Fluorescent

Immunology and Infection
 

Summary

Blandt de tre myg slægter, nemlig

Cite this Article

Copy Citation | Download Citations

Timoshevskiy, V. A., Sharma, A., Sharakhov, I. V., Sharakhova, M. V. Fluorescent in situ Hybridization on Mitotic Chromosomes of Mosquitoes. J. Vis. Exp. (67), e4215, doi:10.3791/4215 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Fluorescerende in situ-hybridisering (FISH) er en teknik, som rutinemæssigt anvendes af mange laboratorier for at bestemme den kromosomale placering af DNA-og RNA-prober. En vigtig anvendelse af denne metode er udviklingen af ​​høj kvalitet fysiske kort anvendelige til forbedring af genomet komponenter til forskellige organismer. Den naturlige båndmønster af polytene og mitotisk kromosomer giver vejledning i præcis bestilling og orientering af de genomiske supercontigs. Blandt de tre myg slægter, nemlig Anopheles, Aedes og Culex, en veletableret kromosom-kortlægning teknik er blevet udviklet udelukkende til Anopheles, hvis medlemmer har læsbare polytene kromosomer 1. Som et resultat af genomkortlægning indsats, 88% af An. gambiae genom er blevet placeret til præcise kromosom positionerne 2,3. To andre slægter myg, Aedes og Culex, er dårligt polytenized kromosomer bom følge af betydelig overrepræsentation af transposerbare elementer i deres genomer 4, 5, 6. Kun 31 og 9% af de genomiske supercontings er blevet tildelt uden orden eller orientering til kromosomer af Ae. aegypti 7 og Cx. quinquefasciatus 8, hhv. Mitotisk kromosom forberedelse til disse to arter er tidligere blevet begrænset til hjernen ganglier og cellelinjer. Imidlertid kromosom slides fremstillet fra hjernen ganglier myg indeholder sædvanligvis et lavt antal metafase pladerne 9. Ligeledes, selv om en FISH-teknikken er blevet udviklet til mitotiske kromosomer fra en cellelinje af Ae. aegypti 10 akkumuleringen af multiple kromosomale omlejringer i cellelinie kromosomer 11 gør dem ubrugelige til genom kortlægning. Her beskriver vi en enkel, robust teknik til opnåelse af høj kvalitet mitotiske Kromosompraeparering fra imaginal discs (ID'er) af 4. stadiums larver, som cet anvendes til alle tre slægter af myg. En standard FISH protokol 12 er optimeret til anvendelse af BAC-kloner af genomisk DNA som en probe på mitotiske kromosomer af Ae. aegypti og Cx. quinquefasciatus, og til anvendelse af en intergenisk afstandsstykke (IGS) region af ribosomalt DNA (rDNA) som en probe på An. gambiae kromosomer. Ud over den fysiske kortlægning, kan den udviklede teknik anvendes på befolkningsgrupper cytogenetik og kromosom taksonomi / systematik af myg og andre insekter grupper.

Protocol

1. Kromosom Forberedelse

Myggelarver blev opdrættet ved hjælp af en standardprotokol beskrevet i Methods i Anopheles Research findes på hjemmesiden for Malaria Research og Reference Reagent Resource Center (MR4) 13. Temperaturerne af mosquito opdræt blev modificeret til at give det højeste antal kromosomer i imaginal diske og laveste dødelighed af larverne. Etaperne i myggelarver udvikling blev fastsat ud fra størrelsen af deres hoved kapsler 13.

  1. Hatch myg æg ved 28 ° C, og efter 2-3 dage, overdragelse 2 nd eller 3 rd stadiums larver til 16 ° C i Ae. aegypti og Cx. quinquefasciatus og til 22 ° C i An. gambiae.
  2. Place 4 th stadiums larver på is i flere minutter for immobilisering.
  3. Overfør larve til et dias med en dråbe kold hypotonisk opløsning (0,5%, sådium citrat eller 0,075 M kaliumchlorid), og placer den under stereomikroskop.
  4. Vælg larve med ovale id'er (figur 1B) til yderligere dissektion.
  5. Halshugge larve, og skære neglebånd fra den ventrale side af larvernes thorax hjælp dissekere saks (figur 2A). Gør ekstra nedskæring i andet eller tredje abdominal segment at dissekere tarmen fra larve. Retningerne af snittene er vist med pile.
  6. Åbn neglebånd, og fjern tarmen og fedt kroppen fra larve. Fjern hypotonisk opløsning fra objektglasset ved hjælp af filtrerpapir, og der tilsættes en frisk dråbe hypotonisk opløsning direkte til ID'er (figur 2B). Holde larve i hypotonisk opløsning i 10 minutter ved stuetemperatur.
  7. Fjern hypotonisk opløsning ved anvendelse af filtrerpapir, og anvende Carnoy opløsning (ethanol / eddikesyre i forholdet 3:1). Efter tilsætning fikseringsopløsning, IDS straks blive hvid og bliver let synlige under mikroskop (figur 2C
  8. Brug dissekere nåle, fjerne ID'er fra larve (Figur 2D), og overføre dem til et fald på 50% propionsyre. Fjerne alle andre væv, såsom tarmen og fedt organ, fra slæden. Dæk id'er med et unsiliconized 22x22 dækglas, og holde i 10 minutter ved stuetemperatur.
  9. Dæk slide med filtrerpapir og squash vævet ved at trykke på viskelæder på en blyant på kanten af ​​dækglasset.
  10. Kort analysere kvaliteten af objektglas ved hjælp af fasekontrast-mikroskop ved 100x eller 200x forstørrelse (fig. 3). Præparater med> 50 kromosom spreads kan betragtes som egnet til FISH.
  11. Dyp og holde objektglasset i flydende nitrogen, indtil den stopper bobler. Fjern dækglas fra objektglasset med et barberblad, og overfører slæden straks til en beholder med 70% ethanol afkølet ved -20 ° C. Opbevares ved 4 ° C i mindst 1 time for den bedste dehydratisering resultat (hvis det er nødvendigt, kan objektglas opbevares ved thans skridt fra adskillige minutter til adskillige dage).
  12. Dehydratisere objektglassene i en serie af ethanol (70%, 80%, 100%) ved 4 ° C i 5 minutter hver, og lufttørre ved stuetemperatur.
  13. Opbevares tørre objektglas ved -20 ° C før anvendelse dem til FISH.

2. Udvinding af repetitive DNA Brøker

Udførelse FISK af BAC klon DNA-probe på kromosomer fra Ae. aegypti og Cx. quinquefasciatus kræver anvendelse af umærkede repetitive DNA-fraktioner for at blokere uspecifik hybridisering af DNA repeats på kromosomer. The reassociation af enkeltstrenget DNA fragmenteret i stykker af flere hundrede bp følger efter en C 0 t kurve, hvor C 0 er den oprindelige koncentration af enkeltstrenget DNA og t er reannealing tid. DNA-fraktioner med C0t værdier lig med 10 -4 -10 -1 eller 10 ° -10 2 betragtes som meget og moderat repetitive hhv.

  1. Uddrag 400-500 ug af det genomiske DNA fra hele den voksne myg hjælp af Qiagen Blood and Cell Culture Maxikit, og forberede 100-1.000 ng / pl DNA-opløsning i 1,2 x SSC.
  2. Denaturerer DNA ved at anbringe en sikker-låserøret med genomisk DNA i en varmeblok forvarmet til 120 ° C i 2 min. Høj temperatur bidrager til at ligge DNA i 200-500 bp fragmenter.
  3. Afhængigt af DNA-koncentration, DNA reassociere ved at placere røret ved 60 ° C i 15-150 minutter til opnåelse C 0 t DNA-fraktioner på op til C 0 t3 (tabel 1).
  4. Glasset anbringes med DNA på is i 2 minutter.
  5. Overføre DNA til 42 ° C, tilsættes forvarmet 10x S1-nuklease-puffer og S1-nuclease til en slutkoncentration på 100 U per 1 mg DNA, og inkuberes i 1 time.
  6. Bundfaldet DNA ved tilsætning af 0,1 volumen af ​​3 M natriumacetat og 1 volumen isopropanol ved stuetemperatur.
  7. Der centrifugeres ved 14.000 rpm i 20 min ved 4 ° C.
  8. Vask DNA med 70% ethanol og centrifugeres igen ved 14.000 opm i 10 minutterved 4 ° C.
  9. Lufttørre og opløses DNA-pelleten i TE-buffer.
  10. Måling af DNA-koncentrationen, og visualisere ved gelelektroforese. Normalt er den endelige mængde af repetitive DNA-fraktioner udgør 35-50% af den oprindelige DNA-mængde.

3. DNA Probe Labeling

To forskellige protokoller blev anvendt til mærkning BAC-klon-DNA-probe og IGS rDNA probe.

3,1 BAC klon mærkning ved hjælp af nick-translation

  1. Uddrag BAC klon DNA fra BAC-biblioteket ved hjælp af Qiagen Large Construct Kit.
  2. Forbered reaktionsblandingen til nick-translation mærkning på is med slutvolumen på 50 pi: 1 ug isoleret BAC-klon-DNA, 0,05 mM af hver af umærket dATP, dCTP og dGTP og 0,015 mM dTTP, 1 ml af Cy3-dUTP (eller en anden fluorochrom) 0,05 mg / ml BSA, 5 ul 10 x nick-translation buffer, 20 U DNA-polymerase I, og 0,0012 U af DNase.
  3. Inkuber ved 15 ° C i 20,5 timer.
  4. Stop reaktionen ved tilsætning af 1 ml af 0,5 M EDTA.
  5. Opbevar sonde ved -20 ° C i et mørkt sted.

3,2 IGS rDNA mærkning under anvendelse af PCR

  1. Udarbejde reaktionsblandingen på is med slutvolumen på 50 pi: 200 ng af genomisk DNA, 0,05 mM af hver af umærket dATP, dCTP og dGTP, 0,015 mM dTTP, 1 ml af Cy3-dUTP (eller et andet fluorchrom) 5 ul af 10 x PCR-puffer, 50 pmol fremad, FN (GTGTGCCCCTTCCTCGATGT) og omvendt, GA (CTGGTTTGGTCGGCACGTTT) primere til IGS amplifikation, og 10 U Taq DNA-polymerase 14.
  2. Udføre PCR-reaktion under anvendelse af standard PCR-parametre for IGS amplifikation: 95 ° C / 5 min x 1 cycle; (95 ° C / 30 sec, 50 ° C / 30 sec, 72 ° C / 30 sec) x 30 cykler, 72 ° C / 5 min x 1 cyklus, og 4 ° C hold 14.
  3. Opbevar sonde ved -20 ° C i et mørkt sted.

4. Fluorescerende in situ-hybridisering

og Cx. quinquefasciatus og det andet for at bruge IGS rDNA på mitotiske kromosomer An. gambiae. Hvis du bruger BAC klon DNA-sonder, trin skip RNase behandling 4,3, 4,4, og samtidig slide / sonde denatureringstrin 4,19. Hvis du bruger IGS rDNA sonde, forberede hybridiseringsblanding uden C 0 t DNA fraktioner, og springe separat slide / sonde denaturering trin 4,10, 4,11, 4,16 og 4,17.

  1. Inkuber objektglassene i 2 x SSC i 30 minutter ved 37 ° C.
  2. Dehydrer dias i serie på 70%, 80% og 100% ethanol i 5 minutter hver ved stuetemperatur, og lufttørre. Hvis du udfører FISH med BAC klon DNA, gå direkte til trin 4,5.
  3. Inkuber kromosom præparat i 0,1 mg / ml RNase opløsningen under parafilm i 30 minutter ved 37 ° C.
  4. Vaskes to gange i 2x SSC i 5 minutter hver ved 37 ° C.
  5. Put dias ina krukke med 0,01% pepsin og 0,037% HCI-opløsning, og der inkuberes i 5 minutter ved 37 ° C.
  6. Vask objektglassene i 1 x PBS i 5 minutter ved stuetemperatur.
  7. Fix kromosom præparat i en krukke med 1% formalin i 1 x PBS fremstillet ud fra 10% neutral-pufret formalin i 10 minutter ved stuetemperatur.
  8. Vask objektglassene i 1 x PBS i 5 minutter ved stuetemperatur.
  9. Dehydrer dias i serie på 70%, 80% og 100% ethanol i 5 minutter hver ved stuetemperatur, og lufttørre præparater ved 37 ° C. Hvis du udfører FISH med IGS, gå direkte til trin 4,12
  10. Denaturere glider i en krukke med forvarmet 70% formamid i 2 minutter ved 72 ° C.
  11. Dehydratisere objektglassene i serie af kold (-20 ° C) 70%, 80% og 100% ethanol i 5 minutter hver, og lufttørre ved 37 ° C.
  12. Forbered hybridiseringsblanding:. 5 ul af mærket probe-DNA fra trin 3, 10 ul C 0 t DNA fra trin 2 med slutkoncentration på 0,5 ng / pl, og 5 pi af 1 pg / pl sonikeret laksesperm-DNA for fisk med IGS rDNA, forberedehybridiseringsblanding uden C 0 t DNA-fraktioner.
  13. Bundfaldet DNA ved tilsætning af 0,1 volumen af ​​3 M natriumacetat og 2 volumener ethanol. Opbevar ved -20 ° C i 1-3 timer.
  14. Centrifuge ved 14.000 rpm ved 4 ° C i 20 minutter, fjernes ethanolen og lufttørres pelleten ved stuetemperatur.
  15. Grundigt pellet opløses i 10 gl hybridiseringspuffer:. 50% formamid, 20% dextransulfat, 2x SSC Hvis du udfører FISH med IGS, gå direkte til trin 4,18
  16. Denaturerer hybridiseringsblanding i 7 min ved 97 ° C, og straks anbragt på is i 1 min.
  17. Prehybridize blandingen ved 37 ° C i 30 minutter for at forhindre uspecifik hybridisering af repetitive DNA på kromosomer.
  18. Placer 10 ul af hybridiseringsblandingen på diaset, og dæk med et 22x22 dækglas. Forebyg bobledannelse - luftbobler skal fjernes med let tryk på dækglasset Hvis du udfører FISH med BAC klon DNA, gå direkte til trin 4,20 <./ Em>
  19. Denaturere proben og kromosom-DNA samtidigt under anvendelse af en varmeblok ved 75 ° C i 5 minutter.
  20. Lim dækglas omkring omkredsen ved hjælp af gummi cement.
  21. Udføre hybridisering natten over i et fugtigt kammer ved 37 ° C.
  22. Fjern gummi cement og dækglas fra diaset.
  23. Vask objektglasset 2 min i forvarmet Opløsning 1 (0,4 x SSC, 0,3% Nonidet-P40) ved 73 ° C.
  24. Skylning af objektglas i opløsning 2 (2x SSC, 0,1% Nonidet-P40) i 5 minutter ved stuetemperatur.
  25. Kontrastfarve objektglas med 0,001 mM YOYO-1 i 1 x PBS i 10 minutter i fugtigt kammer ved stuetemperatur.
  26. Monteres i en lille mængde Forlæng Gold antiblegemiddel reagens med en dækstrimmel.
  27. Analysere præparater under et fluorescensmikroskop under anvendelse af passende filtersæt ved 1000 x forstørrelse (figur 4).

5. Repræsentative resultater

Insekt id'er er placeret i hvert segment af larve. Afhængigt af positionen, they omdanne til forskellige væv i den voksne stadium af insektet. De ID'er, som anvendes til kromosom forberedelse i denne protokol, udvikle sig til benene på den voksne etape af myg. Disse ID'er er placeret på den ventrale side af larvernes thorax og er klart synlige gennem kutikula under mikroskopet (figur 1). På et tidligt 4. stadium larvestadiet, har id'er en rund form (figur 1A). De største antal mitose, er ~ 175 i ét id 9, akkumuleret på et senere "ovale" fase (figur 1B), der må betragtes som den optimale scene for præparatet. På dette tidspunkt, opdeler mellemliggende ID i to: en forvandles til et ben og en anden forvandler sig til en vinge. Vi foretrækker at bruge de store ben ID'er på "ovale" scenen for kromosom præparatet. Figur 1C repræsenterer ID'er på den seneste fase af 4 th instar larve udvikling. På dette trin afId'er allerede udviklet sig til ben og vinger, og indeholder en signifikant mængde af differentierede væv og et lavt antal mitose. Denne fase af ID udvikling bør undgås for kromosom præparatet. Vi anbefaler også opdræt myggelarver ved lave temperaturer:. 16 ° C for Aedes og Culex og 22 ° C for Anopheles Dette bidrager til at øge mængden af mitosen i ID'er 9.

Figur 2 illustrerer ID dissektion fra brystkassen på 4 th instar larve. Fordi neglebånd af en levende insekt er svært at dissekere, anbefaler vi at bruge dissekere saks i stedet for nåle der almindeligvis anvendes til larve forberedelse. Det mest afgørende procedure for opnåelse af høj kvalitet kromosom forberedelse er den hypotonisk opløsning behandling. For de bedste resultater skal du fjerne vi tarmen og fedt kroppen fra larve thorax før denne behandling. Hævelse af ID-celler i løbet af denne procedure er med til at sprede kromosoms på et dias (figur 3A). En passende kvalitet for den hypotoniske opløsning behandlingen kan let genkendes af den runde form af celler i de præparater (fig. 3A, B). Celler med en oval form indikere utilstrækkelig hypotonisk opløsning behandlingen (figur 3C). For at blive udvalgt til FISH, bør kromosom forberedelse indeholde mindst 50 af høj kvalitet kromosom spreads. Normalt ~ 90% af objektglassene fremstillet under anvendelse af denne protokol er tilstrækkelig kvalitet for FISH 9.

Vi præsenterer to lidt forskellige fisk protokoller: en avanceret protokol for fisk ved hjælp af genomisk BAC klon DNA-probe på mitotiske kromosomer af Aedes og Culex og en simpel FISH protokol for IGS rDNA sonde på mitotiske kromosomer Anopheles. Genomerne fra Aedes og Culex er højrepetitivt grund af overrepræsentation af transposerbare elementer 7,8. Således udfører FISH, som utilizes genomisk BAC-klon-DNA som en probe, kræver tilsætning af umærkede repetitive DNA-fraktioner til sonden for at blokere uspecifik hybridisering af DNA repeats til kromosomer. Til udvinding af de repetitive DNA-fraktionerne, er genomisk DNA denatureres ved 120 ° C i 2 min. Kogende DNA ved en høj temperatur også bidrager til opnåelse af DNA i fragmenter på 200-500 bp. DNA får lov at reassociere efter denne behandling. De stærkt repetitive DNA-fragmenter tendens til at finde deres kammerat for reassociation hurtigere end DNA med unikke sekvenser gør. Som følge heraf følger reassociation af DNA'et a C 0 x t kurve, hvor C 0 er den oprindelige koncentration af enkeltstrenget DNA, og t er reannealing tid. DNA-fraktioner med C 0 t-værdier lig med 10-4 - 10-1 eller 100-102, betragtes som meget og moderat repetitive hhv. Tidspunktet for reassociation for forskellige C 0 t DNA-fraktioner kan beregnes ved hjælp the formlen t = C 0 t X x 4,98 / C 0, hvor t - inkubationstid, C 0 t X - C 0 t fraktion (C0t 1 = 1, C 0 t 2 = 2, etc.) og C 0 - initiale DNA-koncentration i pg / pl 15 (tabel 1). Efter reassociation er den enkeltstrengede DNA spaltet med S1 nuclease. Vi foretrækker at bruge alle C 0 T-DNA-fraktioner op til C 0 t 3 sammen i stedet for den almindeligt anvendte C 0 t 1 DNA-fraktion. Disse C 0 t fraktioner omfatter nogle af de moderat repetitive DNA-sekvenser og sammen normalt repræsenterer 35-50% af den oprindelige mængde af det genomiske DNA i Ae. aegypti. Den korrekte forhold mellem mærket DNA-probe og umærket C 0 t DNA fraktion afhænger af den repetitive DNA-komponent i hvert enkelt BAC-klon. I gennemsnit bruger vi 1:20 sonde til C 0 tDNA fraktion andelen for at opnå en acceptabel signaler / baggrund forholdet af FISH resultatet. Præhybridisering af DNA-proben med C 0 t DNA-fraktioner i et rør i 30 minutter, inden den egentlige hybridisering på objektglasset hjælper også til at reducere baggrunden. Mærkning, hybridisering selv, og vask i denne protokol udføres under anvendelse af standardbetingelser 12.

The Fish Resultaterne af to forskelligt mærkede BAC-klon DNA-prober på mitotiske kromosomer af Ae. aegypti og Cx. quinquefasciatus er vist i figur 4A og B, hhv. BAC klon DNA-sonder producere stærke signaler i en enkelt position på kromosomerne. Kromosomer vist i figur 1 er modfarvet med YOYO-1-iodid. Dette farvestof giver de bedste båndmønstre på Ae. aegypti kromosomer 9. Alternativt kan andre fluorescerende farvestoffer, såsom DAPI eller propidiumiodid, anvendes til the kromosom kontrastfarvning. For at undertrykke fotoblegning af dias, bruger vi Forlæng Guld antiblegemiddel montage medium. Dette reagens har gode signal bevarelse evner og også let kan fjernes fra slæden ved skylning i 1 x PBS, hvis det er nødvendigt at anvende den samme slide flere hybridiseringer.

En enkel udgave af FISH protokollen er beregnet til hybridisering af IGS rDNA probe på mitotiske kromosomer Anopheles. Ribosomale gener i Anopheles er repræsenteret som en polymorf klynge af gener placeret på kønskromosomer 16. En DNA-probe i denne protokol er mærket ved anvendelse af standard PCR-reaktion ved tilsætning af fluorescensmærkede Cy3 eller Cy5 dNTP'er. Fordi blokere uspecifik hybridisering af repetitive DNA i euchromatin ikke er nødvendig, er alle trin i forbindelse med brug C 0 t DNA fraktioner udeladt. I stedet er Kromosompraeparering forbehandlet med RNase for at forhindre hybridisering af IGS rDNA proben tilde nucleolus. Kromosomer og DNA-proben denatureres samtidigt ved opvarmning af objektglasset med en probe i et hybridiserings-system ved 75 ° C i 5 minutter. Hybridisering og vask i denne protokol er også udført under anvendelse af standardbetingelser for FISH 12. Resultatet af fisk er vist i figur 4C: polymorfien af ​​IGS rDNA hybridisering mellem to X-kromosomer er klart synlig.

0 t 3
DNA-koncentration pg / pl Reannealing tid, min
C 0 t 2 0,1 100
0,3 33
0,5 20
0,7 14
0,9 11
1 10
0,1 150
0,3 50
0,5 30
0,7 21
0,9 17
1 15

Tabel 1. DNA-koncentration og reannealing gange for fremstilling af C 0 T2 og C 0 t3 fraktioner.

Figur 1
Figur 1 Faser i ID udvikling i 4 th instar larve: A) en tidlig "runde form" fase, B) et mellemliggende "oval form" stage - optimal for kromosomet forberedelse; C) et sent tidspunkt - uegnede til kromosom præparater. . Positionerne af ID'er er angivet med pile på den ventrale side af larver thorax.

Figur 2
Figur 2 trin i ID dissektion: A) afhuggede larve (retningen af nedskæringer er angivet med pile), B) larver med dissekeret gut under hypotonisk opløsning behandling (ID'er svulme op og blive næsten usynlig), C) larve efter Carnoy løsning ansøgning (. ID'er bliver hvide og tydeligt synlige), D) dissekeret id'er i Carnoy løsning. Placering af id'er i larve er angivet med *.

Figur 3
Figur 3 forskellige kvaliteter af kromosomet spreads: A) en perfekt kromosom spread - runde form af cellerne demonstrerer tilstrækkelig behandling af id'er i hypotonisk opløsning b) en perfekt hypotonisk behandling - kromosomer er lidt undersquashed c) en dårlig kromosom spredning. - resultatet afutilstrækkelig hypotonisk behandling er angivet med oval form af cellerne.

Figur 4
Figur 4. Eksempler på fisk med BAC-kloner (A, B) og IGS rDNA (C) i kromosomerne i Ae. aegypti (A), Cx. quinquefasciatus (B), og An. gambiae (C). 1, 2 og 3 - er antallet af kromosomer, X - kvindelig sex kromosom i An. gambiae.

Discussion

Ikke-fluorescerende in situ hybridisering mitotiske kromosomer af myg blev udført for første gang i 1990 af A. Kumar og K. Rai 17. I denne undersøgelse klonede 18S og 28S ribosomale DNA-gener, sammen i et plasmid, blev anbragt på kromosomer af 20 arter af myg. DNA-proben blev radioaktivt mærket og hybridiseret til kromosomer fra hjernen ganglier. Mellem tre myg slægter, har en FISH teknik blevet udviklet kun til mitotiske kromosomer fra cellelinie Ae. aegypti 10,18,19 og er aldrig blevet udført på mitotiske kromosomer fra levende myg. For nylig har vi udviklet en enkel, robust teknik for at opnå høj kvalitet kromosom præparater fra ID'er på 4 th stadiums larver 9. Denne metode giver et stort antal kromosomer, der skal opnås i et dias og kan bruges alment til alle arter af myg. Nødvendigheden af ​​at anvende kun larver, ikke pupal eller voksen staGES af myg, for præparatglaspræpareringsprotokol er sandsynligvis den eneste begrænsning af fremgangsmåden. Standard FISH fremgangsmåde 12 blev optimeret til anvendelse af genomisk BAC-klon og IGS rDNA som prober for de mitotiske kromosomer af Aedes, Culex, og Anopheles.

Ud over disse specifikke anvendelser, kan fisken protokollerne der er beskrevet her, også kan anvendes til andre formål. Den avancerede FISH protokol, som anvender C 0 t DNA fraktioner for at blokere uspecifik hybridisering, kan også anvendes til hybridiseringen af BAC-kloner eller andre store DNA-fragmenter i heterochromatic regioner Anopheles. Heterochromatic regioner er beriget med transposerbare elementer og andre gentagelser, og prober fra disse regioner normalt producerer stærk baggrund på kromosom 3. Anvendelse af umærkede C 0 t DNA fraktioner vil bidrage til at reducere uspecifik hybridisering af proben på kromosomer. Den enkle version af FISH protocol kan anvendes til enhver rDNA eller repetitive DNA-prober på mitotiske kromosomer af myg og andre insekter. Derudover det kan anvendes til hybridiseringen af BAC-klon-DNA i arter med lav repetitive DNA-indhold i euchromatic regioner, såsom Anopheles eller Drosophila. Protokollen her foreslåede vil bidrage til opnåelse af højt færdige kromosom-baserede genom enheder til myg og kan bredt anvendes til forskellige cytogenetiske anvendelser i andre grupper af insekter.

Disclosures

Ingen interessekonflikter erklæret.

Acknowledgments

Vi takker Sergei Demin og Tatyana Karamysheva for deres hjælp med kromosom forberedelse og FISH på Anopheles. Vi takker også David Severson for at give os Aedes og Culex genomisk DNA BAC kloner og Melissa Wade til redigering af teksten. Dette arbejde blev støttet af to tilskud fra National Institutes of Health: 1R21 AI88035-01 til Maria V. Sharakhova og 1R21 AI094289-01 til Igor V. Sharakhov.

Materials

Name Company Catalog Number Comments
MZ6 Leica stereomicroscope Leica VA-OM-E194-354 A different stereomicroscope can be used
Olympus CX41 phase microscope Olympus CX41 A different phase microscope can be used
Olympus BX61 fluorescent microscope Olympus BX61 A different fluorescent microscope can be used
ThermoBrite Slide Denaturation/Hybridization System Abbott Molecular 30-144110 Serves as a heating block and a humid chamber
Dissecting needles Fine ScienceTools 10130-10
Needle holders Fine Science Tools 26018-17
Dissecting scissors Fine Science Tools 15000-03
75x25 double frosted micro slides Corning 2949-75x25
22x22 mm microscope coverslips Fisher Scientific 12-544-10
Parafilm Fisher Scientific 13-374-10
Rubber Cement Fisher Scientific 50-949-105
Acetic acid Fisher Scientific A491-212
Alcohol 200 Proof Decon Laboratories 2701
Propionic acid Sigma-Aldrich 402907
Hydrochloric acid Fisher Scientific A144-500
Sodium citrate dihydrate Fisher Scientific S279-500
Sodium acetate trihydrate Fisher Scientific BP334-500
Potassium chloride Fisher Scientific BP366-500
EDTA Fisher Scientific S311-500
Tris base Fisher Scientific BP152-1
10x PBS Invitrogen P5493
10% NBF (neutral buffered formalin) Sigma-Aldrich HT501128
99% formamide Fisher Scientific BP227500
Dextran sulfate sodium salt Sigma-Aldrich D8906
20x SSC buffer Invitrogen AM9765
1 mM YOYO-1 iodide (491/509) solution Invitrogen Y3601
Antifade Prolong Gold reagent Invitrogen P36930
dATP, dCTP, dGTP, dTTP Fermentas R0141, R0151, R0161, R0171
Cy3-dUTP, Cy5-dUTP GE Healthcare PA53022, PA55022
BSA Sigma-Aldrich A3294
DNA Polymerase I Fermentas EP0041
DNase I Fermentas EN0521
S1 Nuclease Fermentas EN0321
Taq DNA Polymerase Invitrogen 18038-042
RNase Sigma-Aldrich 9001-99-4
Pepsin USB 9001-75-6
Salmon sperm DNA Sigma-Aldrich D7656
Nonidet-P40 (NP40) US Biological NC9375914
Qiagen Blood and Cell Culture Maxikit Qiagen 13362
Qiagen Large Construct Kit Qiagen 12462

DOWNLOAD MATERIALS LIST

References

  1. Sharakhov, I. V., Sharakhova, M. V. Chromosome Mapping Research Developments. Verrity, J. F., Abbington, L. E. Nova Science Publishers, Inc. (2008).
  2. Holt, R. A., et al. The genome sequence of the malaria mosquito Anopheles gambiae. Science. 298, 129-149 (2002).
  3. Sharakhova, M. V., et al. Update of the Anopheles gambiae PEST genome assembly. Genome biology. 8, R5 (2007).
  4. Campos, J., Andrade, C. F., Recco-Pimentel, S. M. A technique for preparing polytene chromosomes from Aedes aegypti (Diptera, Culicinae). Memorias do Instituto Oswaldo Cruz. 98, 387-390 (2003).
  5. Campos, J., Andrade, C. F., Recco-Pimentel, S. M. Malpighian tubule polytene chromosomes of Culex quinquefasciatus (Diptera, Culicinae). Memorias do Instituto Oswaldo Cruz. 98, 383-386 (2003).
  6. McAbee, R. D., Christiansen, J. A., Cornel, A. J. A detailed larval salivary gland polytene chromosome photomap for Culex quinquefasciatus (Diptera: Culicidae) from Johannesburg, South Africa. J. Med. Entomol. 44, 229-237 (2007).
  7. Nene, V., et al. Genome sequence of Aedes aegypti, a major arbovirus vector. Science. 316, 1718-1723 (2007).
  8. Arensburger, P., et al. Sequencing of Culex quinquefasciatus establishes a platform for mosquito comparative genomics. Science. 330, 86-88 (2010).
  9. Sharakhova, M. V., et al. Imaginal discs--a new source of chromosomes for genome mapping of the yellow fever mosquito Aedes aegypti. PLoS neglected tropical diseases. 5, e1335 (2011).
  10. Brown, S. E., et al. Toward a physical map of Aedes aegypti. Insect Mol. Biol. 4, 161-167 (1995).
  11. Steiniger, G. E., Mukherjee, A. B. Insect chromosome banding: technique for G- and Q-banding pattern in the mosquito Aedes albopictus. Can. J. Genet. Cytol. 17, 241-244 (1975).
  12. Garimberti, E., Tosi, S. Fluorescence in situ hybridization (FISH). Bridger, J. M., Volpi, E. V. Springer Science and Business Media. (2010).
  13. Methods in Anopheles Research [Internet]. The Malaria Research and Reference Reagent Resource Center. Atlanta, GA. Available from: http://www.mr4.org/Portals/3/Pdfs/ProtocolBook/MethodsAnophelesResearchV4c.pdf (2007).
  14. Scott, J. A., Brogdon, W. G., Collins, F. H. Identification of single specimens of the Anopheles gambiae complex by the polymerase chain reaction. The American journal of tropical medicine and hygiene. 49, 520-529 (1993).
  15. Trifonov, V. A., Vorobyeva, N. N., Rens, W. Fluorescence in situ hybridization (FISH). Leiehr, T. Spriger-Verlag. (2009).
  16. Collins, F. H., et al. A ribosomal RNA gene probe differentiates member species of the Anopheles gambiae complex. The American journal of tropical medicine and hygiene. 37, 37-41 (1987).
  17. Kumar, A., Rai, K. S. Chromosomal localization and copy number of 18S+28S ribosomal RNA genes in evolutionary diverse mosquitoes (Diptera, Culicidae). Hereditas. 113, 277-289 (1990).
  18. Brown, S. E., Knudson, D. L. FISH landmarks for Aedes aegypti chromosomes. Insect Mol. Biol. 6, 197-202 (1997).
  19. Brown, S. E., Severson, D. W., Smith, L. A., Knudson, D. L. Integration of the Aedes aegypti mosquito genetic linkage and physical maps. Genetics. 157, 1299-1305 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics