שתי שיטות לקביעת אדם תאי רירית הרחם סטרומה ראשיים מדוגמאות כריתת הרחם

* These authors contributed equally
Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

הקמת מערכות עיקריות של רירית הרחם סטרומה תא תרבות מדגימות כריתת רחם היא טכניקת ערך ביולוגית וצעד חיוני לקראת רודף מגוון רחב של מחקר שואף. כאן, אנו מתארים שתי שיטות המשמשות להקמת תרבויות סטרומה מרקמות של רירית הרחם שעברו כריתה כירורגית של חולים אנושיים.

Cite this Article

Copy Citation | Download Citations

Jividen, K., Movassagh, M. J., Jazaeri, A., Li, H. Two Methods for Establishing Primary Human Endometrial Stromal Cells from Hysterectomy Specimens. J. Vis. Exp. (87), e51513, doi:10.3791/51513 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

מאמצים רבים הוקדשו להקמת מערכות בתרבית תאים במבחנה. מערכות אלה נועדו לבנות מודל של מספר עצום של in vivo תהליכים. מערכות תרבית תאים הנובעות מדגימות של רירית הרחם אדם אינן יוצאי דופן. יישומים נעים בין תהליכים פיסיולוגיים מחזוריים רגילים לפתולוגיות של רירית הרחם כגון סרטן גינקולוגיות, מחלות זיהומיות, וליקויי פוריות. כאן, אנו מספקים שתי שיטות להקמת תאי סטרומה רירית הרחם עיקריים מדגימות כריתת רחם רירית הרחם שעברו כריתה בניתוח. השיטה הראשונה מכונה "שיטת הגירוד" ומשלבת גירוד מכאני באמצעות סכין כירורגית או גילוח ואילו בשיטה השנייה נקראת "שיטת טריפסין." שיטה זו האחרונה משתמשת בפעילות האנזימטית של טריפסין כדי לקדם את ההפרדה של תאים והעיקריים תא תולדה. אנו מדגימים המתודולוגיה צעד אחר צעד באמצעות תמונות ומיקרוסקופ דיגיטליים. אנחנו גם providדוגמאות דואר לאימות שורות תאי סטרומה רירית הרחם באמצעות תגובות כמותיים בזמן אמת שרשרת פולימרז (qPCR) וimmunofluorescence (IF).

Introduction

קורפוס הרחם האנושי מורכב משלוש שכבות, perimetrium (או serosa), myometrium, ורירית הרחם. הבחנה כל אחת משכבות אלה הוא צעד חשוב להקמת שורות תאים של רירית הרחם. Perimetrium הוא רוב השכבה החיצונית של הרחם ומורכב של תאים דקים, הצפק. Myometrium הוא השכבה העבה, באמצע של הרחם ומורכב מתאי שריר חלק. רירית הרחם מזוהה כשכבה הפנימית של הרחם וכולל אוכלוסיות האפיתל ותאים סטרומה.

רירית הרחם הוא מחולק חלוקה נוספת לשכבת basalis גזע שאוכלוסיית תאי השערה היא לאכלס מחדש את שכבת functionalis בערך כל 28 ימים 1. שכבת functionalis של רירית הרחם האנושית עוברת שינויים ביוכימיים ומורפולוגיים משמעותיים בתגובה למחזור הורמונים. הורמונים אלה נגזרים מבלוטת יותרת המוח והשחלות.

ייצור מתואם ופרסום תוצאות הורמונים במחזור רבייה. מחזור הרבייה נועד להכין את רירית הרחם לאירועי השרשת עובר פוטנציאליים. בבני אדם, מחזור הרבייה ידוע בשם "המחזור החודשי" ומחולק לשלושה שלבים - שגשוג, הפרשה, ווסת. שלב השגשוג כרוך ההתפשטות של שכבת רירית הרחם functionalis ואילו שלב ההפרשה מתאפיין בהבשלת functionalis. באופן ספציפי, שינויים תאיים, הפרשות, והתמיינות תאים לאותת השתלה פוטנציאלית. אם השתלה אינה מתרחשת לפני תום שלב ההפרשה, שכבת רירית הרחם functionalis נשפכה במהלך שלב הווסת. חשיבותה של וסת והאירועים המפעילים את שפיכת שכבת functionalis הם עדיין נדונה. בבני אדם, זה כבר מציב כי וסת היא התוצאה של אירוע אמצע הפרשה בידול שלב מסוים ידועכ" decidualization הספונטני "2. בכתב יד זה, אנו מספקים מתודולוגיה מפורטת לשתי שיטות בידוד תא סטרומה רירית הרחם, ולהשתמש בשילוב של immunofluorescence ותמונות דיגיטליות להדגים את היעילות של גישות אלה. בנוסף, אנו מיישמים את השימוש נפוץ במודל חוץ גופית של decidualization הספונטני כדי לאשר בידוד תא סטרומה רירית הרחם.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

דגימות כריתת רחם בשימוש בכתב היד הזה נאספו הקונקורדנציה עם פרוטוקול אתיקה אישר-IRB האוניברסיטה הממוספר # IRB-HSR 14424.

1. רכישה לדוגמא ממקור קליני

  1. השג ממשלה וקווים מנחים אתיים המבוסס על מוסד ותיעוד אישור לפני תחילת.
  2. לנהל את כל השלבים בתנאים סטריליים.
  3. לשמר רקמה שמקורם בחולה בתקשורת (RPMI או DMEM / גבוה גלוקוז) בצינור 50 מיליליטר ב 4 ° C, אם המדגם לא יכול להיות מעובד בתרבות באופן מיידי. דוגמאות ניתן לאחסן במצב זה לתקופה מקסימלית של 24 שעות.
  4. שטוף דגימת רקמה שלוש פעמים עם בופר פוספט סטרילי 1X (PBS) ולהשליך את הפתרון בין שוטף.

2. הכנה של שורות תאים ראשוניות בשיטת האוספות

  1. הוספת 4-10 מיליליטר של תקשורת צמיחה (RPMI או DMEM / גלוקוז גבוהה בתוספת 10% שור סרום עוברי ו -1% פניצילין, streptomyCIN) לרקמות ולהוסיף Fungizone (0.25 מיקרוגרם / מיליליטר בריכוז סופי) ל30 דקות.
  2. מחק את תקשורת הצמיחה.
  3. שטוף רקמה פעמיים עם 1X PBS.
  4. מניחים את הרקמה על צלחת תרבית תאי 6 סנטימטר להבחין בין myometrium ושכבות רירית הרחם (ראה איורים 2 א-2C לתיאור נוסף). הפרד את רירית הרחם.
  5. באמצעות להב סכין מנתחים או סכין גילוח, ויחצה את הרקמה לחתיכות קטנות תוך מגרד על צלחת תרבית תאי 6 סנטימטר. סריטות אלה להקל על ההתקשרות של תאי רירית הרחם העיקריים המתעוררים. בהשוואה לשיטת טריפסין, יש צורך יותר רקמה (ראה איור 2 ד לקירוב).
  6. בעדינות, להוסיף 2 מיליליטר של תקשורת צמיחה לצלחת שרוטה (שברי רקמה יהיו גלויים ומשותק באופן אידיאלי מתנועת הגירוד).
  7. העבר את הצלחת (ים) לחממה ייעודית תרבית תאים (37 מעלות צלזיוס, 5% CO 2). לייעד מקום לשורות תאים ראשוניים, מן othאה מנות תרבות תא. תרבויות עיקריות הן רגישות יותר להידבקות וזיהום.
  8. לבחון את התאים תחת מיקרוסקופ אור יומי. אוכלוסיות קטנות של תאים צריכים להופיע ביום שניים או שלושה מרחבי הרקמות הפרוסים (ראו איור 3 ב).
  9. כדי לשמור על תרבויות, לשטוף בעדינות עם 1X PBS ולהוסיף תקשורת טרי צמיחה (2ml) כל שלושה ימים. כאשר העלאות ריבית התפשטות, מדיה נוספת צמיחה (3-4 מיליליטר) ניתן להוסיף לצלחת 6 סנטימטר התרבות (ים).
    הערה: במהלך שינויי כביסה ותקשורת, חתיכות של רקמות צפויות להישאף. זו לא תשפיע על צמיחה של תאים חסיד. חתיכות של רקמה צריכה להישאף על ידי השלב שלאחר מכן (2.10) כמושבות חדשות צפויים לצאת אחרי שבוע אחד.
  10. כאשר צלחת 6 סנטימטר היא כ 75 - מחוברות 80% (ראה איור 3 ב), מעבר באמצעות טריפסין 0.05%. לא ניתן passaged תאים ראשוניים ללא הגבלת זמן - להקפיא את צלחת אחד מתאים בהקדם שתיים או שלוש צלחות הן maintained. אם יותר קטעים נדרשים, בצע את פרוטוקול הנצחה (הנסקרת ב נ"צ 3).

3. הכנה של שורות תאים ראשוניות בשיטת טריפסין

  1. מניחים פיסה קטנה של רקמת רירית הרחם (ראה איור 2 ד לקירוב) ב 2 מיליליטר של טריפסין 0.25% בתוספת Kanamycin (0.03 מ"ג / מיליליטר בריכוז סופי).
  2. דגירה רקמה על 37 מעלות צלזיוס במסתובבת פלטפורמה ל30 דקות.
  3. בקצרה מערבולת הרקמות.
  4. צנטריפוגה המדגם ב 200-400 XG במשך 2 דקות וזורקים supernatant.
  5. הוספת טריפסין הטרי וKanamycin.
  6. דגירה הרקמה על 37 מעלות צלזיוס בזמן מסתובב לשעה.
  7. מערבולת הרקמות ל5-10 שניות.
  8. הוספת 2ml של תקשורת צמיחה (בתוספת 10% שור סרום עוברי ו -1% פניצילין, סטרפטומיצין) כדי לבטל את טריפסין.
  9. תאי צנטריפוגה ב 200-400 XG במשך 2-3 דקות.
  10. בטל supernatant ולהוסיף 2 מיליליטר של לגדולתקשורת ה לתאי pelleted.
  11. צלחת על צלחת תרבית תאי 6 סנטימטר. מגרד את הצלחת כמו בשלב 2.5 של הכנת שורות תאים ראשוניות בשיטת האוספות הוא לא הכרחי, אבל משפר את הקובץ המצורף ותולדה של תרבויות עיקריות.
  12. לפקח על תאים תחת מיקרוסקופ אור יומי. תאים הם בדרך כלל גלויים תחת מיקרוסקופ אור לאחר 24-48 שעה (ראו איור 3 ג).
  13. כדי לשמור על התרבויות, לפקח על התאים ולשנות את התקשורת בכל 2-3 ימים כמו בשלב 2.9.
  14. למעבר התאים, השתמשו 0.05% או 0.25% טריפסין כאשר תאים מגיעים confluency 75-80% (ראה איור 3 ג).

4. שמירת רקמות נוספות לניתוח בהקפאה (הצמד ופורמלין קיבוע)

  1. שטוף מדגם פעמיים עם 1X PBS.
  2. לשאוב הרבה נוזלים ככל האפשר.
  3. להקפאת הצמד, למקם את דגימת רקמת רירית הרחם בצינור 1.7 צנטריפוגות (ראה 2F דמויות ו2G). הנח את 1.7צינור צנטריפוגות בחנקן נוזלי ל10 שניות או עד שניתן לראות שהרקמה הקפיאה למטה.
    שים לב: יש להיזהר שלא לגעת בחנקן נוזלי ישירות בעת הכנת דגימות. דוגמאות ניתן לאחסן ב -80 ° C עד עיבוד או ניתוח נוסף.
  4. לקיבעון פורמלין, לחתוך פיסה קטנה של רקמת רירית הרחם (ראה איור 2H), ולצלול ב10% פורמלין אבץ שנאגרו. לאחר 24 שעות, להשליך פורמלין ולהוסיף 70% אתנול לדגימות רקמה ועד עיבוד נוסף.

5. Immunofluorescence (IF)

  1. קיבוע תא
    1. הכן את התאים בשקופית תרבות או צלחת.
    2. בעדינות, לשטוף תאים עם 1X PBS.
    3. הוספת מתנול טרום צונן (4 מעלות צלזיוס) ואצטון (מעורבב ביחס של 1:1) במשך 5 דקות.
    4. אוויר יבש השקופית לפני שתמשיך. שקופית יכולה להיות מאוחסן על 4 מעלות צלזיוס במשך 1-2 שבועות במידת צורך.
  2. עיבוד IF
    1. רעננות תאים עם 1X PBS עבור 10 דקות. עבור עבורllowing שלבי 1-6, לנהל את כל הכביסות וincubations על פלטפורמה מסתובבת.
    2. בלוק באמצעות 1X PBS בתוספת 1% הסרום אלבומין שור (BSA) וסרום מיני 1% ספציפיים (מקור 2 nd נוגדן) ל30 דקות בטמפרטורת חדר (RT).
    3. דגירה בנוגדן ראשוני (ראה המלצות יצרנים לדילולי נוגדנים). מתייחס לחומרים לנוגדנים ספציפיים. לדלל את הנוגדן הראשוני במאגר חסימה טרי כמו בשלב 5.2.2. דגירה זה יכול להתנהל במשך לפחות שעה 2 ב RT או הלילה ב 4 ° C.
    4. לשטוף 3 פעמים עם 1X PBS במשך 5 דקות כל אחד.
    5. דגירה בנוגדנים משני (ראה המלצות יצרנים לדילולי נוגדנים). לדלל את הנוגדנים משני במאגר חסימה טרי כמו בשלב 5.2.2. כדי למנוע צילום הלבנה, חשוב לנהל את זה, והשלבים הבאים בהיעדר האור.
    6. לשטוף 3 פעמים עם 1X PBS במשך 5 דקות כל אחד.
    7. Thoroughly לייבש את השקופיות.
    8. הוסף מדיה גוברת ופתרון counterstaining DAPI.
    9. החל coverslip וסוגר את הקצוות באמצעות איטום (ים). שקופיות ניתן לאחסן ב 4 ° C בחושך עד 2 שבועות.

6. RNA חילוץ

  1. גלולה 1 x 10 7 תאים על ידי צנטריפוגה. כל החומרים וחומרים כימיים בפרוטוקול זה צריכים להיות RNase חינם.
  2. תאי Lyse במגיב 1 Trizol מיליליטר, דגירה הדגימות הומוגני ל10 דקות בטמפרטורת חדר כדי להשלים את הניתוק של מתחמי nucleoprotein.
  3. הוסף 200 μl של כלורופורם לכל 1 מיליליטר של Trizol. לנער במרץ ביד ל15 שניות ודגירה של 2-3 דקות ב RT.
  4. צנטריפוגה במהירות המרבית (15,000 XG) במשך 15 דקות ב 4 ° C. שלוש שכבות יגרמו.
  5. מעביר את השלב מימיים העליון לתוך צינור microcentrifuge טרי. הוספת גליקוגן μl 1 כדי להגדיל את תשואת RNA; עם זאת, צעד זה הוא הכרחי רק כאשר קטןכמות הרנ"א צפויה.
  6. הוסף 0.5 מיליליטר של אלכוהול לשכבה המימית, ולהפוך את הדגימות 3-5 פעמים. דגירה דגימות ב RT עבור 10 דקות. כדי להגדיל את התשואה, ניתן להציב דגימות ב-20 ° C או -80 מעלות צלזיוס למשך 30 דקות.
  7. צנטריפוגה במהירות המרבית ל10 דקות ב 4 ° C.
  8. בשלב זה, גלולה קטנה של RNA צריכה להיות גלויה. בטל supernatant.
  9. שטוף את RNA עם 1 מיליליטר של 75% אתנול.
  10. צנטריפוגה במהירות המרבית למשך 5 דקות וזורקים supernatant. ניתן לכבס דגימות פעם נוספת ללהיפטר מזהמים אורגניים, אך צעד זה אינו הכרחי.
  11. בקצרה, לייבש את גלולה RNA עד RNA גלולה היא יבשה (בדרך כלל לוקח 7-10 דק ').
    הערה: צעד נוסף אחד יכול להשתמש בו כדי להקטין את העניין אורגני ולצמצם את זמן ייבוש. לאחר השלכת supernatant מלשטוף אתנול, דגימות ספין במהירות המרבית למשך דקה נוספת ונוזל שיורי לשאוב. שים לב שלא לשאוב גלולה.
  12. לפזר RNA במי RNase ללא, תלוי בגודל של גלולה RNA. כרכים בדרך כלל נעים 10-50 μl.
  13. דגירה דגימות ב55 מעלות צלזיוס למשך 10 דקות, ולמדוד את הריכוז של רנ"א.
  14. דגימות חנות ב -20 ° C עד עיבוד נוסף.

7. הפוך תמלול

  1. להביא את RNA המדגם (1-3 מיקרוגרם) בהיקף של 9 μl עם H 2 O.
  2. RNA חום ל70 מעלות צלזיוס למשך 10 דקות.
  3. כדי ליצור תערובת הורים AMV, לשלב את ריאגנטים הבאים: 5 μl של dNTP (ריכוז עבודה של 50 מיקרומטר), 5 μl של oligos N6-DNA (ריכוז עבודה של 80 מיקרומטר), 5 μl של חיץ 5X AMV, וμl 1 של AMV . פתרון תערובת אמן זה נועד לדגימה אחת.
  4. הוספת 16 μl של מיקס מאסטר RNA המחומם. סופי עוצמת התגובה תהיה 25 תגובת μl.
  5. השתמש בתנאים הבאים PCR לשעתוק לאחור: (השלב ​​1) C ° 42 ל90 דקות, (STAge 2) 95 מעלות צלזיוס למשך 5 דקות, ו( שלב 3) 4 ° C עד עיבוד נוסף.

8. Time PCR נדל

  1. לנהל PCR תגובות באמצעות פריימרים, טמפרטורות חישול, מספרי מחזור, וחומרים כימיים הנמצאים בטבלה 1.
    שים לב: הוא אידיאלי לעקוב אחר הוראות יצרן בעת שימוש בחומרים כימיים PCR (מתייחס למספרי חברה וקטלוג בחומרים).

9. במבחנה Decidualization Protocol (נגזר 4 Ref ו5)

  1. פלייט תאי רירית הרחם.
  2. לגדול confluency של 75-85%.
  3. לאחר התאים הופכים מחוברות, לשטוף פעם אחת עם 1X PBS.
  4. במהירות, להוסיף מדיה ללא הורמון (RPMI בחינם פנול בתוספת 5% FBS רצועת פחם ו -1% פניצילין, סטרפטומיצין).
  5. לאחר 24 שעות, להוסיף מדיה הורמון חופשי בתוספת אצטט medroxyprogesterone (MPA) בריכוז סופי של 1 מיקרומטר ו8-bromoadenosine 3 ', 5'monophosphate מחזורי (cAMP) בריכוז סופי של 0.5 מ"מ.
  6. אחרי לפחות 48 שעות, לעצור את התגובה ולשמור את הצלחת (ים) לעיבוד נוסף.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

כפי שהודגש בסעיף הפרוטוקול, כדי להיות בטוח לנהל את כל השיטות תחת ממשלתי, מוסדיות, וקווים המנחים אתיים בעת טיפול והכנת רקמה אנושית.

בכתב היד הזה כלול הוא איור של זרימת העבודה הכללית של "שיטת הגירוד" (איור 1 א) ואת "שיטת טריפסין" (איור 1) המשמשת להקמת תרבויות רירית הרחם ראשונית. שיטות אלה מתוארות בפירוט בסעיף הפרוטוקול (ראה חלקים - 1. 3.). שני השיטות להוכיח מוצלחות בצמיחה של רירית הרחם תרבויות עיקריות. היתרון ל" שיטת הגירוד "הוא זמן ההכנה מתקצר; עם זאת, הזמן שנדרש כדי לבחון תאי קיימא הוא בדרך כלל 2 - 4 פעמים יותר בהשוואה ל" שיטת טריפסין. "

סיפקו הם תמונות דיגיטליות של הרקמה האנושית הראשונית שהתקבלה מרכש רקמות. ניתן להבחין בין שכבות הרחם על ידיגסות של השכבה, כלומר myometrium היא עבה ושרירי ורירית הרחם דק ומניב יותר. יש לנו הדגיש את השכבה העבה, שריר החלק (myometrium) בלבן והתוויתי את שכבת רירית הרחם של עניין בשחור משני מדגמים שונים כריתת רחם (2A דמויות ו2B). באיור 2C, רקמות מכוונים עם myometrium פונה כלפי מעלה ואילו רירית הרחם נמצא בעמדה כלפי מטה. השכבה דקה, perimetrial הייתה לכרות את הגידול בניתוח ולא מודגש בתמונות הללו. כמו כן, חשוב לציין כי בגודל של השכבה של רירית הרחם בתמונות 2 ממדים הדיגיטליים אלה הוא מצג שווא כמו השכבה 3 ממדים בפועל היא דקה מאוד בהשוואה לmyometrium.

חיתוך לגודל הרקמה המתאים הוא חשוב לשני "שיטת הגירוד" ו "שיטת טריפסין." באיור 2 ד, גדלים מתאימים מיועדים לכל אחת משיטות הנ"ל לדוגמא, בהתאמה. שימוש 0.5x0 אחדחתיכת סנטימטר x0.5 .5 עבור "שיטת טריפסין" [משמאל] היא מספיקה לביסוס תרבות. רקמת המוצא הנציג ל" שיטת הגירוד "[זכות] כוללת את כל שכבות הרחם. המוצר הסופי ל" שיטת הגירוד "מיוצג באיור 2E, ומומלץ שלפחות סנטימטר 1x1x1 של רקמת רירית הרחם ישמש להקמת תרבויות ובת קיימא. הדרישה לדגימת רקמה הרבה זה חסרון של "שיטת הגירוד".

רקמות שנותר משמשות לעתים קרובות בדרכים רבות, כולל חלבון ו-RNA מנתח. על מנת להבטיח שמירה על איכות רקמה, חשוב להשתמש בשיטה "הצמד ההקפאה", כמו בסעיף הפרוטוקול (ראה 4.). שיטה זו גם באיור 2F ואיור 2G. שמירת רקמות נוספות על ידי קיבוע פורמלין היא גם מנהג נפוץ של פתולוגים וחוקרים. רקמה מתכוננת לקיבעון פורמלין מתוארת בפרוטוקול באיור 2H.

במיקרוסקופ אור היא חיונית לניטור תרבויות רירית הרחם ראשונית. תאי סטרומה רירית הרחם אדם צריכים להפגין מורפולוגיה פיברובלסטים (איור 3 א). "שיטת הגירוד" בדרך כלל יוצרת אשכולות של תאים המתעוררים מוקדם, בעיקר לאורך סריטות נגרם אזמל (איור 3 ב, יום 2). "שיטת טריפסין" מייצרת גם אשכול ודפוסי צמיחת תאים מפוזרים (איור 3 ג, יום 4). יש לנו כלל כמה תמונות מייצגות מציפוי הראשוני (יום 0) לקטע הראשון של כל שיטה (איור 3B ו 3 ג).

רקמות רבות מוגדרות על ידי הביטוי שלהם סמני רקמות ספציפיות כמו שריר אקטין חלק (SMA) לשריר חלק, CD34 בתאי גזע חיסון, וכו 'בעוד ניסויי ביטוי גנים וחלבונים שנערכו לרירית הרחם 6-11, enסמן הספציפי של תאי סטרומה dometrial עדיין לא גילה. במקום זאת, חוקרים בדרך כלל להעריך את טוהר stroma רירית הרחם על ידי מדידת סמנים ממזהמי תא פוטנציאליים. לדוגמא, סמני cytokeratin משמשים להצגת אוכלוסיות אפיתל. עם זאת, הוא פחות דאגה, כי הקמת ואחזקת epithelia רירית הרחם הוא קשה ובדרך כלל נבחר נגד (Ref 12 ואיור 4 א). אם דגימות היו שיתקבל במהלך הריון, ביטוי חיובי של HLA-A,-B,-C מדגים חיידק, תאי trophoblast 13. מצד השני, כמו fibroblasts mesenchymal האחר, תאי סטרומה רירית הרחם לבטא vimentin (CDH1). אנו מדגימים עם immunofluorescence, הביטוי של vimentin והעדר cytokeratin וcadherin E (CDH1) בתאים שלנו הוקמו רירית הרחם סטרומה (איור 4).

לבסוף, אנו מספקים ראיות פונקציונליות של תרבות רירית הרחם העיקרית באמצעות i n המבחנה assay decidualization הספונטני. שיטה זו הותאמה מ4 Ref ו -5, וכרוך בטיפול בתרבויות עם שילוב של אצטט medroxyprogesterone (MPA) ו 8 - bromoadenosine 3 ', monophosphate 5'-מחזורי (cAMP) (תאר ב9 במבחנה Decidualization פרוטוקול ודגם. באיור 5 א). בנוכחותו של MPA וcAMP, תאי סטרומה רירית הרחם תערוכת פרופילים שונים באופן משמעותי ביטוי גנים (הנסקרת ב 14 Ref). סמני decidualization ספונטניים לעתים קרובות שפורסמו הם פרולקטין (PRL) וגורם גדילה דמוי אינסולין מחייב חלבון 1 (IGFBP1) (הנסקרת ב 14 Ref). התגובה של שני הגנים האלה כדי MPA וcAMP הן אינדיקטורים חזקים של שניהם decidualization הספונטני והקמה מוצלחת של תרבות סטרומה רירית הרחם. אנו מדגימים את זה באיור 5.

ther.within-page = "תמיד"> איור 1
איור 1. סכמטי של שתי שיטות בידוד רירית הרחם ראשוניות. () מדרגה 2.1-2.10 של שיטת הגירוד מוצגת בתרשים ארגוני. (ב ') מדרגה 3.1-3.14 של שיטת טריפסין מוצגת בתרשים ארגוני. לחץ כאן לצפייה בתמונה גדולה יותר.

איור 2
איור 2. עיבוד רקמות רחם. (AC) דגימות רחם קליניות משתי מטופלות. & C נגזרות מ1 החולה ובB נגזר 2 חולה. רקמה שעברה כריתה כירורגית של הרחם (משמאל) וhighlighteשכבות רחם ד (מימין). (A & B) myometrium הוא מוקף בעיגול לבן ורירית הרחם בשחור. (C) myometrium עומד בפני המצלמה. (ד ') לדוגמה גדלי רירית הרחם נציג ראשוניים עבור שני שיטות הבידוד מצוינים. שיטת טריפסין דורשת רירית הרחם טהורה לפני תוספת של טריפסין ואילו בשיטת הגירוד יכולה משתמשת בדגימות הרחם כולו. דוגמא (E) של המדגם של רירית הרחם מעובד של שיטת הגירוד. (F & G) תמונה של רקמת רחם שנותר בהכנה לצמד הקפאה. מוצג הוא מיכל מתכת מתוצרת מעבדה מנוצל לשיטה זו. קיבעון פורמלין של מדגם של רירית הרחם (H). לחץ כאן לצפייה בתמונה גדולה יותר.

איור 3 איור 3. תמונות במיקרוסקופ אור תרבויות רירית הרחם ראשוניות. . (א) נציג תמונות של תרביות תאי רירית הרחם סטרומה נלקחו בכוחות וconfluency שונים (ב ') נציג תמונות של שיטת הגירוד (ימים 0-16) נלקחים מאותו צלחת התרבות, מופעל ב10x הערה:. קווים חזותיים מצביעות על סריטות מ להב כירורגים (ג) נציג תמונות של שיטת טריפסין.. (ימים 0-16) נלקח מאותו צלחת התרבות, מופעל ב10x לחץ כאן לצפייה בתמונה גדולה יותר.

איור 4
איור 4. תמונות Immunofluorescence של תאי סטרומה רירית הרחם. Immunofluorescence ()של תרבויות העיקריות של רירית הרחם בודד באמצעות שיטת הגירוד. תמונות להפגין אובדן cytokeratin בין הקטע 2 (P2) וקטע 5 (P5). חלבון וקמיה פרומיילוציטית (PML) חלבון גרעיני ומכתים DAPI שימשו כקבוצת ביקורת. תמונות (ב ') להפגין מכתים חיובי עבור סמן mesenchymal vimentin. תמונות גם מראות מכתים שלילי עבור E cadherin (CDH1) וcytokeratin. מכתים את DAPI וחלבון פרומיילוציטית לוקמיה (PML) סופקו שולטת. לחץ כאן לצפייה בתמונה גדולה יותר.

איור 5
איור 5. Decidualization ספונטני של שני תאי סטרומה רירית הרחם ראשוניים. () תמציתי של הליך ניסיוני. (B) upregulation של פרולקטין (PRL) וגורם גדילה דמוי אינסולין עקידת חלבון 1 ביטוי גנים (IGFBP1) בתגובה לMPA ומחנה. תוצאות נמדדו באמצעות RT-qPCR, והביטוי היה מנורמל GAPDH. משמעות חושב באמצעות סטודנטים מבחן t (P <0.001 *** וP <0.0001 ****). שני שורות התאים היו מבודדות בשיטת הגירוד. לחץ כאן לצפייה בתמונה גדולה יותר.

תחל רצף חישול בטמפרטורה (° C) מחזורים Assay
פרולקטין (PRL) קדימה CATATTGCGATCCTGGAATGAGC 60 40 Sybrgreen
פרולקטין (PRL) הפוך TCCTCAATCTCTACAGCTTTGGA 60 40 Sybrgreen
חלבון קושר פקטור גדילה דמוי אינסולין 1 (IGFBP1)קדימה TCCTTTGGGACGCCATCAGTAC 60 40 Sybrgreen
1 היפוך מחייב חלבון גורם גדילה דמוי אינסולין (IGFBP1) GATGTCTCCTGTGCCTTGGCTA 60 40 Sybrgreen
GAPDH לא צוין (ראה רשימה מגיב) 60 40 TaqMan

טבלת 1. תנאי PCR לסמני decidualization.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

קבוצות אחרות שתיארו והותאמו המתודולוגיה להכנת תרבויות סטרומה רירית הרחם, שרובם לנצל collagenase 4,12,13,15-18. בכתב היד הזה, שאנו מספקים מתודולוגיה וראיות לשתי שיטות עיקריות פשוטות של רירית הרחם תרבות סטרומה, אשר שניהם מנוצלים על ידי המעבדה שלנו מסיבות כלכליות והזמינות הנוחה של טריפסין ו / או סכין גילוח.

כאשר משווים את שתי השיטות שלנו, הן ליצור בהצלחה תרבויות עיקריות קיימא. השיטה המועדפת שלנו היא שיטת טריפסין כמו שיש בדרך כלל תשואה גבוהה יותר עם דרישה קטנה יותר גודל מדגם. עם זאת, אם הזמן הכנה מוגבל, שיטת הגירוד דורשת 30 דקות ואילו תאי ציפוי בשיטת טריפסין לוקח יותר משעה וחצי.

כמו כן ראוי לציון הוא שאנחנו מדגימים שיטות אלה עם דגימות כריתת רחם בניגוד לביופסיות של רירית הרחם. יו רירית הרחםpsies נלקח ללא חדירה משמעותית ונוטה לייצר דגימות קטנות יותר. ובכל זאת, בשיטות המתוארות בכתב היד הזה (במיוחד בשיטת טריפסין) אמורות להניב תרבויות מביופסיות של רירית הרחם.

ישנם יישומים רבים עבור תאי סטרומה רירית הרחם ראשוניים. השוואה בין תרבויות סטרומה רירית הרחם מאדם לעומת יונקים אחרים עשויה לספק רמזים לשאלות שכבר התווכחו במשך מאות שנים על למה בני אדם הווסת. ישנם מחקרי פיזיולוגיה נחקרו אחרים שדורשים בתרבות חוץ גופית. עניין מיוחד הן התגליות המספקות תובנות לגבי אירועי מחזור רבייה כגון ממצאים שמצאו קשר בין אירועים מולקולריים אפיגנטיים לאירועים תפקודיים של מחזור הרבייה 19,20, 21, וסקרו ב11 Ref.

רופאים יפיקו תועלת רבה מלימוד תרבות סטרומה רירית הרחם וזיהוי סמנים ביולוגייםים במקרים של הפרעות בפוריות ומחל ממאירות סרטן. בין 2006 2010, דווח כי 7.4 מ'נשים ובני זוגן השתמשו בשירותי פוריות בארצות הברית 22. אחוז משמעותי של אי פוריות הוא בגלל הכישלון של decidualization 23. יתר על כן, הקשר בין מחלות של רירית הרחם כגון היפרפלזיה ואנדומטריוזיס לפוריות הוא רק לאחרונה מוערך. היכולת ללמוד סרטן גינקולוגי רחם דרך דוגמנות במבחנה היא גם לא יסולא בפז, כי למרות שסרקומה רירית הרחם המתקדמת היא נדירה, זה יכול להיות קטלני. על ידי הקמת בתרבויות עיקריות חוץ גופית, אנחנו לומדים את ההשפעה של האירועים המולקולריים הקשורים למחלות ויכולים ליצור יישומים קליניים משוערים.

לסיכום, יצירת נציג ויעיל במודלי vivo עבור רבים של יישומים אלה היא קשה. זה הופך את הפיתוח במבחנה תרבויות רירית הרחם עיקריות ללמוד כמה in vivo פונקציות קריטיות. שתי שיטות אלה רירית הרחם הבידוד, "שיטת הגירוד" ו "שיטת טריפסין," יעזרו לספק דריסת הרגל להבנת פיזיולוגיה והפתולוגיה רירית הרחם שלנו.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים אין לגילוי.

Acknowledgements

אנו מודים למאמצים המשותפים של ד"ר Thao דאנג וחברי המעבדה שלה לשימוש בציוד ההדמיה ומיקרוסקופ. אנו מודים גם Biorepository ומתקן רקמות מחקר ליבה (BTRF), ג'ף הרפר, והתושבים באוניברסיטת וירג'יניה שספק לנו רקמת רחם. אנו מודים קרול ה"שלאכטה לעזרה עם סכמטי סקירה.

Materials

Name Company Catalog Number Comments
0.25 Trypsin or 0.05% Trypsin  Hyclone SH3023602 or SH30004202
1.7 micro Centrifuge Tube   Genesee Scientific 22-272A
1 µl, 20 µl, 200 ml and 1,000 µl Pipette   Genesee Scientific 24-401,24-402, 24-412, 24-430
15 ml Conical Tube  Hyclone 339650
50 ml Conical Tube  Hyclone 339652
6 cm Cell Culture Dish  Thermo scientific 12-556-002
8 well Chambers  Thermo Scientific AB-4162
Acetate  Fisher scientific C4-100
AMV RT Enzyme/Buffer  Bio Labs M077L
Bovine Serum Albumin (BSA)  Fisher Scientific BP-1605-100
Buffered Zinc Formalin  Thermo 59201ZF
Charcoal strip FBS  Fisher NC9019735
Chloroform  Fisher Scientific BP1145-1
Cover slip  Fisher Brand 12-544D
Cyclic AMP (cAMP)  Sigma B7880
DMEM/High Glucose  Hyclone SH30243FS
dNTP  Bioline BIO-39025
Donkey Anti Goat -TRITC  Santa Cruz SC-3855
Donkey Serum  Jackson’s lab 017-000-002
E Cadherin Antibody   Epitomics 1702-1
Ethanol  Fisher Scientific BP2818-1
Fetal Bovine Serum (FBS)  Fisher Scientific 03-600-511
Fungizone Amphotericin B  Gibco 15290-018
GAPDH Probe  Life Technologies HS99999905
Glycogen  5Prime 2301440
Goat Anti Mouse - FITC  Jackson’s Lab 115-096-003
Isopropanol  Fisher Scientific BP2618-1
Kanamycin   Fisher Scientific BP906-5
Medroxyprogesterone acetate (MPA)  Sigma M1629
MeOH (Methanol)  Fisher Scientific A4-08-1
Mounting Media (w/DAPI)  Vector Labratories H-1500
N6 DNA Oligos  Invitrogen
Number 15 Scraper   BD 371615
Pan Cytokeratin  Mouse mAB  Cell Signaling 4545
PBS (phosphate buffered saline)  Fisher Scientific BP-399-4
Penicillin-Streptomycin Glutamine Solution 100X   Hyclone SV30082.01
PML Anti Goat Anti body  Santa Cruz SC-9862
Primer(s)  Eurofins
RPMI  Hyclone SH30027FS
RPMI (Phenol free)  Gibco 11835
Sybr Green   Thermo Scientific AB-4162
Taqman  Thermo AB-4138
Trizol  Life Technologies 15596018
Vimentin Antibody  Epitomics 4211-1

DOWNLOAD MATERIALS LIST

References

  1. Heller, D. in The endometrium: a clinicopathologic approach. Heller, D. 56-75 (1994).
  2. Emera, D., Romero, R., Wagner, G. The evolution of menstruation: a new model for genetic assimilation: explaining molecular origins of maternal responses to fetal invasiveness. Bioessays. 34, 26-35 (2011).
  3. Gudjonsson, T., Villadsen, R., Ronnov-Jessen, L., Petersen, O. W. Immortalization protocols used in cell culture models of human breast morphogenesis. Cell Mol Life Sci. 61, 2523-2534 (2004).
  4. Brosens, J. J., Hayashi, N., White, J. O. Progesterone receptor regulates decidual prolactin expression in differentiating human endometrial stromal cells. Endocrinology. 140, 4809-4820 (1999).
  5. Jones, M. C., et al. Regulation of the SUMO pathway sensitizes differentiating human endometrial stromal cells to progesterone. Proc Natl Acad Sci U S A. 103, 16272-16277 (2006).
  6. Salamonsen, L. A., et al. Proteomics of the human endometrium and uterine fluid: a pathway to biomarker discovery. Fertil Steril. 99, 1086-1092 (2013).
  7. Haouzi, D., Dechaud, H., Assou, S., De Vos, J., Hamamah, S. Insights into human endometrial receptivity from transcriptomic and proteomic data. Reprod Biomed Online. 24, 23-34 (2012).
  8. Chen, J. I., et al. Proteomic characterization of midproliferative and midsecretory human endometrium. J Proteome Res. 8, 2032-2044 (2009).
  9. Talbi, S., et al. Molecular phenotyping of human endometrium distinguishes menstrual cycle phases and underlying biological processes in normo-ovulatory women. Endocrinology. 147, 1097-1121 (2006).
  10. Punyadeera, C., et al. Oestrogen-modulated gene expression in the human endometrium. Cell Mol Life Sci. 62, 239-250 (2005).
  11. Ponnampalam, A. P., Weston, G. C., Susil, B., Rogers, P. A. Molecular profiling of human endometrium during the menstrual cycle. Aust N Z J Obstet Gynaecol. 46, 154-158 (2006).
  12. Zhang, L., Rees, M. C., Bicknell, R. The isolation and long-term culture of normal human endometrial epithelium and stroma. Expression of mRNAs for angiogenic polypeptides basally and on oestrogen and progesterone challenges. J Cell Sci. 108, (1), 323-331 (1995).
  13. Richards, R. G., Brar, A. K., Frank, G. R., Hartman, S. M., Jikihara, H. Fibroblast cells from term human decidua closely resemble endometrial stromal cells: induction of prolactin and insulin-like growth factor binding protein-1 expression). Biol Reprod. 52, 609-615 (1995).
  14. Gellersen, B., Brosens, J. Cyclic AMP and progesterone receptor cross-talk in human endometrium: a decidualizing affair. J Endocrinol. 178, 357-372 (2003).
  15. Marsh, M. M., Hampton, A. L., Riley, S. C., Findlay, J. K., Salamonsen, L. A. Production and characterization of endothelin released by human endometrial epithelial cells in culture. J Clin Endocrinol Metab. 79, 1625-1631 (1994).
  16. Siegfried, J. M., Nelson, K. G., Martin, J. L., Kaufman, D. G. Histochemical identification of cultured cells from human endometrium. In Vitro. 20, 25-32 (1984).
  17. Rawdanowicz, T. J., Hampton, A. L., Nagase, H., Woolley, D. E., Salamonsen, L. A. Matrix metalloproteinase production by cultured human endometrial stromal cells: identification of interstitial collagenase, gelatinase-A, gelatinase-B, and stromelysin-1 and their differential regulation by interleukin-1 alpha and tumor necrosis factor-alpha. J Clin Endocrinol Metab. 79, 530-536 (1994).
  18. Dimitriadis, E., Robb, L., Salamonsen, L. A. Interleukin 11 advances progesterone-induced decidualization of human endometrial stromal cells. Mol Hum Reprod. 8, 636-643 (2002).
  19. Sakai, N., et al. Involvement of histone acetylation in ovarian steroid-induced decidualization of human endometrial stromal cells. J Biol Chem. 278, 16675-16682 (2003).
  20. Logan, P. C., Ponnampalam, A. P., Steiner, M., Mitchell, M. D. Effect of cyclic AMP and estrogen/progesterone on the transcription of DNA methyltransferases during the decidualization of human endometrial stromal cells. Mol Hum Reprod. 19, 302-312 (2013).
  21. Tamura, I., et al. Induction of IGFBP-1 expression by cAMP is associated with histone acetylation status of the promoter region in human endometrial stromal cells. Endocrinology. 153, 5612-5621 (2012).
  22. American Society for Reproductive Medicine: Quick facts about infertility. Available from: http://www.asrm.org/detail.aspx?id=2322 (2013).
  23. Salker, M., et al. Natural selection of human embryos: impaired decidualization of endometrium disables embryo-maternal interactions and causes recurrent pregnancy loss. PLoS One. 5, (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics