Fluorescerende

Immunology and Infection
 

Summary

Van de drie mug genera, namelijk

Cite this Article

Copy Citation | Download Citations

Timoshevskiy, V. A., Sharma, A., Sharakhov, I. V., Sharakhova, M. V. Fluorescent in situ Hybridization on Mitotic Chromosomes of Mosquitoes. J. Vis. Exp. (67), e4215, doi:10.3791/4215 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Fluorescente in situ hybridisatie (FISH) is een techniek routinematig gebruikt door vele laboratoria om de chromosomale positie van DNA en RNA probes bepalen. Een belangrijke toepassing van deze werkwijze is de ontwikkeling van hoogwaardige fysische kaarten nuttig om het genoom samenstellingen voor verschillende organismen. De natuurlijke strepen patroon van polytheen en mitotische chromosomen vormt een leidraad voor de precieze ordening en oriëntatie van de genomische supercontigs. Van de drie mug geslachten, namelijk Anopheles, Aedes en Culex, een gevestigde chromosoom-based mapping techniek is ontwikkeld uitsluitend voor Anopheles, waarvan de leden bezitten leesbaar polytheen chromosomen 1. Als gevolg van genoomkartering inspanningen 88% van de An. gambiae genoom is geplaatst om precieze chromosoom posities 2,3. Twee andere mug geslachten, Aedes en Culex, hebben slecht polytenized chromosomen banwege significante oververtegenwoordiging van transposons in hun genoom 4, 5, 6. Slechts 31 en 9% van de genomische supercontings zijn toegewezen zonder orde of richting te chromosomen van Ae. aegypti 7 en Cx. quinquefasciatus 8, respectievelijk. Mitotische chromosoom voorbereiding voor deze twee soorten eerder beperkt tot de hersenen ganglia en cellijnen. Echter, chromosoom dia's bereid uit de hersenen ganglia van muggen bevatten meestal lage aantallen metafase platen 9. Ook, hoewel een FISH techniek ontwikkeld voor mitotische chromosomen van een cellijn van Ae. aegypti 10, de accumulatie van meerdere chromosomale herschikkingen in cellijn chromosomen 11 zijn ze nutteloos voor genoomkartering. Hier beschrijven we een eenvoudige, robuuste techniek om hoogwaardige mitotische chromosoompreparaten van denkbeeldige schijven (ID) 4 e instar larven die ceen gebruikt worden voor alle drie genera muggen. Een standaard FISH protocol 12 is geoptimaliseerd voor gebruik BAC klonen van genoom DNA als probe op mitotische chromosomen van Ae. aegypti en Cx. quinquefasciatus, of het gebruik van een intergene spacer (IGS) regio van ribosomaal DNA (rDNA) als probe op An. gambiae chromosomen. Naast de fysieke kaart brengen, kunnen de ontwikkelde techniek worden toegepast op de bevolking cytogenetica en chromosoom taxonomie / systematiek van muggen en andere insecten groepen.

Protocol

1. Chromosoom Voorbereiding

Muggenlarven zijn gehouden met behulp van een standaard protocol beschreven in Methods in Anopheles Research, beschikbaar op de website van de Malaria Research and Reference Reagent Resource Center (MR4) 13. De temperaturen van mug opfok werden gewijzigd om het hoogste aantal chromosomen in imaginaire schijven en laagste sterfte van de larven te geven. De stadia van muggenlarven ontwikkeling werden bepaald op basis van de grootte van het hoofd capsules 13.

  1. Hatch mosquito eieren bij 28 ° C, en na 2-3 dagen, transfer 2e of 3e instar larven 16 ° C gedurende Ae. aegypti en Cx. quinquefasciatus en 22 ° C gedurende An. gambiae.
  2. Plaats 4 e instar larven op ijs gedurende enkele minuten voor immobilisatie.
  3. Overdracht larve aan een dia met een daling van koude hypotone oplossing (0,5%, zodatdium citraat of 0,075 M kaliumchloride), en plaats het onder de stereomicroscoop.
  4. Selecteer larve met ovale IDs (fig. 1B) voor verdere dissectie.
  5. Onthoofden larve, en snijd de cuticula van de ventrale zijde van de larvale thorax met het ontleden schaar (Figuur 2A). Maak extra verlaging van de tweede of derde abdominale segment van de darm ontleden van de larve. De richtingen van de delen zijn weergegeven door pijlen.
  6. Open de cuticula, en verwijder de darm en dikke lichaam van de larve. Verwijder de hypotone oplossing van de dia met filtreerpapier en een frisse druppel hypotone oplossing rechtstreeks aan de ID (Figuur 2B). Houden larve in hypotone oplossing gedurende 10 min bij RT.
  7. Verwijder hypotone oplossing met filtreerpapier en toepassing Carnoy's oplossing (ethanol / azijnzuur in 3:1 ratio). Na het toevoegen van fixatief oplossing, ID's direct weer wit en worden goed zichtbaar onder de microscoop (figuur 2C
  8. Met behulp van het ontleden van naalden, verwijdert u id's uit de larve (figuur 2D) en overbrengen naar een daling van 50% propionzuur. Eventuele andere weefsels, zoals de darmen en dik lichaam van de glijbaan. Bedek IDs met unsiliconized 22x22 dekglas en gedurende 10 min bij RT.
  9. Bedek de dia met filtreerpapier, en squash het weefsel door te tikken op de gum van een potlood aan de rand van het deksel slip.
  10. Korte analyse van de kwaliteit van de schuif met de fase-contrast microscoop bij 100x of 200x vergroting (figuur 3). Preparaten met> 50 chromosoom spreads kan worden geschikt geacht voor FISH.
  11. Doop en houd de schuif in vloeibare stikstof totdat deze niet verder borrelen. Verwijder het dekglas van de dia met een scheermesje en onmiddellijk over de dia naar een container van 70% ethanol gekoeld tot -20 ° C. Bewaar bij 4 ° C gedurende tenminste 1 uur voor het beste resultaat uitdroging (eventueel kan worden opgeslagen slides tZijn stap van enkele minuten tot enkele dagen).
  12. Uitdrogen glaasjes in een reeks ethanol (70%, 80%, 100%) bij 4 ° C gedurende 5 minuten elk, en drogen bij kamertemperatuur.
  13. Bewaar droge dia's bij -20 ° C voor gebruik te maken van hen voor FISH.

2. Extractie van repetitief DNA breuken

Het uitvoeren van vis van de BAC-kloon DNA-probe op de chromosomen van Ae. aegypti en Cx. quinquefasciatus vereist het gebruik van gelabelde herhalende DNA fracties onspecifieke hybridisatie van de DNA herhalingen blokkeren de chromosomen. De reassociatie van enkelstrengs DNA gefragmenteerd in stukken van enkele honderden bp volgt een C 0 t C 0 curve waarbij de beginconcentratie van enkelstrengs DNA en t de tijd opnieuw annealen. DNA fracties met C0t waarden gelijk aan 10 -4 -10 -1 of 10 ° -10 2 worden als zeer matig en repetitieve beschouwd als respectievelijk.

  1. Extract 400-500 ug van het genomische DNA van gehele volwassen muskieten met Qiagen Blood and Cell Culture Maxikit en bereid 100-1000 ng / ul DNA oplossing in 1,2 x SSC.
  2. DNA denatureren door een safe-lock buis met genomisch DNA in een verwarmingsblok voorverwarmd tot 120 ° C gedurende 2 minuten. Hoge temperatuur helpt om DNA variëren in 200-500 bp fragmenten.
  3. Afhankelijk van de DNA concentratie reassociëren DNA door het plaatsen van de buis bij 60 ° C gedurende 15 tot 150 minuten tot C 0 t DNA fracties te verkrijgen tot C 0 t3 (tabel 1).
  4. Plaats de buis met DNA op ijs gedurende 2 minuten.
  5. Breng de DNA tot 42 ° C voorverwarmd 10x S1 nuclease buffer en S1 nuclease aan een eindconcentratie van 100 U per 1 mg van DNA, en incubeer gedurende 1 uur.
  6. DNA precipitaat door toevoeging van 0,1 volume 3 M natriumacetaat en 1 volume isopropanol bij kamertemperatuur.
  7. Centrifugeer bij 14.000 rpm gedurende 20 min bij 4 ° C.
  8. Wassen DNA in 70% ethanol en opnieuw gecentrifugeerd bij 14.000 rpm gedurende 10 minbij 4 ° C.
  9. Drogen en los DNA pellet in TE buffer.
  10. Meet de DNA concentratie en visualiseren door gelelektroforese. Meestal de uiteindelijke hoeveelheid van repeterende DNA fracties vertegenwoordigt 35-50% van de oorspronkelijke hoeveelheid DNA.

3. DNA Probe Labeling

Twee verschillende protocollen voor etikettering BAC kloon DNA probe en IGS rDNA probe.

3,1 BAC-kloon etikettering met behulp van nick-translatie

  1. Extract BAC-kloon DNA van de BAC-bibliotheek met behulp van Qiagen Grote Construct Kit.
  2. Bereid reactiemengsel voor nick-translatie labeling op ijs met eindvolume van 50 pl: 1 pg die BAC kloon DNA, 0,05 mM elk van ongelabelde dATP, dCTP, en dGTP en 0,015 mM dTTP, 1 ul Cy3-dUTP (of een andere fluorochroom) 0,05 mg / ml BSA, 5 pl 10x nick-translatie buffer, 20 U van DNA-polymerase I, en 0,0012 U of DNase.
  3. Incubeer bij 15 ° C gedurende 20.5 hr.
  4. Stop reactie door toevoeging van 1 pi 0,5 M EDTA.
  5. Bewaren sonde bij -20 ° C op een donkere plaats.

3,2 IGS rDNA labeling met PCR

  1. Bereid reactiemengsel op ijs met eindvolume van 50 pi 200 ng genomisch DNA, 0,05 mM elk van ongelabelde dATP, dCTP, en dGTP, 0,015 mM dTTP, 1 ul Cy3-dUTP (of een ander fluorochroom), 5 pi 10x PCR-buffer, 50 pmol voorwaartse UN (GTGTGCCCCTTCCTCGATGT) en reverse, GA (CTGGTTTGGTCGGCACGTTT) primers voor amplificatie IGS en 10 U van Taq DNA polymerase 14.
  2. Voer PCR reactie met standaard PCR amplificatie IGS parameters: 95 ° C / 5 min x 1 cyclus; (95 ° C / 30 sec, 50 ° C / 30 sec, 72 ° C / 30 sec) x 30 cycli, 72 ° C / 5 min x 1 cyclus en 4 ° C te houden 14.
  3. Bewaren sonde bij -20 ° C op een donkere plaats.

4. Fluorescente in situ hybridisatie

en Cx. quinquefasciatus en de tweede voor het gebruik van IGS rDNA op mitotische chromosomen van An. gambiae. Bij gebruik van BAC-kloon DNA-probes, sla RNase behandeling stap 4.3, 4.4, en gelijktijdige schuif / sonde denaturatiestap 4.19. Bij gebruik van IGS rDNA probe, voor te bereiden hybridisatie mengsel zonder C 0 t DNA breuken, en sla een aparte schuif / sonde denaturerende stappen 4.10, 4.11, 4.16, en 4.17.

  1. Incubeer slides in 2x SSC gedurende 30 min bij 37 ° C.
  2. Uitdrogen slides in series van 70%, 80% en 100% ethanol gedurende 5 minuten elk bij kamertemperatuur en drogen. Bij het ​​uitvoeren FISH met BAC kloon DNA, rechtstreeks naar stap 4.5.
  3. Incubeer chromosoom preparaat 0,1 mg / ml RNase oplossing onder parafilm gedurende 30 min bij 37 ° C.
  4. Was tweemaal in 2x SSC gedurende 5 minuten elk bij 37 ° C.
  5. Zet dia's ina pot met 0,01% pepsine en 0,037% HCl oplossing en incubeer gedurende 5 min bij 37 ° C.
  6. Wassen slides in 1x PBS gedurende 5 min bij RT.
  7. Fix chromosoom preparaat in een pot met 1% formaline in 1x PBS bereid uit 10% neutraal gebufferde formaline gedurende 10 min bij RT.
  8. Wassen slides in 1x PBS gedurende 5 min bij RT.
  9. Uitdrogen slides in series van 70%, 80% en 100% ethanol gedurende 5 minuten elk bij kamertemperatuur en drogen preparaten bij 37 ° C. Bij het ​​uitvoeren FISH met IGS, rechtstreeks naar stap 4,12
  10. Denatureren glaasjes in een pot met voorverwarmde 70% formamide gedurende 2 minuten bij 72 ° C.
  11. Uitdrogen slides in serie koude (-20 ° C) 70%, 80% en 100% ethanol gedurende 5 minuten elk, en drogen bij 37 ° C.
  12. Bereid hybridisatiemengsel:. 5 pi gemerkte probe DNA uit stap 3, 10 pi C 0 t DNA uit stap 2 met eindconcentratie van 0,5 ng / pl en 5 pl van 1 ug / ul gesoniceerd zalmsperma DNA voor vis IGS rDNA, voor te bereidenhybridisatie mengsel zonder C 0 t DNA breuken.
  13. DNA precipitaat door toevoeging van 0,1 volume 3 M natriumacetaat en 2 volumes ethanol. Houden bij -20 ° C gedurende 1-3 uur.
  14. Centrifugeer bij 14.000 rpm bij 4 ° C gedurende 20 min, wordt de ethanol en drogen de pellet bij kamertemperatuur.
  15. Goed los de pellet in 10 ul hybridisatiebuffer: 50%. Formamide, 20% dextransulfaat, 2 x SSC Bij het ​​uitvoeren FISH met IGS, rechtstreeks naar 4,18 Trap
  16. Denatureren hybridisatiemengsel gedurende 7 min bij 97 ° C en onmiddellijk op ijs gedurende 1 minuut.
  17. Prehybridize mengsel bij 37 ° C gedurende 30 minuten tot onspecifieke hybridisatie van herhaalde DNA voorkomen dat de chromosomen.
  18. Plaats 10 ul van de hybridisatie mengsel op de dia, en dek af met een 22x22 dekglas. Voorkom blaasvorming - luchtbellen moeten worden verwijderd met een lichte druk op de dekglaasje Bij het ​​uitvoeren van FISH met BAC-kloon DNA, gaat u direct naar stap 4,20 <./ Em>
  19. Denaturatie van de probe en chromosoom DNA tegelijkertijd met een verwarmingsblok bij 75 ° C gedurende 5 minuten.
  20. Lijm dekglas rond de omtrek met behulp van rubber cement.
  21. Voer overnacht hybridisatie in een vochtige kamer bij 37 ° C.
  22. Verwijder de rubber cement en dekglaasje uit de dia.
  23. Wassen dia 2 min voorverwarmd in Oplossing 1 (0.4x SSC, 0,3% Nonidet-P40) bij 73 ° C.
  24. Wassen slides in oplossing 2 (2x SSC, 0,1% Nonidet-P40) gedurende 5 min bij RT.
  25. Tegenkleuring dia met 0,001 mM YOYO-1 in 1x PBS gedurende 10 minuten in vochtige kamer bij kamertemperatuur.
  26. Monteren in een kleine hoeveelheid verlengen Gold antifade reagens met een dekglas.
  27. Analyseer de voorbereidingen onder een fluorescentiemicroscoop met geschikte filtersets bij 1.000 x vergroting (figuur 4).

5. Representatieve resultaten

Insect-id's in elk segment van de larve. Afhankelijk van de positie, they transformeren in verschillende weefsels in het volwassen stadium van het insect. De ID's die worden gebruikt voor de bereiding chromosoom in dit protocol ontwikkelen tot benen bij de volwassen stadium van de mug. Deze ID's zijn gelegen aan de ventrale zijde van de larvale thorax en zijn duidelijk zichtbaar door de cuticula onder de microscoop (Figuur 1). Aan het begin van 4 e instar larvale stadium, ID's hebben een ronde vorm (Figuur 1A). De grootste aantallen van mitose, zijn ~ 175 in een ID 9, opgebouwd op een later "ovale" fase (Figuur 1B), die moet worden beschouwd als de optimale podium voor het prepareren van objectglaasjes. Op dit moment de tussenliggende ID splitst in twee: een transformeert in een been en een andere verandert in een vleugel. Wij geven de voorkeur het gebruik van de grote been-id's in de "ovale" podium voor de chromosoom prepareren. Figuur 1C vertegenwoordigt ID's op de nieuwste stand van 4 e instar larve ontwikkeling. In dit stadiumIDs reeds ontwikkeld tot poten en de vleugels, en een significante hoeveelheid van gedifferentieerde weefsels en een laag aantal mitose. Dit stadium van ontwikkeling ID moeten worden vermeden voor chromosoom prepareren. We raden houden van muggenlarven bij lage temperaturen: 16. ° C voor Aedes en Culex en 22 ° C gedurende Anopheles Dit helpt de hoeveelheid mitose verhogen IDs 9.

Figuur 2 illustreert ID dissectie van de thorax van 4 e instar larve. Omdat de cuticula van een live insect is moeilijk te ontleden, raden we u aan ontleden schaar in plaats van de naalden vaak gebruikt voor larve voorbereiding. De meest cruciale procedure voor het verkrijgen van hoge kwaliteit chromosoom voorbereiding is de hypotone oplossing behandeling. Voor de beste resultaten, verwijderen we de darm en de dikke lichaam van de larven thorax voor deze behandeling. Zwelling van de ID-cellen tijdens deze procedure helpt om zich te verspreiden chromosooms een dia (Figuur 3A). De juiste kwaliteit van de hypotone oplossing behandeling kan gemakkelijk worden bepaald door de ronde vorm van cellen in de preparaten (Figuur 3A, B). Cellen met een ovale vorm dan onvoldoende hypotone oplossing behandeling (Figuur 3C). Om geselecteerd te worden voor FISH, moet chromosoom voorbereiding bevatten ten minste 50 hoge kwaliteit chromosoom spreads. Normaal ~ 90% van de dia bereid met dit protocol voldoende kwaliteit voor FISH 9.

We presenteren twee lichtjes verschillende FISH protocollen: een geavanceerd protocol voor FISH gebruik van genomische BAC-kloon DNA-probe op mitotische chromosomen van Aedes en Culex en een eenvoudige FISH protocol voor het IGS rDNA probe op mitotische chromosomen van Anopheles. De genomen van Aedes en Culex zijn zeer repetitief vanwege de oververtegenwoordiging van transposons 7,8. Zo uitvoeren FISH die utilizes genomische BAC-kloon DNA als een probe, vereist het toevoegen unlabeled repetitieve DNA fracties de probe om niet-specifieke hybridisatie van de DNA herhalingen blokkeren chromosomen. Voor de extractie van de repetitieve DNA fracties wordt genomisch DNA gedenatureerd bij 120 ° C gedurende 2 minuten. DNA koken op hoge temperatuur helpt ook om DNA fragmenten verkrijgen van 200-500 bp. DNA mag reassociëren na deze behandeling. De zeer repetitieve DNA-fragmenten hebben de neiging om hun partner te vinden voor reassociatie sneller dan DNA met unieke sequenties doet. Bijgevolg de reassociatie van DNA volgt een C 0 x t curve waar C 0 is de beginconcentratie van enkelstrengs DNA, en t de tijd opnieuw annealen. DNA-fracties met C 0 t-waarden gelijk aan 10-4 - 10-1 of 100 tot 102 zijn zeer en matig repetitieve beschouwd, respectievelijk. De tijd van de reassociatie voor verschillende C 0 t DNA fracties worden berekend the formule t = 0 t X C × 4,98 / C 0, waarbij t - incubatietijd, C 0 t X - C 0 t fractie (C0t 1 = 1, C 0 t 2 = 2, enz.) en C 0 - eerste DNA concentratie in pg / pl 15 (tabel 1). Na reassociatie, wordt het enkelstrengs DNA gedigereerd met nuclease S1. We geven de voorkeur aan alle C 0 t DNA breuken tot C 0 t 3 elkaar in plaats van de algemeen gebruikte C 0 t 1 DNA fractie. Deze C 0 t fracties omvatten enkele van matig repetitieve DNA-sequenties samen meestal voor 35-50% van de oorspronkelijke hoeveelheid van het genomische DNA in Ae. aegypti. De juiste verhouding tussen gemerkte DNA probe en ongelabelde C 0 t DNA-fractie is afhankelijk van de repetitieve DNA component in elk afzonderlijk BAC kloon. Gemiddeld gebruiken we 1:20 probe C 0 tDNA fractie verhouding voor het verkrijgen van een aanvaardbare signaal / achtergrond verhouding van de FISH resultaat. Prehybridisatie van de DNA probe met C 0 t DNA breuken in een buis gedurende 30 minuten voordat de feitelijke hybridisatie op de dia helpt te verminderen achtergrond. Labeling, hybridisatie zelf, en wassen in dit protocol worden uitgevoerd met standaard condities 12.

De FISH resultaten van twee verschillend gelabelde BAC-kloon DNA-sondes op mitotische chromosomen van Ae. aegypti en Cx. quinquefasciatus worden getoond in Figuren 4A en B respectievelijk. De BAC kloon DNA probes produceren sterke signalen in een positie op de chromosomen. Chromosomen figuur 1 worden tegengekleurd met YOYO-1 jodide. Deze kleurstof produceert de beste bandenpatronen op Ae. aegypti chromosomen 9. Als alternatief kunnen andere fluorescerende kleurstoffen, zoals DAPI of propidiumjodide, worden gebruikt voor the chromosoom tegenkleuring. Voor het onderdrukken van fotobleken van de dia's, gebruiken we Verleng Gold antifade fixeermiddel. Dit reagens is goed signaal behoud capaciteiten en kan gemakkelijk worden verwijderd van de slide door spoelen in 1x PBS als het nodig is om dezelfde dia enkele kruisingen gebruikt.

Een eenvoudige versie van de FISH protocol is ontworpen voor hybridisatie van IGS rDNA probe op mitotische chromosomen van Anopheles. Ribosomale genen in Anopheles weergegeven als een polymorfe cluster van genen op geslachtschromosomen 16. Een DNA probe in dit protocol wordt gelabeld met standaard PCR reactie door het toevoegen fluorescent gelabelde Cy3 of Cy5 dNTPs. Omdat het blokkeren van niet-specifieke hybridisatie van repetitieve DNA in euchromatine niet nodig is, zijn alle stappen met betrekking tot het gebruik van C 0 t DNA breuken weggelaten. In plaats daarvan worden chromosoompreparaten voorbehandeld met RNase voor het voorkomen van hybridisatie van de probe IGS rDNAde nucleolus. Chromosomen en de DNA probe gelijktijdig gedenatureerd door verhitting van de schuif met een probe in een hybridisatie-systeem bij 75 ° C gedurende 5 minuten. Hybridisatie en wassen in dit protocol zijn ook uitgevoerd met behulp van standaard condities voor FISH 12. Het resultaat van FISH wordt aangetoond in Figuur 4C: het polymorfisme van het IGS rDNA hybridisatie tussen twee X chromosomen duidelijk zichtbaar.

0 t 3
DNA concentratie ug / ul Opnieuw annealen, min
C 0 t 2 0,1 100
0,3 33
0,5 20
0,7 14
0,9 11
1 10
0,1 150
0,3 50
0,5 30
0,7 21
0,9 17
1 15

Tabel 1. DNA concentratie en opnieuw annealen tijden voor de bereiding van C 0 t2 en t3 C 0 fracties.

Figuur 1
Figuur 1 Fasen van de ID ontwikkeling in de 4e instar larve: A) een vroege "ronde vorm" stadium; B) een intermediair "ovale vorm" fase - optimaal voor het chromosoom voorbereiding; C) een laat stadium - niet geschikt voor chromosoom preparaten. . De posities van ID's zijn aangegeven met pijlen aan de ventrale zijde van de larvale thorax.

Figuur 2
Figuur 2 Stappen ID dissection: A) onthoofd larve (richting delen zijn aangegeven met pijlen), B) larven ontleed gut onder hypotonische oplossing behandeling (ID zwellen en bijna onzichtbaar) C) larven na Carnoy's oplossing toepassing (. ID's worden wit en duidelijk zichtbaar); D) ontleed-id's in Carnoy's oplossing. Posities van id's in larve zijn aangegeven met een asterisk.

Figuur 3
Figuur 3 verschillende kwaliteiten van chromosoom spreads: A) een perfecte chromosoom spread - ronde vorm van de cellen aantoont voldoende behandeling van de ID in hypotone oplossing, B) een perfect hypotonische behandeling - chromosomen iets undersquashed, C) een slechte chromosoom spread. - het resultaat vanonvoldoende hypotone behandeling geïndiceerd door ovale vorm van de cellen.

Figuur 4
Figuur 4. Voorbeelden van FISH met BAC klonen (A, B) en IGS rDNA (C) in de chromosomen van Ae. aegypti (A), Cx. quinquefasciatus (B) en An. gambiae (C). 1, 2 en 3 - zijn nummers van chromosomen, X - vrouwelijke geslachtschromosoom in An. gambiae.

Discussion

Nonfluorescent in situ hybridisatie op mitotische chromosomen muggen werd voor het eerst in 1990 door A. Kumar en K. Rai 17. In deze studie, 18S en 28S ribosomale DNA genen gekloneerd in een plasmide samen zijn geplaatst om de chromosomen van 20 soorten muggen. De DNA probe werd radioactief gelabeld en gehybridiseerd met de chromosomen van de hersenen ganglia. Tussen drie genera mug is een FISH techniek ontwikkeld alleen mitotische chromosomen van de cellijn van Ae. aegypti 10,18,19 en nog nooit is uitgevoerd op mitotische chromosomen van levende muggen. Onlangs hebben we een eenvoudige, robuuste techniek om hoogwaardige chromosoompreparaten van ID's van 4 e instar larven 9. Deze methode laat een groot aantal chromosomen te verkrijgen in een dia en universeel inzetbaar voor alle soorten muggen. De noodzaak om alleen larven, niet poppenwieg of volwassene stages van muggen, voor het prepareren van objectglaasjes is waarschijnlijk de enige beperking van de methode. De standaard FISH methode 12 werd geoptimaliseerd voor het gebruik van genomische BAC-kloon en IGS rDNA als probes voor de mitotische chromosomen van Aedes, Culex en Anopheles.

Naast deze specifieke toepassingen kan de FISH protocollen hier beschreven ook worden gebruikt voor andere doeleinden. De FISH protocol, dat C 0 t DNA breuken te blokkeren onspecifieke hybridisatie gebruikt, kan ook worden toegepast voor de hybridisatie van BAC klonen of andere grote DNA-fragmenten in heterochromatine regio Anopheles. Heterochromatine regio's zijn verrijkt met transposons en andere herhalingen, en probes uit deze regio's produceren normaal sterke achtergrond op de chromosomen 3. Met ongelabelde C 0 t DNA fracties helpt onspecifieke hybridisatie van de probe te reduceren tot de chromosomen. De eenvoudige versie van de FISH protocol kan worden gebruikt voor elke rDNA of repetitieve DNA probes op mitotische chromosomen van muggen en andere insecten. Daarnaast kan ook worden toegepast voor de hybridisatie van BAC kloon DNA in soorten met laag repetitieve DNA inhoud euchromatic gebieden zoals Anopheles of Drosophila. De hier voorgestelde protocol helpt zeer afgewerkte chromosoom gebaseerde genoom samenstellingen voor muggen verkrijgen en kan grofweg worden gebruikt voor verschillende toepassingen in cytogenetische andere groepen insecten.

Disclosures

Geen belangenconflicten verklaard.

Acknowledgments

Wij danken Sergei Demin en Tatyana Karamysheva voor hun hulp bij chromosoom voorbereiding en FISH op Anopheles. We danken ook David Severson voor het verstrekken van ons Aedes en Culex genomisch DNA BAC klonen en Melissa Wade voor het bewerken van de tekst. Dit werk werd ondersteund door twee subsidies van de National Institutes of Health: 1R21 AI88035-01 aan Maria V. Sharakhova en 1R21 AI094289-01 naar Igor V. Sharakhov.

Materials

Name Company Catalog Number Comments
MZ6 Leica stereomicroscope Leica VA-OM-E194-354 A different stereomicroscope can be used
Olympus CX41 phase microscope Olympus CX41 A different phase microscope can be used
Olympus BX61 fluorescent microscope Olympus BX61 A different fluorescent microscope can be used
ThermoBrite Slide Denaturation/Hybridization System Abbott Molecular 30-144110 Serves as a heating block and a humid chamber
Dissecting needles Fine ScienceTools 10130-10
Needle holders Fine Science Tools 26018-17
Dissecting scissors Fine Science Tools 15000-03
75x25 double frosted micro slides Corning 2949-75x25
22x22 mm microscope coverslips Fisher Scientific 12-544-10
Parafilm Fisher Scientific 13-374-10
Rubber Cement Fisher Scientific 50-949-105
Acetic acid Fisher Scientific A491-212
Alcohol 200 Proof Decon Laboratories 2701
Propionic acid Sigma-Aldrich 402907
Hydrochloric acid Fisher Scientific A144-500
Sodium citrate dihydrate Fisher Scientific S279-500
Sodium acetate trihydrate Fisher Scientific BP334-500
Potassium chloride Fisher Scientific BP366-500
EDTA Fisher Scientific S311-500
Tris base Fisher Scientific BP152-1
10x PBS Invitrogen P5493
10% NBF (neutral buffered formalin) Sigma-Aldrich HT501128
99% formamide Fisher Scientific BP227500
Dextran sulfate sodium salt Sigma-Aldrich D8906
20x SSC buffer Invitrogen AM9765
1 mM YOYO-1 iodide (491/509) solution Invitrogen Y3601
Antifade Prolong Gold reagent Invitrogen P36930
dATP, dCTP, dGTP, dTTP Fermentas R0141, R0151, R0161, R0171
Cy3-dUTP, Cy5-dUTP GE Healthcare PA53022, PA55022
BSA Sigma-Aldrich A3294
DNA Polymerase I Fermentas EP0041
DNase I Fermentas EN0521
S1 Nuclease Fermentas EN0321
Taq DNA Polymerase Invitrogen 18038-042
RNase Sigma-Aldrich 9001-99-4
Pepsin USB 9001-75-6
Salmon sperm DNA Sigma-Aldrich D7656
Nonidet-P40 (NP40) US Biological NC9375914
Qiagen Blood and Cell Culture Maxikit Qiagen 13362
Qiagen Large Construct Kit Qiagen 12462

DOWNLOAD MATERIALS LIST

References

  1. Sharakhov, I. V., Sharakhova, M. V. Chromosome Mapping Research Developments. Verrity, J. F., Abbington, L. E. Nova Science Publishers, Inc. (2008).
  2. Holt, R. A., et al. The genome sequence of the malaria mosquito Anopheles gambiae. Science. 298, 129-149 (2002).
  3. Sharakhova, M. V., et al. Update of the Anopheles gambiae PEST genome assembly. Genome biology. 8, R5 (2007).
  4. Campos, J., Andrade, C. F., Recco-Pimentel, S. M. A technique for preparing polytene chromosomes from Aedes aegypti (Diptera, Culicinae). Memorias do Instituto Oswaldo Cruz. 98, 387-390 (2003).
  5. Campos, J., Andrade, C. F., Recco-Pimentel, S. M. Malpighian tubule polytene chromosomes of Culex quinquefasciatus (Diptera, Culicinae). Memorias do Instituto Oswaldo Cruz. 98, 383-386 (2003).
  6. McAbee, R. D., Christiansen, J. A., Cornel, A. J. A detailed larval salivary gland polytene chromosome photomap for Culex quinquefasciatus (Diptera: Culicidae) from Johannesburg, South Africa. J. Med. Entomol. 44, 229-237 (2007).
  7. Nene, V., et al. Genome sequence of Aedes aegypti, a major arbovirus vector. Science. 316, 1718-1723 (2007).
  8. Arensburger, P., et al. Sequencing of Culex quinquefasciatus establishes a platform for mosquito comparative genomics. Science. 330, 86-88 (2010).
  9. Sharakhova, M. V., et al. Imaginal discs--a new source of chromosomes for genome mapping of the yellow fever mosquito Aedes aegypti. PLoS neglected tropical diseases. 5, e1335 (2011).
  10. Brown, S. E., et al. Toward a physical map of Aedes aegypti. Insect Mol. Biol. 4, 161-167 (1995).
  11. Steiniger, G. E., Mukherjee, A. B. Insect chromosome banding: technique for G- and Q-banding pattern in the mosquito Aedes albopictus. Can. J. Genet. Cytol. 17, 241-244 (1975).
  12. Garimberti, E., Tosi, S. Fluorescence in situ hybridization (FISH). Bridger, J. M., Volpi, E. V. Springer Science and Business Media. (2010).
  13. Methods in Anopheles Research [Internet]. The Malaria Research and Reference Reagent Resource Center. Atlanta, GA. Available from: http://www.mr4.org/Portals/3/Pdfs/ProtocolBook/MethodsAnophelesResearchV4c.pdf (2007).
  14. Scott, J. A., Brogdon, W. G., Collins, F. H. Identification of single specimens of the Anopheles gambiae complex by the polymerase chain reaction. The American journal of tropical medicine and hygiene. 49, 520-529 (1993).
  15. Trifonov, V. A., Vorobyeva, N. N., Rens, W. Fluorescence in situ hybridization (FISH). Leiehr, T. Spriger-Verlag. (2009).
  16. Collins, F. H., et al. A ribosomal RNA gene probe differentiates member species of the Anopheles gambiae complex. The American journal of tropical medicine and hygiene. 37, 37-41 (1987).
  17. Kumar, A., Rai, K. S. Chromosomal localization and copy number of 18S+28S ribosomal RNA genes in evolutionary diverse mosquitoes (Diptera, Culicidae). Hereditas. 113, 277-289 (1990).
  18. Brown, S. E., Knudson, D. L. FISH landmarks for Aedes aegypti chromosomes. Insect Mol. Biol. 6, 197-202 (1997).
  19. Brown, S. E., Severson, D. W., Smith, L. A., Knudson, D. L. Integration of the Aedes aegypti mosquito genetic linkage and physical maps. Genetics. 157, 1299-1305 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics