिखाई देता हो), डी) Carnoy समाधान में आईडी dissected. तारों से लार्वा में आईडी की स्थिति संकेत कर रहे हैं.

चित्रा 3
चित्रा 3 गुणसूत्र फैलाता के विभिन्न गुणों: ए) एक सही गुणसूत्र फैल - कोशिकाओं के गोल आकार hypotonic समाधान में आईडी की पर्याप्त उपचार को दर्शाता है, बी) एक सही hypotonic उपचार - गुणसूत्रों थोड़ा undersquashed हैं, सी) एक गरीब गुणसूत्र प्रसार. - का परिणामअपर्याप्त hypotonic उपचार कोशिकाओं की अंडाकार आकार से संकेत दिया है.

चित्रा 4
चित्रा 4 बीएसी क्लोनों (ए, बी) और के गुणसूत्रों में IGS rDNA (सी) के साथ मछली का उदाहरण. (A) aegypti, Cx (बी). quinquefasciatus, और एक. gambiae (सी). 1, 2 और 3 - गुणसूत्रों की संख्या, एक्स - एक में महिला लिंग गुणसूत्र. gambiae.

Discussion

मच्छरों की mitotic गुणसूत्रों पर स्वस्थानी संकरण में Nonfluorescent 1990 में पहली बार के लिए ए कुमार और कश्मीर राय 17 द्वारा किया गया था. उस अध्ययन में 18S और 28S ribosomal डीएनए जीन, एक प्लाज्मिड में एक साथ क्लोन, मच्छरों की 20 प्रजातियों के गुणसूत्रों के लिए रखा गया है. डीएनए जांच radioactively चिह्नित किया गया और मस्तिष्क ganglia से गुणसूत्रों संकरित. तीन मच्छर पीढ़ी के बीच एक मछली तकनीक की सेल लाइन से mitotic गुणसूत्रों के लिए ही विकसित किया गया है. aegypti 10,18,19 और mitotic गुणसूत्रों पर रहते मच्छरों से कभी नहीं किया किया गया है. हाल ही में, हम 4 वें instar 9 लार्वा के आईडी से उच्च गुणवत्ता वाले गुणसूत्र तैयारियाँ प्राप्त करने के लिए एक सरल, मजबूत तकनीक विकसित की है. इस विधि गुणसूत्रों की एक उच्च संख्या एक स्लाइड में प्राप्त करने के लिए अनुमति देता है और सार्वभौमिक मच्छरों की सभी प्रजातियों के लिए इस्तेमाल किया जा सकता है. केवल लार्वा पोटा संबंधी, वयस्क नहीं या स्टेशन का उपयोग करने की आवश्यकतामच्छरों की ges, स्लाइड तैयार करने के लिए शायद पद्धति का ही सीमा है. मानक मछली 12 विधि जीनोमिक बीएसी क्लोन और IGS rDNA एडीज, क्युलेक्स और एनोफ़ेलीज़ mitotic गुणसूत्रों के लिए जांच के रूप में उपयोग करने के लिए अनुकूलित किया गया था.

इन विशिष्ट अनुप्रयोगों के अलावा, मछली यहाँ वर्णित प्रोटोकॉल भी अन्य प्रयोजनों के लिए इस्तेमाल किया जा सकता है. उन्नत मछली प्रोटोकॉल है, जो unspecific संकरण को अवरुद्ध करने के लिए सी 0 टी डीएनए fractions का इस्तेमाल भी बीएसी क्लोनों एनोफ़ेलीज़ की heterochromatic क्षेत्रों में या किसी अन्य बड़े डीएनए टुकड़े के संकरण के लिए लागू किया जा सकता है. Heterochromatic क्षेत्रों transposable तत्वों और अन्य दोहराता के साथ समृद्ध कर रहे हैं, और इन क्षेत्रों से जांच आम तौर पर 3 गुणसूत्रों पर मजबूत पृष्ठभूमि का उत्पादन. Unlabeled सी 0 टी डीएनए fractions का उपयोग गुणसूत्रों को जांच के unspecific संकरण को कम करने में मदद मिलेगी. मछली जनसंपर्क के सरल संस्करणotocol किसी भी rDNA या मच्छर तथा अन्य कीड़ों के mitotic गुणसूत्रों पर दोहराए डीएनए जांच के लिए इस्तेमाल किया जा सकता है. इसके अलावा, यह भी कम एनोफ़ेलीज़ या ड्रोसोफिला के रूप में euchromatic क्षेत्रों में दोहराव डीएनए सामग्री के साथ प्रजातियों के में बीएसी क्लोन डीएनए के संकरण के लिए लागू किया जा सकता है. यहाँ प्रस्तावित प्रोटोकॉल के लिए अत्यधिक समाप्त गुणसूत्र आधारित मच्छरों के लिए जीनोम असेंबलियों को प्राप्त करने में मदद है और मोटे तौर पर कीड़े के अन्य समूहों में विभिन्न cytogenetic अनुप्रयोगों के लिए इस्तेमाल किया जा सकता है.

Disclosures

ब्याज की कोई संघर्ष की घोषणा की.

Acknowledgments

हम उनकी मदद के लिए गुणसूत्र और एनोफ़ेलीज़ पर तैयारी मछली के साथ में सर्गेई Demin और तात्याना Karamysheva धन्यवाद. हम भी हमें पाठ संपादन के लिए एडीज और क्यूलेक्स जीनोमिक डीएनए बीएसी क्लोन और मेलिस्सा उतारा प्रदान करने के लिए डेविड Severson धन्यवाद. 1R21 AI88035-01 इगोर वी. Sharakhov मारिया वी. Sharakhova और 1R21 AI094289-01: यह काम दो स्वास्थ्य के राष्ट्रीय संस्थानों से अनुदान द्वारा समर्थित किया गया था.

Materials

Name Company Catalog Number Comments
MZ6 Leica stereomicroscope Leica VA-OM-E194-354 A different stereomicroscope can be used
Olympus CX41 phase microscope Olympus CX41 A different phase microscope can be used
Olympus BX61 fluorescent microscope Olympus BX61 A different fluorescent microscope can be used
ThermoBrite Slide Denaturation/Hybridization System Abbott Molecular 30-144110 Serves as a heating block and a humid chamber
Dissecting needles Fine ScienceTools 10130-10
Needle holders Fine Science Tools 26018-17
Dissecting scissors Fine Science Tools 15000-03
75x25 double frosted micro slides Corning 2949-75x25
22x22 mm microscope coverslips Fisher Scientific 12-544-10
Parafilm Fisher Scientific 13-374-10
Rubber Cement Fisher Scientific 50-949-105
Acetic acid Fisher Scientific A491-212
Alcohol 200 Proof Decon Laboratories 2701
Propionic acid Sigma-Aldrich 402907
Hydrochloric acid Fisher Scientific A144-500
Sodium citrate dihydrate Fisher Scientific S279-500
Sodium acetate trihydrate Fisher Scientific BP334-500
Potassium chloride Fisher Scientific BP366-500
EDTA Fisher Scientific S311-500
Tris base Fisher Scientific BP152-1
10x PBS Invitrogen P5493
10% NBF (neutral buffered formalin) Sigma-Aldrich HT501128
99% formamide Fisher Scientific BP227500
Dextran sulfate sodium salt Sigma-Aldrich D8906
20x SSC buffer Invitrogen AM9765
1 mM YOYO-1 iodide (491/509) solution Invitrogen Y3601
Antifade Prolong Gold reagent Invitrogen P36930
dATP, dCTP, dGTP, dTTP Fermentas R0141, R0151, R0161, R0171
Cy3-dUTP, Cy5-dUTP GE Healthcare PA53022, PA55022
BSA Sigma-Aldrich A3294
DNA Polymerase I Fermentas EP0041
DNase I Fermentas EN0521
S1 Nuclease Fermentas EN0321
Taq DNA Polymerase Invitrogen 18038-042
RNase Sigma-Aldrich 9001-99-4
Pepsin USB 9001-75-6
Salmon sperm DNA Sigma-Aldrich D7656
Nonidet-P40 (NP40) US Biological NC9375914
Qiagen Blood and Cell Culture Maxikit Qiagen 13362
Qiagen Large Construct Kit Qiagen 12462

DOWNLOAD MATERIALS LIST

References

  1. Sharakhov, I. V., Sharakhova, M. V. Chromosome Mapping Research Developments. Verrity, J. F., Abbington, L. E. Nova Science Publishers, Inc. (2008).
  2. Holt, R. A., et al. The genome sequence of the malaria mosquito Anopheles gambiae. Science. 298, 129-149 (2002).
  3. Sharakhova, M. V., et al. Update of the Anopheles gambiae PEST genome assembly. Genome biology. 8, R5 (2007).
  4. Campos, J., Andrade, C. F., Recco-Pimentel, S. M. A technique for preparing polytene chromosomes from Aedes aegypti (Diptera, Culicinae). Memorias do Instituto Oswaldo Cruz. 98, 387-390 (2003).
  5. Campos, J., Andrade, C. F., Recco-Pimentel, S. M. Malpighian tubule polytene chromosomes of Culex quinquefasciatus (Diptera, Culicinae). Memorias do Instituto Oswaldo Cruz. 98, 383-386 (2003).
  6. McAbee, R. D., Christiansen, J. A., Cornel, A. J. A detailed larval salivary gland polytene chromosome photomap for Culex quinquefasciatus (Diptera: Culicidae) from Johannesburg, South Africa. J. Med. Entomol. 44, 229-237 (2007).
  7. Nene, V., et al. Genome sequence of Aedes aegypti, a major arbovirus vector. Science. 316, 1718-1723 (2007).
  8. Arensburger, P., et al. Sequencing of Culex quinquefasciatus establishes a platform for mosquito comparative genomics. Science. 330, 86-88 (2010).
  9. Sharakhova, M. V., et al. Imaginal discs--a new source of chromosomes for genome mapping of the yellow fever mosquito Aedes aegypti. PLoS neglected tropical diseases. 5, e1335 (2011).
  10. Brown, S. E., et al. Toward a physical map of Aedes aegypti. Insect Mol. Biol. 4, 161-167 (1995).
  11. Steiniger, G. E., Mukherjee, A. B. Insect chromosome banding: technique for G- and Q-banding pattern in the mosquito Aedes albopictus. Can. J. Genet. Cytol. 17, 241-244 (1975).
  12. Garimberti, E., Tosi, S. Fluorescence in situ hybridization (FISH). Bridger, J. M., Volpi, E. V. Springer Science and Business Media. (2010).
  13. Methods in Anopheles Research [Internet]. The Malaria Research and Reference Reagent Resource Center. Atlanta, GA. Available from: http://www.mr4.org/Portals/3/Pdfs/ProtocolBook/MethodsAnophelesResearchV4c.pdf (2007).
  14. Scott, J. A., Brogdon, W. G., Collins, F. H. Identification of single specimens of the Anopheles gambiae complex by the polymerase chain reaction. The American journal of tropical medicine and hygiene. 49, 520-529 (1993).
  15. Trifonov, V. A., Vorobyeva, N. N., Rens, W. Fluorescence in situ hybridization (FISH). Leiehr, T. Spriger-Verlag. (2009).
  16. Collins, F. H., et al. A ribosomal RNA gene probe differentiates member species of the Anopheles gambiae complex. The American journal of tropical medicine and hygiene. 37, 37-41 (1987).
  17. Kumar, A., Rai, K. S. Chromosomal localization and copy number of 18S+28S ribosomal RNA genes in evolutionary diverse mosquitoes (Diptera, Culicidae). Hereditas. 113, 277-289 (1990).
  18. Brown, S. E., Knudson, D. L. FISH landmarks for Aedes aegypti chromosomes. Insect Mol. Biol. 6, 197-202 (1997).
  19. Brown, S. E., Severson, D. W., Smith, L. A., Knudson, D. L. Integration of the Aedes aegypti mosquito genetic linkage and physical maps. Genetics. 157, 1299-1305 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics