Fluorescente

Immunology and Infection
 

Summary

Dentre os três gêneros de mosquito, ou seja,

Cite this Article

Copy Citation | Download Citations

Timoshevskiy, V. A., Sharma, A., Sharakhov, I. V., Sharakhova, M. V. Fluorescent in situ Hybridization on Mitotic Chromosomes of Mosquitoes. J. Vis. Exp. (67), e4215, doi:10.3791/4215 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Hibridação fluorescente in situ (FISH) é uma técnica habitualmente usada por muitos laboratórios para determinar a posição cromossómica de sondas de DNA e RNA. Uma importante aplicação do presente método é o desenvolvimento de mapas de alta qualidade físicas úteis para melhorar os conjuntos do genoma de vários organismos. O padrão natural de bandas dos cromossomos politênicos e mitóticos fornece orientação para o ordenamento preciso e orientação dos supercontigs genômicos. Dentre os três gêneros de mosquitos Anopheles, ou seja, Aedes, Culex e, uma bem estabelecida técnica de mapeamento baseado cromossomo foi desenvolvido apenas para Anopheles, cujos membros possuem cromossomos politênicos legíveis 1. Como resultado dos esforços de mapeamento do genoma, 88% da Uma. gambiae genoma foi colocado para posições precisas cromossoma 2,3. Dois gêneros de mosquitos Aedes outros, e Culex, que mal polytenized b cromossomosomo de super-representação significativa de elementos transponíveis em seus genomas 4, 5, 6. Apenas 31 e 9% dos supercontings genômicas foram atribuídos sem ordem ou orientação de cromossomos de Ae. aegypti 7 e CX. quinquefasciatus 8, respectivamente. Preparação mitótico cromossoma para estas duas espécies tinham sido previamente limitado aos gânglios cerebral e linhas celulares. No entanto, as lâminas cromossoma preparadas a partir de gânglios cérebro de mosquitos geralmente contêm baixos números de placas de metafase 9. Além disso, embora a técnica FISH foi desenvolvido para cromossomas mitóticos a partir de uma linha de células de Ae. aegypti 10, a acumulação de múltiplos rearranjos cromossômicos em cromossomos das células da linha 11 torna inútil para mapeamento do genoma. Aqui descrevemos uma técnica simples e robusta para a obtenção de alta qualidade de preparações cromossômicas mitóticas de discos imaginais (IDs) de 4 larvas ínstares, que cum ser utilizado para todos os três géneros de mosquitos. Um protocolo de FISH padrão de 12 é otimizado para uso de clones BAC de DNA genômico como uma sonda em cromossomos mitóticos de Ae. aegypti e Cx. quinquefasciatus., e para a utilização de um espaçador intergênica (IGS) região do DNA ribossomal (rDNA) como uma sonda em um. cromossomas gambiae. Além de mapeamento físico, a técnica desenvolvida pode ser aplicada a citogenética de populações e taxonomia cromossoma / sistemática de mosquitos e grupos de outros insectos.

Protocol

1. Preparação cromossomo

As larvas do mosquito foram criados usando um protocolo padrão descrito em Métodos de Pesquisa em Anopheles disponível no site da Pesquisa em Malária e Centro de Referência de Recursos Reagente (MR4) 13. As temperaturas de criação do mosquito foram modificados para proporcionar o maior número de cromossomos em discos imaginais e menor mortalidade das larvas. Os estágios de desenvolvimento das larvas de mosquitos foram determinados com base nos tamanhos de cápsulas de cabeça 13.

  1. Ovos de mosquito escotilha a 28 ° C, e após 2-3 dias, a transferência de 2 º ou 3 º larvas instar a 16 ° C para o Ae. aegypti e Cx.. quinquefasciatus e a 22 ° C durante uma. gambiae.
  2. 4 º lugar larvas no gelo por alguns minutos para imobilização.
  3. Transferir larva de uma lâmina com uma gota de solução hipotónica frio (0,5% de mododium citrato ou cloreto de potássio 0,075 M), e colocá-lo sob o microscópio estéreo.
  4. Seleccione larva com IDs ovais (Figura 1B), para posterior dissecação.
  5. Decapitar larva, e cortar a cutícula do lado ventral do tórax larval utilizando tesoura de dissecção (Figura 2A). Faça corte adicional no segundo ou terceiro segmento abdominal para dissecar o intestino da larva. As direcções dos cortes são mostradas por setas.
  6. Abrir a cutícula, e remover o intestino e gordura corporal da larva. Remover a solução hipotónica da lâmina utilizando papel de filtro, e adicionar uma gota fresca de solução hipotónica directamente para o ID (Figura 2B). Larva manter em solução hipotónica durante 10 min a RT.
  7. Remover solução hipotónica utilizando papel de filtro, e aplicar a solução de Carnoy (etanol / ácido acético na proporção de 3:1). Depois de adicionar a solução de fixador, IDs imediatamente virar branco e se tornar facilmente visíveis ao microscópio (Figura 2C
  8. Utilizando-se agulhas de dissecação, remover IDs da larva (Figura 2D), e transferi-los para uma queda de 50% de ácido propiónico. Remover quaisquer outros tecidos, tais como o intestino e de gordura corporal, a partir do slide. IDs cobrir com uma lamela de 22x22 unsiliconized, e manter durante 10 min à RT.
  9. Cobrir a lâmina com papel de filtro, e squash o tecido tocando a borracha de um lápis sobre o perímetro da lamínula.
  10. Breve análise da qualidade da células com um microscópio de contraste de fase de 100x ou 200x de ampliação (figura 3). Preparações com> 50 se espalha cromossomo pode ser considerado adequado para os peixes.
  11. Mergulhe e mantenha o slide em nitrogênio líquido até que ele pare borbulhante. Remova a lâmina de cobertura da lâmina utilizando uma lâmina de barbear, e transferir a lâmina imediatamente para um recipiente de etanol a 70% arrefecido a -20 ° C. Armazenar a 4 ° C durante pelo menos 1 hora para o melhor resultado de desidratação (se necessário, as lâminas podem ser armazenadas a to passo de vários minutos a vários dias).
  12. Desidratar as lâminas de uma série de etanol (70%, 80%, 100%) a 4 ° C durante 5 min cada, e seca o ar à temperatura ambiente.
  13. Armazenar as lâminas secas a -20 ° C antes de as utilizar para FISH.

2. Extracção de fracções de ADN repetitivos

Realizando FISH de a sonda de DNA nos cromossomos BAC clone de Ae. aegypti e Cx.. quinquefasciatus requer o uso de fracções de DNA repetitivo não marcados para bloquear a hibridização não específica das repetições de DNA nos cromossomas. A reassociação de DNA de cadeia única fragmentados em pedaços de várias centenas de bp segue uma curva C 0 C t, onde 0 é a concentração inicial de ADN de cadeia simples e t é o tempo de recombinação. As fracções com valores de ADN C0t iguais a 10 -4 -10 -1 ou 10 ° -10 2 são consideradas como altamente e moderadamente repetitivos, respectivamente.

  1. Extraia 400-500 ng do DNA genômico de mosquito adulto inteiro usando Qiagen Sangue e Maxikit Cultura de Células e preparar 100-1.000 ng / ul solução de DNA em 1,2 x SSC.
  2. DNA desnaturar por colocação de um tubo de bloqueio seguro com ADN genómico em um bloco de aquecimento pré-aquecida a 120 ° C durante 2 min. Temperatura elevada ajuda a variar de ADN em fragmentos de 200-500 bp.
  3. Dependendo da concentração de DNA, DNA reassociar colocando o tubo a 60 ° C durante 15-150 minutos para se obter fracções de ADN C 0 até t C 0 t3 (Tabela 1).
  4. Colocar o tubo com DNA em gelo durante 2 min.
  5. Transferir o ADN a 42 ° C, adicionar preaquecido nuclease S1 10x tampão e S1 nuclease para uma concentração final de 100 U por 1 mg de DNA e incubar durante 1 hora.
  6. DNA precipitado pela adição de 0,1 volume de acetato de sódio 3 M e 1 volume de isopropanol à temperatura ambiente.
  7. Centrifugar a 14.000 rpm durante 20 min a 4 ° C.
  8. Lavar DNA em etanol a 70%, e centrifugar novamente a 14.000 rpm durante 10 mina 4 ° C.
  9. Ar seco e dissolver pellet de ADN em tampão de TE.
  10. Medir a concentração de ADN, e visualizar por electroforese em gel. Normalmente, a quantidade final de fracções de DNA repetitivas representa 35-50% da quantidade de ADN original.

3. DNA Probe Labeling

Dois protocolos diferentes foram utilizados para a rotulagem clone BAC DNA sonda e sonda de rDNA IGS.

3,1 rotulagem clone BAC usando nick-tradução

  1. Extrair DNA BAC clone da biblioteca BAC utilizando Qiagen Kit construir grandes.
  2. Mistura de reacção para preparar nick-translation rotulagem em gelo com um volume final de 50 ul de: 1 ug de ADN do clone BAC isolados, 0,05 mM cada de unlabeled dATP, dCTP, dGTP e e 0,015 mM de dTTP, 1 ul de Cy3-dUTP (ou outra fluorocromo), 0,05 mg / ml de BSA, 5 pi de tampão de nick-translation 10x, 20 U de ADN-polimerase I, e 0,0012 U de DNase.
  3. Incubar a 15 ° C durante 20,5 hr.
  4. Pare reacção adicionando 1 ml de 0,5 M de EDTA.
  5. Loja sonda à temperatura de -20 ° C num local escuro.

3,2 IGS rDNA de marcação utilizando PCR

  1. Prepare mistura de reacção em gelo com um volume final de 50 ul: 200 ng de ADN genómico, 0,05 mM cada de unlabeled dATP, dCTP, dGTP e; 0,015 mM de dTTP, 1 ul de Cy3-dUTP (ou outro fluorocromo), 5 ul de 10x PCR-tampão; 50 pmol de frente; ONU (GTGTGCCCCTTCCTCGATGT) e reversa; GA (CTGGTTTGGTCGGCACGTTT) iniciadores para a amplificação IGS e 10 U de Taq DNA polimerase 14.
  2. Realizar PCR de reacção através de parâmetros de PCR padrão para amplificação IGS: 95 ° C / 5 min x 1 ciclo; (95 ° C / 30 segundos, 50 ° C / 30 segundos, 72 ° C / 30 segundos) x 30 ciclos de 72 ° C; / 5 min x 1 ciclo, e 4 ° C preensão 14.
  3. Loja sonda à temperatura de -20 ° C num local escuro.

4. Hibridização in situ fluorescente

e Cx.. quinquefasciatus eo segundo para uso IGS rDNA em cromossomos mitóticos de Uma. gambiae. Se estiver usando sondas de DNA BAC clone, saltar tratamento RNase passos 4.3, 4.4, e passo a desnaturação simultânea slide / sonda 4,19. Se estiver usando sonda de DNAr IGS, preparar mistura de hibridização sem C 0 frações de DNA de t, e pular slide separado / sonda etapas de desnaturação 4.10, 4.11, 4.16, e 4.17.

  1. Incubar as lâminas em 2x SSC durante 30 min a 37 ° C.
  2. Desidratar as lâminas em série de 70%, 80% e etanol a 100% durante 5 min cada, à TA, e ar seco. Se se realizarem FISH com BAC clone de ADN, seguir diretamente para a etapa 4.5.
  3. Incubar a preparação cromossoma em 0,1 mg / ml, solução de RNase em parafilme durante 30 min a 37 ° C.
  4. Lavar duas vezes em 2x SSC durante 5 minutos cada, a 37 ° C.
  5. Coloque lâminas ind frasco com pepsina a 0,01% e 0,037% de solução de HCl, e incubar durante 5 min a 37 ° C.
  6. Lavar as lâminas em 1 x PBS durante 5 min à TA.
  7. Fix preparação cromossoma em um frasco com 1% de formalina em PBS 1x preparado a partir de 10% de formalina tamponada neutra por 10 min à temperatura ambiente.
  8. Lavar as lâminas em 1 x PBS durante 5 min à TA.
  9. Desidratar as lâminas em série de 70%, 80% e etanol a 100% durante 5 min cada, à TA, e preparações de ar seco a 37 ° C. Se se realizarem FISH com IGS, seguir diretamente para a etapa 4,12
  10. Lâminas desnaturam em um frasco com formamida a 70% pré-aquecido durante 2 min a 72 ° C.
  11. Desidratar as lâminas em série de frio (-20 ° C) de 70%, 80%, e etanol a 100% durante 5 min cada, e ar seco a 37 ° C.
  12. Prepare mistura de hibridização:. 5 ul de DNA sonda marcada a partir do passo 3, 10 ul de DNA C t 0 a partir do passo 2 com a concentração final de 0,5 ul ng / ul, e 5 de 1 ug / ul de ADN de esperma de salmão sonicado para peixes com IGS rDNA, prepararmistura de hibridização sem C 0 fracções de ADN de t.
  13. DNA precipitado pela adição de 0,1 volume de acetato de sódio 3 M e 2 volumes de etanol. Manter a -20 ° C durante 1-3 hr.
  14. Centrifugar a 14.000 rpm a 4 ° C durante 20 minutos, remover o etanol, e o ar seco do sedimento à temperatura ambiente.
  15. Completamente dissolver o sedimento em 10 ul de tampão de hibridação.: 50% de formamida, 20% de sulfato de dextrano, 2x SSC Se se realizarem FISH com IGS, seguir diretamente para a etapa 4,18
  16. Mistura de hibridização Desnaturar durante 7 minutos a 97 ° C, e imediatamente colocadas em gelo durante 1 min.
  17. Prehybridize mistura a 37 ° C durante 30 minutos para evitar a hibridação inespecífica de DNA repetitivo para os cromossomas.
  18. Coloque 10 ul da mistura de hibridização no slide, e cubra com uma lamínula 22x22. Evitar a formação de bolhas - bolhas de ar devem ser retirados com uma leve pressão para a lamela Se realizar FISH com BAC DNA clone, vá diretamente para o passo 4,20 <./ Em>
  19. Desnaturar a sonda e o DNA cromossoma simultaneamente usando um bloco de aquecimento a 75 ° C durante 5 min.
  20. Deslizamento cola tampa em torno do perímetro com cimento de borracha.
  21. Realizar a hibridação durante a noite numa câmara húmida a 37 ° C.
  22. Remover o cimento de borracha e lamela do slide.
  23. Lavar slide 2 min em solução de pré-aquecido 1 (0,4 x SSC, 0,3% de Nonidet-P40) a 73 ° C.
  24. Lavar as lâminas em solução de 2 (2 x SSC, 0,1% de Nonidet-P40) durante 5 min à temperatura ambiente.
  25. Contracoloração lâminas com 0,001 mM YOYO-1 em 1x PBS durante 10 minutos em câmara húmida à temperatura ambiente.
  26. Montar em uma pequena quantidade de reagente Prolongar Antifade ouro com uma lamela.
  27. Analisar as preparações sob um microscópio fluorescente utilizando filtros adequados em 1000 x ampliação (figura 4).

5. Resultados representativos

IDs de insectos estão localizados em cada um dos segmentos da larva. Dependendo da posição do th,ey transformar em diferentes tecidos na fase adulta do inseto. Os IDs, que são utilizados para a preparação cromossoma neste protocolo, se desenvolvem em pernas na fase adulta do mosquito. Estas identificações são localizados no lado ventral do tórax larval e são claramente visíveis através da cutícula sob o microscópio (Figura 1). Na 4 ª cedo estádio fase larval, IDs de ter uma forma redonda (Figura 1A). O maior número de mitose, ~ 175 em um ID 9, são acumulados a uma posterior "oval" fase (Figura 1B), o que deve ser considerado como o ponto óptimo para preparação da lâmina. Neste momento, o ID intermediário divide-se em duas partes: uma transforma em uma perna e outra se transforma em uma asa. Nós preferimos usar os IDs de pernas grandes no "oval" palco para a preparação da lâmina cromossomo. Figura 1C representa identificações na última fase de desenvolvimento larva 4 º instar. Nesta fase, oIDs são já desenvolvido em pernas e asas, e contêm uma quantidade significativa de tecidos diferenciados e um baixo número de mitoses. Este estágio de desenvolvimento ID deve ser evitado para a preparação de slides cromossomo. Recomenda-se também a criação de larvas de mosquito em baixas temperaturas:. 16 ° C durante Aedes e Culex e 22 ° C durante Anopheles Isto ajuda a aumentar a quantidade de mitose em IDs 9.

A Figura 2 ilustra a dissecção ID do tórax de 4 th larva instar. Porque a cutícula de um inseto vivo é difícil de dissecar, recomendamos o uso de tesouras de dissecação em vez das agulhas geralmente usados ​​para a preparação de larva. O processo mais importante para a obtenção de alta qualidade preparação cromossoma é o tratamento uma solução hipotónica. Para obter melhores resultados, remova o intestino e gordura corporal do tórax larval antes deste tratamento. Inchaço das células de identificação durante este procedimento ajuda a espalhar cromossomos em uma lâmina (Figura 3A). A qualidade adequada do tratamento solução hipotónica pode ser facilmente reconhecida pela forma redonda de células nas preparações (Figura 3A, B). As células com uma forma oval indicam tratamento insuficiente solução hipotónica (Figura 3C). A serem seleccionados para FISH, preparação cromossoma deve conter pelo menos 50 barrar de alta qualidade de cromossomas. Normalmente, ~ 90% das lâminas preparadas usando este protocolo tem qualidade suficiente para PEIXES 9.

Nós apresentamos dois protocolos PEIXES ligeiramente diferentes: um protocolo avançado para pescar usando genômica BAC clone sonda de DNA em cromossomos mitóticos de Aedes e Culex e um protocolo de FISH simples para IGS sonda de DNAr em cromossomos mitóticos de Anopheles. Os genomas de Aedes e Culex são altamente repetitiva por causa da sobre-representação de elementos transponíveis 7,8. Assim FISH, realizando, que utilizes DNA do clone genómico BAC como sonda, requer a adição de fracções de DNA repetitivo não marcados com a sonda para bloquear a hibridização não específica das repetições de DNA nos cromossomas. Para a extracção das fracções de DNA repetitivas, o ADN genómico é desnaturado a 120 ° C durante 2 min. DNA de ebulição a uma temperatura elevada, também ajuda a obtenção de DNA em fragmentos de 200-500 bp. DNA é permitido para reassociar após este tratamento. Os fragmentos de DNA altamente repetitivos tendem a encontrar seu companheiro para reassociação mais rápido do que o DNA com seqüências únicas faz. Como resultado, a reassociação de DNA segue uma curva C 0 x t em que C 0 é a concentração inicial de ADN de cadeia simples, e t é o tempo de recombinação. Frações de DNA com C 0 valores de t igual a 10-4 - 10-1 ou 100-102 são considerados altamente e moderadamente repetitivo, respectivamente. O tempo da reassociação para diferentes fracções de ADN 0 C t pode ser calculada usando the fórmula C t = 0 t X × 4,98 / C 0, em que t - tempo de incubação, C 0 t X - C 0 fracção t (C0t 1 = 1, C 0 t 2 = 2, etc), e C 0 - concentração de ADN inicial, em ug / uL 15 (Tabela 1). Após reassociação, o DNA de cadeia simples foi digerido com nuclease S1. Nós preferimos usar todos C 0 frações de DNA t até C 0 t 3 juntos em vez de o comumente usado C 0 t fração do DNA 1. Essas frações C 0 t incluem algumas das seqüências de DNA moderadamente repetitivas e juntos representam geralmente 35-50% do valor original do DNA genômico em Ae. aegypti. A proporção correcta entre a sonda de DNA marcado e não marcado C 0 fracção de ADN t depende do componente de ADN repetitivo em cada clone BAC particular. Em média, usamos 1:20 sonda para C 0 tProporção de DNA para a obtenção de uma fração sinais aceitáveis ​​/ razão de fundo do resultado FISH. A pré-hibridação da sonda de DNA com C 0 fracções de ADN t em um tubo de 30 min antes da hibridação real na corrediça também ajuda a reduzir o fundo. Rotulagem, hibridização em si, e de lavar, neste protocolo são realizadas utilizando condições padrão 12.

Os resultados de peixe de duas diferente rotulados BAC clone sondas de DNA nos cromossomos mitóticos de Ae. aegypti e Cx. quinquefasciatus são apresentados nas Figuras 4A e B, respectivamente. As sondas de DNA BAC clone produzir sinais fortes em uma única posição nos cromossomos. Cromossomas mostrados na Figura 1 são contrastadas com YOYO-1 iodeto. Este corante produz os melhores padrões de bandas em Ae. aegypti cromossomas 9. Alternativamente, outros corantes fluorescentes, tais como DAPI ou iodeto de propídio, podem ser utilizados para pocontracoloração cromossomo e. Para suprimir a fotodegradação dos slides, nós usamos Prolongar meio de Ouro Antifade montagem. Este reagente tem capacidades boa preservação de sinal e também pode ser facilmente removida a partir da lâmina, por lavagem em PBS 1x, se for necessário utilizar a mesma lâmina para vários hibridizações.

Uma versão simples do protocolo de FISH é projetado para a hibridização de IGS sonda de DNAr em cromossomos mitóticos de Anopheles. Genes ribossomais em Anopheles são representados como um aglomerado de genes polimórficos localizados em cromossomas sexuais 16. A sonda de DNA neste protocolo é marcado pela reação de PCR padrão, adicionando etiquetas fluorescentes Cy3 ou Cy5 dNTPs. Porque bloqueio hibridação inespecífica de ADN repetitivo em eucromatina não é necessário, todas as medidas relacionadas com o uso C 0 fracções de ADN t são omitidos. Em vez disso, preparações de cromossomas são pré-tratadas com RNase para prevenir a hibridação da sonda de rDNA para IGSo nucléolo. Cromossomas e a sonda de ADN são desnaturados por aquecimento simultâneo da lâmina em conjunto com uma sonda de um sistema de hibridação a 75 ° C durante 5 min. A hibridação e lavagem neste protocolo são também realizada usando condições padrão para FISH 12. O resultado de FISH é demonstrado na Figura 4C: o polimorfismo da hibridação de rDNA IGS entre dois cromossomas X é claramente visível.

0 t 3
Concentração de DNA ug / uL Recombinação tempo, min
C 0 t 2 0,1 100
0,3 33
0,5 20
0,7 14
0,9 11
1 10
0,1 150
0,3 50
0,5 30
0,7 21
0,9 17
1 15

Tabela concentração de ADN 1. Recombinação e tempos de preparação de C 0 t2 e t3 C 0 fracções.

Figura 1
Figura 1 Etapas do desenvolvimento ID na 4 ª larva instar: A) um início de "forma redonda" Estágio, B) um intermediário "oval forma" palco - ideal para a preparação dos cromossomos; C) um estágio posterior - inadequado para preparações cromossômicas. . As posições das IDs são indicados por setas no lado ventral do tórax larval.

Figura 2
Figura 2 etapas de dissecção ID: Uma larva) decapitada (a direção de cortes são indicados por setas); B) larvas com intestino dissecados sob tratamento solução hipotônica (IDs inchar e tornar-se quase invisível); C) larva após a aplicação de Carnoy solução (. IDs de se tornar branco e claramente visível); D) dissecados IDs em solução de Carnoy. Posições de identificações em larva são indicadas por asteriscos.

Figura 3
Figura 3 qualidades diferentes de os spreads de cromossomos: A) um spread cromossomo perfeito - forma redonda das células demonstra tratamento suficiente das identificações em solução hipotônica, B) de tratamento de uma perfeita hipotônica - cromossomos são ligeiramente undersquashed; C) de um spread cromossomo pobres. - o resultado datratamento hipotónico insuficiente é indicado pela forma oval das células.

Figura 4
Figura 4. Exemplos de peixe com clones BAC (A, B) e rDNA IGS (C) nos cromossomos de Ae. aegypti (A), Cx. quinquefasciatus. (B), e um. gambiae (C). 1, 2 e 3 - são números de cromossomos X - cromossoma sexual feminino em um. gambiae.

Discussion

Não fluorescente na hibridação in situ em cromossomos mitóticos dos mosquitos foi realizada pela primeira vez em 1990 por A. Kumar e Rai K. 17. Nesse estudo, 18S e 28S do DNA ribossomal, clonados juntos em um plasmídeo, foram colocadas para os cromossomas de 20 espécies de mosquitos. A sonda de ADN foi marcada radioactivamente e hibridada com os cromossomas de gânglios cérebro. Entre três gêneros de mosquitos, uma técnica de FISH foi desenvolvido apenas para cromossomos mitóticos a partir da linha de células de Ae. aegypti 10,18,19 e nunca foi realizada em cromossomos mitóticos de mosquitos vivos. Recentemente, foi desenvolvida uma técnica simples e robusta para a obtenção de preparações de alta qualidade dos cromossomos de IDs de 4 larvas ínstares 9. Este método permite que um grande número de cromossomas para ser obtido de uma corrediça e pode ser universalmente utilizado para todas as espécies de mosquitos. A necessidade de utilizar apenas sta não larval, pupal ou adultoges de mosquitos, para preparação da lâmina é provavelmente a única limitação do método. O método padrão FISH 12 foi otimizado para uso genômica BAC clone e IGS rDNA como sondas para os cromossomos mitóticos de Aedes, Culex e Anopheles.

Para além destas aplicações específicas, os protocolos de FISH descritas aqui podem também ser usados ​​para outros fins. O protocolo de FISH avançado, que utiliza fracções de ADN C 0 t para bloquear a hibridização não específica, também pode ser aplicado para a hibridação de clones BAC ou quaisquer outros fragmentos de DNA em grandes regiões de Anopheles heterocromatina. Regiões heterocromáticas são enriquecidas com elementos transponíveis e repete outros, e sondas dessas regiões produzem normalmente sólida sobre os três cromossomos. Usando Unlabeled C 0 frações de DNA t vai ajudar a reduzir a hibridação inespecífica da sonda para os cromossomos. A versão simples do FISH protocol pode ser usado para qualquer rDNA ou as sondas de ADN repetitivo em cromossomos mitóticos de mosquitos e outros insectos. Além disso, também pode ser aplicado para a hibridação de DNA clone BAC em espécies com baixo teor de ADN repetitivo em regiões totalmente eucromático como Anopheles ou Drosophila. O protocolo proposto aqui vai ajudar a obter altamente acabados assembléias cromossomo base do genoma do mosquito e pode ser amplamente utilizado para aplicações de citogenética vários outros grupos de insetos.

Disclosures

Não há conflitos de interesse declarados.

Acknowledgments

Agradecemos Sergei Demin e Tatyana Karamysheva por sua ajuda com a preparação cromossômica e FISH em Anopheles. Agradecemos também a David Severson por nos proporcionar Aedes e Culex DNA genômico BAC clones e Melissa Wade para a edição do texto. Este trabalho foi financiado por duas subvenções dos Institutos Nacionais de Saúde: 1R21 AI88035-01 para Maria V. Sharakhova e 1R21 AI094289-01 para Igor V. Sharakhov.

Materials

Name Company Catalog Number Comments
MZ6 Leica stereomicroscope Leica VA-OM-E194-354 A different stereomicroscope can be used
Olympus CX41 phase microscope Olympus CX41 A different phase microscope can be used
Olympus BX61 fluorescent microscope Olympus BX61 A different fluorescent microscope can be used
ThermoBrite Slide Denaturation/Hybridization System Abbott Molecular 30-144110 Serves as a heating block and a humid chamber
Dissecting needles Fine ScienceTools 10130-10
Needle holders Fine Science Tools 26018-17
Dissecting scissors Fine Science Tools 15000-03
75x25 double frosted micro slides Corning 2949-75x25
22x22 mm microscope coverslips Fisher Scientific 12-544-10
Parafilm Fisher Scientific 13-374-10
Rubber Cement Fisher Scientific 50-949-105
Acetic acid Fisher Scientific A491-212
Alcohol 200 Proof Decon Laboratories 2701
Propionic acid Sigma-Aldrich 402907
Hydrochloric acid Fisher Scientific A144-500
Sodium citrate dihydrate Fisher Scientific S279-500
Sodium acetate trihydrate Fisher Scientific BP334-500
Potassium chloride Fisher Scientific BP366-500
EDTA Fisher Scientific S311-500
Tris base Fisher Scientific BP152-1
10x PBS Invitrogen P5493
10% NBF (neutral buffered formalin) Sigma-Aldrich HT501128
99% formamide Fisher Scientific BP227500
Dextran sulfate sodium salt Sigma-Aldrich D8906
20x SSC buffer Invitrogen AM9765
1 mM YOYO-1 iodide (491/509) solution Invitrogen Y3601
Antifade Prolong Gold reagent Invitrogen P36930
dATP, dCTP, dGTP, dTTP Fermentas R0141, R0151, R0161, R0171
Cy3-dUTP, Cy5-dUTP GE Healthcare PA53022, PA55022
BSA Sigma-Aldrich A3294
DNA Polymerase I Fermentas EP0041
DNase I Fermentas EN0521
S1 Nuclease Fermentas EN0321
Taq DNA Polymerase Invitrogen 18038-042
RNase Sigma-Aldrich 9001-99-4
Pepsin USB 9001-75-6
Salmon sperm DNA Sigma-Aldrich D7656
Nonidet-P40 (NP40) US Biological NC9375914
Qiagen Blood and Cell Culture Maxikit Qiagen 13362
Qiagen Large Construct Kit Qiagen 12462

DOWNLOAD MATERIALS LIST

References

  1. Sharakhov, I. V., Sharakhova, M. V. Chromosome Mapping Research Developments. Verrity, J. F., Abbington, L. E. Nova Science Publishers, Inc. (2008).
  2. Holt, R. A., et al. The genome sequence of the malaria mosquito Anopheles gambiae. Science. 298, 129-149 (2002).
  3. Sharakhova, M. V., et al. Update of the Anopheles gambiae PEST genome assembly. Genome biology. 8, R5 (2007).
  4. Campos, J., Andrade, C. F., Recco-Pimentel, S. M. A technique for preparing polytene chromosomes from Aedes aegypti (Diptera, Culicinae). Memorias do Instituto Oswaldo Cruz. 98, 387-390 (2003).
  5. Campos, J., Andrade, C. F., Recco-Pimentel, S. M. Malpighian tubule polytene chromosomes of Culex quinquefasciatus (Diptera, Culicinae). Memorias do Instituto Oswaldo Cruz. 98, 383-386 (2003).
  6. McAbee, R. D., Christiansen, J. A., Cornel, A. J. A detailed larval salivary gland polytene chromosome photomap for Culex quinquefasciatus (Diptera: Culicidae) from Johannesburg, South Africa. J. Med. Entomol. 44, 229-237 (2007).
  7. Nene, V., et al. Genome sequence of Aedes aegypti, a major arbovirus vector. Science. 316, 1718-1723 (2007).
  8. Arensburger, P., et al. Sequencing of Culex quinquefasciatus establishes a platform for mosquito comparative genomics. Science. 330, 86-88 (2010).
  9. Sharakhova, M. V., et al. Imaginal discs--a new source of chromosomes for genome mapping of the yellow fever mosquito Aedes aegypti. PLoS neglected tropical diseases. 5, e1335 (2011).
  10. Brown, S. E., et al. Toward a physical map of Aedes aegypti. Insect Mol. Biol. 4, 161-167 (1995).
  11. Steiniger, G. E., Mukherjee, A. B. Insect chromosome banding: technique for G- and Q-banding pattern in the mosquito Aedes albopictus. Can. J. Genet. Cytol. 17, 241-244 (1975).
  12. Garimberti, E., Tosi, S. Fluorescence in situ hybridization (FISH). Bridger, J. M., Volpi, E. V. Springer Science and Business Media. (2010).
  13. Methods in Anopheles Research [Internet]. The Malaria Research and Reference Reagent Resource Center. Atlanta, GA. Available from: http://www.mr4.org/Portals/3/Pdfs/ProtocolBook/MethodsAnophelesResearchV4c.pdf (2007).
  14. Scott, J. A., Brogdon, W. G., Collins, F. H. Identification of single specimens of the Anopheles gambiae complex by the polymerase chain reaction. The American journal of tropical medicine and hygiene. 49, 520-529 (1993).
  15. Trifonov, V. A., Vorobyeva, N. N., Rens, W. Fluorescence in situ hybridization (FISH). Leiehr, T. Spriger-Verlag. (2009).
  16. Collins, F. H., et al. A ribosomal RNA gene probe differentiates member species of the Anopheles gambiae complex. The American journal of tropical medicine and hygiene. 37, 37-41 (1987).
  17. Kumar, A., Rai, K. S. Chromosomal localization and copy number of 18S+28S ribosomal RNA genes in evolutionary diverse mosquitoes (Diptera, Culicidae). Hereditas. 113, 277-289 (1990).
  18. Brown, S. E., Knudson, D. L. FISH landmarks for Aedes aegypti chromosomes. Insect Mol. Biol. 6, 197-202 (1997).
  19. Brown, S. E., Severson, D. W., Smith, L. A., Knudson, D. L. Integration of the Aedes aegypti mosquito genetic linkage and physical maps. Genetics. 157, 1299-1305 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics