Dois métodos para estabelecer células endometriais Humano estromais primários de espécimes de histerectomia

* These authors contributed equally
Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Estabelecimento de sistemas de cultura primária de células do estroma endometrial a partir de espécimes de histerectomia é uma técnica biológica valioso e um passo crucial antes de prosseguir uma vasta gama de pesquisa objetiva. Aqui, descrevemos dois métodos utilizados para estabelecer culturas de tecidos do estroma endometriais ressecados cirurgicamente de pacientes humanos.

Cite this Article

Copy Citation | Download Citations

Jividen, K., Movassagh, M. J., Jazaeri, A., Li, H. Two Methods for Establishing Primary Human Endometrial Stromal Cells from Hysterectomy Specimens. J. Vis. Exp. (87), e51513, doi:10.3791/51513 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Muitos esforços têm sido dedicados a estabelecer em sistemas de cultura de células in vitro. Estes sistemas são concebidos para modelar um vasto número de processos in vivo. Sistemas de cultura de células resultantes de amostras endometriais humanos não são excepção. As aplicações vão desde processos fisiológicos normais cíclicos de patologias endometriais, tais como cancros ginecológicos, doenças infecciosas, e deficiências na função reprodutora. Aqui, oferecemos dois métodos para o estabelecimento de células estromais endometriais primários de espécimes ressecados cirurgicamente histerectomia endometriais. O primeiro método é referido como "o método de raspagem" e incorpora raspagem mecânica usando lâminas cirúrgicas ou de barbear ao passo que o segundo método é denominado "o método de tripsina." Este último método utiliza a actividade enzimática da tripsina para promover a separação de células e primário conseqüência celular. Nós ilustramos metodologia passo-a-passo através de imagens digitais e microscopia. Nós também provide exemplos para validar as linhas de células estromais do endométrio através de tempo real, as reacções em cadeia da polimerase quantitativa (qPCR) e imunofluorescência (IF).

Introduction

O corpo do útero humano é composto por três camadas, a perimétrio (ou serosa), miométrio e endométrio. Distinguindo cada uma destas camadas é um passo importante para estabelecer linhas de células do endométrio. O perimétrio é a camada mais exterior do útero e do composto, as células serosas finas. O miométrio é a espessura da camada, meio do útero e composta por células de músculo liso. O endométrio é identificada como a camada interna do útero e inclui populações epiteliais e células estromais.

O endométrio é subdividida na camada basal, cuja população de células-tronco é a hipótese de repovoar a camada functionalis aproximadamente a cada 28 dias 1. A camada functionalis do endométrio humano é submetido a alterações bioquímicas e morfológicas significativas na resposta a hormonas circulantes. Estas hormonas são derivados a partir da glândula pituitária e os ovários.

Oprodução coordenada e liberação de hormônios resulta em um ciclo reprodutivo. O ciclo reprodutivo é projetado para preparar o endométrio para potenciais eventos de implantação do embrião. Nos seres humanos, o ciclo de reprodução é conhecido como "ciclo menstrual" e divide-se em três fases - proliferativa, secretora, e menstruais. A fase proliferativa envolve a proliferação do endométrio functionalis camada enquanto que a fase de secreção está marcada por functionalis maturação. Especificamente, as alterações extracelulares, secreções e diferenciação celular sinalizar uma implantação potencial. Se o implante não ocorrer antes do final da fase de secreção, a camada functionalis endométrio é eliminado durante a fase menstrual. A importância da menstruação e os eventos que provocam o desprendimento da camada functionalis ainda estão sendo debatidas. Nos seres humanos, tem-se colocado que a menstruação é o resultado de um evento específico mid-secretora diferenciação fase conhecidacomo "decidualização espontânea" 2. Neste manuscrito, nós fornecemos metodologia detalhada para ambos os métodos de isolamento de células do estroma endometrial, e usar uma combinação de imunofluorescência e imagens digitais para demonstrar a eficácia dessas abordagens. Além disso, foi aplicado um comumente utilizado em modelo in vitro de decidualização espontânea para confirmar o isolamento de células do estroma endometrial.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Espécimes de histerectomia utilizadas neste manuscrito foram coletadas em concordância com um protocolo de ética da Universidade IRB-aprovado numeradas IRB-HSR # 14424.

1. Aquisição de exemplo de origem clínica

  1. Obter governo e diretrizes éticas baseadas em instituições e documentação de aprovação antes de começar.
  2. Realizar todas as etapas condições estéreis.
  3. Preservar tecido derivado do paciente em meio (RPMI ou DMEM / Glucose alta) em um tubo de 50 ml a 4 ° C, se a amostra não pode ser processada em cultura imediatamente. As amostras podem ser armazenadas neste estado por um período máximo de 24 horas.
  4. Lavar amostra de tecido, três vezes com 1X tampão fosfato salino estéril (PBS) e descartar a solução entre as lavagens.

2. Preparação de linhas de células primárias, utilizando o Método de raspagem

  1. Adicionar 4-10 ml de meio de crescimento (RPMI ou DMEM / alto teor de glucose suplementado com 10% de soro fetal bovino e 1% de Penicilina-streptomycin) de tecido e adiciona Fungizona (0,25 ug / ml de concentração final) durante 30 min.
  2. Descartar o meio de cultura.
  3. Lavar o tecido duas vezes com 1X PBS.
  4. Colocar o tecido de uma placa de cultura de 6 centímetros de células para distinguir entre miométrio e endométrio camadas (ver as Figuras 2A-2C para uma descrição mais detalhada). Separa-se o endométrio.
  5. Usando uma lâmina de bisturi ou navalha, transecto o tecido em pedaços pequenos, enquanto arranhando sobre o prato de cultura de seis centímetros celular. Estes riscos facilitar a fixação das células endometriais primárias emergentes. Em comparação com o método de tripsina, é necessário mais do tecido (ver Figura 2D para uma aproximação).
  6. Gentilmente, adicionar 2 ml de meio de cultura para prato riscado (fragmentos de tecido será visível e idealmente imobilizado a partir do movimento coçar).
  7. Transferir a placa (s) para uma incubadora de cultura de células designada (37 ° C e 5% CO 2). Designar um lugar para as linhas de células primárias, longe de other placas de cultura de células. As culturas primárias são mais sensíveis para a infecção e contaminação.
  8. Examine as células sob um microscópio de luz por dia. Pequenas populações de células que surgem de dois dias ou de três em torno dos tecidos cortadas (ver Figura 3B).
  9. Para manter as culturas, lavar cuidadosamente com PBS 1X e adicionar o meio de crescimento fresco (2 mL) a cada três dias. Quando aumenta a taxa de proliferação, o meio de crescimento adicional (3-4 ml) pode ser adicionado à placa de cultura de 6 centímetros (s).
    Nota: Durante a lavagem e mídia alterações, pedaços de tecido provavelmente será aspirado. Isso não vai afetar o crescimento de células aderentes. Pedaços de tecido deve ser aspirado pelo passo subsequente (2,10) como novas colónias é improvável que emergem após uma semana.
  10. Quando a placa de 6 cm é cerca de 75 - 80% confluentes (ver Figura 3B), a passagem utilizando 0,05% de tripsina. Pilhas não podem ser passadas por tempo indeterminado - congelar baixo uma placa de células assim que duas ou três placas são maintained. Se forem necessárias mais passagens, siga um protocolo de imortalização (revisado em Ref 3).

3. Preparação de linhas celulares primárias utilizando o Método de tripsina

  1. Coloque um pequeno pedaço de tecido endometrial (ver Figura 2D para uma aproximação) em 2 ml de tripsina a 0,25% suplementado com canamicina (0,03 mg / ml de concentração final).
  2. Incubar tecido a 37 ° C na plataforma rotativa durante 30 min.
  3. Resumidamente vortex do tecido.
  4. Centrifugar a amostra a 200-400 x g durante 2 min e desprezar o sobrenadante.
  5. Adicionar tripsina fresco e Kanamycin.
  6. Incubar o tecido a 37 ° C durante a rotação durante uma hora.
  7. Vortex o tecido durante 5-10 seg.
  8. Adicionar 2 ml de meio de crescimento (suplementado com 10% de soro fetal bovino e 1% de penicilina-estreptomicina) para desactivar a tripsina.
  9. Células centrifugar a 200-400 g durante 2-3 min.
  10. Desprezar o sobrenadante e adicionar 2 ml de crescerª mídia para as células peletizadas.
  11. Placa para um prato de cultura de 6 centímetros de células. Raspar a placa como no Passo 2.5 de Preparação Lines célula primária utilizando o Método raspagem não é necessário, mas melhora a fixação e crescimento de culturas primárias.
  12. Monitorar as células em um microscópio de luz por dia. As células são geralmente visíveis ao microscópio de luz após 24-48 horas (Figura 3C).
  13. Para manter as culturas, monitorar as células e meios de mudar a cada 2-3 dias, como no passo 2.9.
  14. Para passagem, as células, utilizar 0,05% ou 0,25% de tripsina, quando as células atingem 75-80% de confluência (ver Figura 3C).

4. Salvando tecido extra para Análise (pressão congelamento e formalina Fixation)

  1. Lavar as amostras duas vezes com 1X PBS.
  2. Aspirar o máximo de líquido possível.
  3. Por pressão de congelamento, coloque amostra de tecido endometrial em um tubo de centrífuga de 1,7 (ver Figuras 2F e 2G). Coloque a 1,7tubo de centrífuga, em azoto líquido durante 10 segundos ou até que ele pode ser visto que o tecido foi congelado para baixo.
    Nota: Tenha cuidado para não tocar diretamente nitrogênio líquido durante a preparação de amostras. As amostras podem ser armazenadas a -80 ° C até processamento adicional ou análise.
  4. Para a fixação em formalina, corte um pequeno pedaço de tecido endometrial (ver Figura 2H), e submergir em 10% de formalina tamponada a zinco. Após 24 horas, descartar formalina e adicionar 70% de etanol para as amostras de tecido, até processamento posterior.

5. Imunofluorescência (IF)

  1. Fixação celular
    1. Prepare as células em um slide cultura ou prato.
    2. Delicadamente, lave as células com PBS 1X.
    3. Adicionar pré-arrefecida (4 ° C), metanol e acetona (misturadas a uma razão de 1:1) durante 5 min.
    4. O ar seco do slide antes de prosseguir. Slide pode ser armazenado a 4 ° C durante 1-2 semanas, se necessário.
  2. Processamento IF
    1. Rehidratar células com 1X PBS durante 10 min. Para o following Passos 1-6, realizar todas as lavagens e incubações em uma plataforma giratória.
    2. Bloco utilizando 1X PBS suplementado com 1% de Albumina de Soro Bovino (BSA) e 1% de espécies de soro específico (fonte de anticorpo 2 nd) durante 30 min à temperatura ambiente (RT).
    3. Incubar no anticorpo primário (ver recomendações do fabricante para diluições de anticorpos). Consulte Materiais para detecção de anticorpos específicos. Dilui-se o anticorpo primário em tampão de bloqueio fresco como no Passo 5.2.2. Esta incubação pode ser realizada por pelo menos duas horas à temperatura ambiente ou durante a noite a 4 ° C.
    4. Lavar 3 vezes com PBS 1X durante 5 minutos cada.
    5. Incubar no anticorpo secundário (ver recomendações do fabricante para diluições de anticorpos). Dilui-se o anticorpo secundário em tampão de bloqueio fresco como no Passo 5.2.2. Para evitar foto-branqueamento, é importante para a realização desta e os passos subsequentes na ausência de luz.
    6. Lavar 3 vezes com PBS 1X durante 5 minutos cada.
    7. Thoroughly secar os slides.
    8. Adicionar mídia de montagem e solução contracoloração DAPI.
    9. Aplicar lamela e selar as bordas com selante (s). As lâminas podem ser armazenadas a 4 ° C no escuro, durante cerca de 2 semanas.

6. Extração de RNA

  1. Granulado de 1 x 10 7 células por centrifugação. Todos os materiais e reagentes neste protocolo deve ser livre de RNase.
  2. Lisar as células em 1 ml de reagente TRIZOL, e incuba-se as amostras homogeneizadas durante 10 min à temperatura ambiente para completar a dissociação de complexos nucleoproteicos.
  3. Adicionar 200 ul de clorofórmio por cada 1 ml de TRIZOL. Agitar vigorosamente à mão por 15 segundos e incubar por 2-3 min à temperatura ambiente.
  4. Centrifugar a uma velocidade máxima (15000 xg) durante 15 minutos a 4 ° C. Três camadas vai resultar.
  5. Transferir a fase aquosa superior para um tubo de microcentrifugação fresco. Adicionar 1 mL de glicogénio para aumentar o rendimento de ARN; no entanto, esta etapa só é necessária quando uma pequenaquantidade de ARN é antecipado.
  6. Adicionar 0,5 ml de álcool isopropílico para a camada aquosa, e inverter as amostras 3-5 vezes. Incubar as amostras a temperatura ambiente durante 10 min. Para aumentar o rendimento, as amostras podem ser colocadas em -20 ° C ou -80 ° C durante 30 min.
  7. Centrifugar a uma velocidade máxima durante 10 minutos a 4 ° C.
  8. Neste ponto, uma pequena bola de ARN deve ser visível. Desprezar o sobrenadante.
  9. Lava-se a ARN com 1 ml de etanol a 75%.
  10. Centrifugar a uma velocidade máxima durante 5 minutos e descarta-se o sobrenadante. As amostras podem ser lavadas mais para eliminar contaminantes inorgânicos, uma vez, mas este passo não é necessário.
  11. Resumidamente, secar o sedimento de ARN ARN até pelota é seca (normalmente demora 7-10 min).
    Nota: Um passo adicional pode ser usada para diminuir a matéria inorgânica e diminuir o tempo de secagem. Após o descarte do sobrenadante da lavagem de etanol, as amostras de rotação à velocidade máxima por mais um minuto e aspirado líquido residual. Tome cuidado para não aspirar pelota.
  12. Dissolve-se o ARN em água livre de RNase, dependendo do tamanho do sedimento de ARN. Volumes variam tipicamente 10-50 ul.
  13. Incubar as amostras a 55 ° C durante 10 min, e medir a concentração de ARN.
  14. Armazenar as amostras a -20 ° C até posterior processamento.

7. Transcrição Reversa

  1. Traga o ARN da amostra (1-3 mg) com um volume de 9 mL com H 2 O.
  2. ARN de calor a 70 ° C durante 10 min.
  3. Para gerar uma mistura principal de AMV, combinar os reagentes seguintes: 5 ul de dNTPs (concentração de trabalho de 50 uM), 5 ul de oligonucleótidos de ADN de N6 (concentração de trabalho de 80 uM), 5 ul de tampão 5X AMV, e 1 ul de AMV . Esta solução master mix foi concebido por uma amostra.
  4. Adicionar 16 ul da mistura de base para a ARN aquecida. O volume de reacção final de 25 ul de reacção.
  5. Use as seguintes condições de PCR para a transcrição reversa: (fase 1), 42 ° C por 90 min, (STAge 2) 95 ° C durante 5 min, e (Fase 3) 4 ° C até posterior processamento.

8. PCR em Tempo Real

  1. Realizar as reacções de PCR utilizando os iniciadores, a temperatura de recozimento, números de ciclos, e os reagentes presentes no Quadro 1.
    Nota: É ideal para acompanhar as instruções do fabricante ao utilizar reagentes de PCR (consulte os números da empresa e catálogo de materiais).

9. In vitro decidualização Protocol (Derivado Ref 4 e 5)

  1. Placa células endometriais.
  2. Crescer até uma confluência de 75-85%.
  3. Após as células se tornam confluentes, lavar uma vez com 1X PBS.
  4. Rapidamente, adicionar mídia sem hormônio (fenol livre RPMI suplementado com 5% de carvão tira FBS e 1% de penicilina-estreptomicina).
  5. Após 24 horas, adicionar mídia da hormona livre suplementados com acetato de medroxiprogesterona (MPA), a uma concentração final de 1 uM e 8-bromoadenosine 3 ', 5'Monofosfato cíclico (cAMP), a uma concentração final de 0,5 mM.
  6. Depois de pelo menos 48 horas, parar a reacção e salvar a chapa (s) para posterior processamento.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Conforme enfatizado na seção de protocolo, não se esqueça de realizar todos os métodos sob governo, institucionais e diretrizes éticas ao manusear e preparar o tecido humano.

Incluídos neste manuscrito é uma ilustração do fluxo de trabalho geral de "o método de raspagem" (Figura 1A) e "o método de tripsina" (Figura 1B) utilizados para estabelecer culturas primárias de endométrio. Estes métodos são descritos em detalhe na secção de protocolo (ver as partes 1 -. 3.). Ambos os métodos de ser bem sucedida no crescimento de culturas primárias de endométrio. A vantagem a "o método de raspagem" é o tempo de preparação encurtado; no entanto, o tempo que leva para observar as células viáveis ​​é geralmente 2-4 vezes mais em comparação com o "Método de tripsina."

São fornecidas imagens digitais do tecido humano inicial recebeu de colheita de tecidos. As camadas uterinas podem ser distinguidos pelagrossura da camada, ou seja, o miométrio é espessa e muscular e do endométrio é fino e mais maleável. Destacamos a espessa camada, músculo liso (miométrio) em branco e delineou a camada endometrial de interesse em preto a partir de duas amostras diferentes de histerectomia (Figuras 2A e 2B). Na Figura 2C, os tecidos são orientados com o miométrio virado para cima, enquanto o endométrio é posicionado para baixo. A camada fina, perimetrial foi ressecada cirurgicamente e não destaque nestas imagens. Também é importante notar que o tamanho da camada endometrial nestas imagens 2-dimensionais digitais é deturpada como a camada 3-dimensional real é muito fina comparada com o miométrio.

Cortando o tamanho apropriado do tecido é importante tanto para a "o método de raspagem" e "o método de tripsina." Na Figura 2D, os tamanhos apropriados são designados para cada método acima da respectiva amostra. Usando um 0.5x00,5 x0.5 cm peça para "o método de tripsina" [left] é suficiente para o estabelecimento de uma cultura. O tecido representante de partida para "o método de raspagem" [direita] inclui todas as camadas uterinas. O produto final para "o método de raspagem" está representado na Figura 2E, e recomenda-se que, pelo menos, 1x1x1 cm de tecido endometrial ser utilizado para estabelecer culturas viáveis. O requisito para esta amostra de tecido muito é uma desvantagem de "o método de raspagem".

Tecido remanescente é muitas vezes usado de várias maneiras, incluindo proteínas e análises de RNA. Para garantir a preservação da qualidade do tecido, é importante usar um método de "estalo congelamento", como na seção Protocol (ver 4.). Este método também é ilustrada na Figura 2F e Fig. 2G. Salvando tecido extra pela fixação formol também é uma prática comum de patologistas e pesquisadores. Preparação de tecido para fixação em formalina é descrito no protocolo Figura 2H.

A microscopia de luz é essencial para monitorar culturas endometriais primários. As células estromais do endométrio individuais devem apresentar morfologia de fibroblastos (Figura 3A). "O método de raspagem" gera tipicamente aglomerados de células emergentes primeiros, principalmente ao longo de arranhões induzida por bisturi (Figura 3B, Dia 2). "O método de tripsina" gera tanto cluster e os padrões de crescimento de células dispersas (Figura 3C, dia 4). Estão incluídas várias imagens representativas da colocação inicial (dia 0) até à primeira passagem de cada um dos métodos (Figura 3B e 3C).

Muitos tecidos são definidos pela sua expressão de marcadores específicos de tecidos, tais como a actina de músculo liso (SMA) para o músculo liso, CD34 para células estaminais imunes, etc Apesar de experiências de expressão de genes e de proteínas têm sido conduzidos para o endométrio 6-11, uma casamarcador específico de células do estroma endometrial tem ainda a ser descoberto. Em vez disso, os pesquisadores comumente avaliar endometrial pureza estroma pela medição de marcadores celulares contaminantes potenciais. Por exemplo, marcadores de citoqueratina são usadas para mostrar as populações epiteliais. No entanto, é uma preocupação menor, porque o estabelecimento e manutenção do epitélio do endométrio são difíceis e geralmente selecionada contra (Ref 12 e Figura 4A). Se as amostras fossem obtidas durante a gravidez, a expressão positiva de HLA-A,-B,-C demonstra germinais, células trofoblásticas 13. Por outro lado, tal como outros fibroblastos mesenquimais, células estromais do endométrio expressão de vimentina (CDH1). Demonstramos com imunofluorescência, a expressão da vimentina e a ausência de citoqueratina e E caderina (CDH1) nas nossas células estromais do endométrio estabelecidos (Figura 4B).

Finalmente, fornecemos evidências funcionais da cultura endometrial primário através de um in vitro de decidualização espontânea. Este método foi adaptado do Ref. 4 e 5, e envolve o tratamento de culturas com uma combinação de acetato de medroxiprogesterona (MPA) e 8 - bromoadenosine 3 ', 5'-monofosfato cíclico (AMPc) (descrito em 9 in vitro decidualization protocolo e modelado. na Figura 5A). Na presença de MPA e cAMP, células estromais endometriais apresentam perfis de expressão gênica alteraram significativamente (revisada em Ref 14). Os marcadores decidualização espontâneas freqüentemente publicados são prolactina (PRL) e Insulin-like Growth Factor Binding Protein 1 (IGFBP1) (revisto em Ref 14). A resposta desses dois genes para MPA e cAMP são fortes indicadores de ambos decidualization espontânea e sucesso da criação de uma cultura de estroma endometrial. Demonstramos isso na Figura 5B.


Figura 1. Esquemática dos dois métodos de isolamento do endométrio primárias. (A) Os passos 2,1-2,10 do método de raspagem exibidas em um organograma. (B) Os passos 3,1-3,14 do método de tripsina exibidas em um organograma. Clique aqui para ver imagem ampliada.

Figura 2
Figura 2. Processamento de tecido uterino. amostras uterinas clínicos (AC) a partir de dois pacientes do sexo feminino. A e C são derivadas de um paciente e B é derivado a partir do Paciente 2. tecido cirurgicamente ressecado uterino (esquerda) e highlighted camadas uterinas (direita). (A & B) O miométrio é circulado em branco e do endométrio em preto. (C) O miométrio é frente para a câmera. (D) tamanhos endometriais representante inicial da amostra para ambos os métodos de isolamento são indicados. O método de tripsina requer endométrio puro antes da adição da tripsina ao passo que o método de raspagem pode utiliza os espécimes uterinos inteiras. (E) Exemplo de amostra do endométrio processada do método de raspagem. (F e G) de imagens de tecido uterino restante sendo preparado por snap Congelamento. Mostrado é um metal recipiente feito em laboratório utilizado para este método. (H) formalina fixação de amostra endometrial. Clique aqui para ver imagem ampliada.

Figura 3 Figura 3. Imagens de microscopia de luz de culturas primárias de endométrio. . (A) Imagens representativas de culturas de células estromais endometriais tomadas em vários poderes e de confluência (B) Imagens representativas do método de raspagem (dias 0-16), tomada da mesma placa de cultura, alimentado em 10x Nota:. Linhas visuais indicam riscos de lâmina cirúrgica (C) Imagens representativas do método de tripsina.. (dias 0-16) tiradas do mesmo prato de cultura, alimentado em 10x Clique aqui para ver imagem ampliada.

Figura 4
Figura 4. Imagens de imunofluorescência das células estromais do endométrio. (A) Imunofluorescênciade culturas primárias de endométrio isolado através do método de raspagem. Imagens mostram perda de citoqueratina entre passagem 2 (P2) e passagem 5 (P5). Proteína da leucemia promielocítica (PML) proteína nuclear e coloração com DAPI foram utilizados como controlos. (B) As imagens demonstram coloração positiva para o marcador mesenquimais vimentina. As imagens também mostram coloração negativa para E caderina (CDH1) e Cytokeratin. A coloração para DAPI e proteína leucemia promielocítica (PML) foram fornecidos como controles. Clique aqui para ver imagem ampliada.

Figura 5
Figura 5. Decidualização espontânea de duas células estromais do endométrio primárias. (A) Esquema de procedimento experimental. (B) Upregulation de prolactina (PRL) eInsulin-like Growth Factor Binding Protein 1 (IGFBP1) expressão gênica em resposta ao MPA e Camp. Os resultados foram medidos por meio de RT-qPCR, e a expressão foi normalizado para GAPDH. A significância foi calculado usando os estudantes o teste t (P <0,001 *** e P <0,0001 ****). Ambas as linhas de células foram isoladas pelo método de raspagem. Clique aqui para ver imagem ampliada.

Cartilha Seqüência Recozimento Temperatura (° C) Ciclos Ensaio
A prolactina (PRL) Encaminhar CATATTGCGATCCTGGAATGAGC 60 40 Sybrgreen
A prolactina (PRL) Reversa TCCTCAATCTCTACAGCTTTGGA 60 40 Sybrgreen
Proteína de ligação do fator de crescimento semelhante à insulina 1 (IGFBP1)Para a frente TCCTTTGGGACGCCATCAGTAC 60 40 Sybrgreen
Proteína de ligação do fator de crescimento semelhante à insulina 1 (IGFBP1) Reversa GATGTCTCCTGTGCCTTGGCTA 60 40 Sybrgreen
GAPDH Não especificado (ver lista de reagente) 60 40 Taqman

Tabela 1. Condições de PCR para marcadores decidualização.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Outros grupos descritos e adaptado metodologia para a preparação de culturas do estroma do endométrio, a maioria dos quais utilizam colagenase 4,12,13,15-18. Neste manuscrito, nós fornecemos metodologia e evidências para dois métodos de cultura de estroma endometriais simplificados primários, os quais são utilizados por nosso laboratório por razões económicas ea disponibilidade conveniente de tripsina e / ou uma lâmina de barbear.

Ao comparar os nossos dois métodos, ambos geram sucesso culturas primárias viáveis. O nosso método preferido é o método de tripsina como existe normalmente um rendimento mais elevado com um menor requisito de tamanho da amostra. No entanto, se o tempo de preparação é limitado, o método de raspagem requer 30 minutos ao passo que o plaqueamento de células usando o método de tripsina demora mais de uma hora e meia.

Também digno de nota é que demonstramos esses métodos com amostras de histerectomia ao invés de biópsias endometriais. Endometrial biopsies são tomadas sem intrusão significativa e tendem a produzir espécimes menores. Ainda, os métodos descritos neste manuscrito (especialmente o método de tripsina) deverá produzir culturas de biópsias do endométrio.

Existem numerosas aplicações para as células estromais do endométrio primárias. Comparando culturas estromais endometriais de humano contra outros mamíferos podem fornecer pistas para as questões que foram debatidas durante séculos sobre o porquê de os humanos menstruar. Existem outros estudos de fisiologia inexploradas que requerem cultivo in vitro. De particular interesse são as descobertas que fornecem insights sobre eventos do ciclo reprodutivo, como os resultados que ligaram eventos moleculares epigenéticas para os eventos funcionais do ciclo reprodutivo 19,20, 21 e revisada na Ref. 11.

Os médicos beneficiariam muito de estudar a cultura do estroma endometrial e identificar biomarcadoress nos casos de distúrbios reprodutivos e doenças malignas do câncer. Entre 2006 e 2010, foi relatado que 7,4 milhões de mulheres e seus parceiros utilizaram os serviços de infertilidade nos Estados Unidos 22. Uma percentagem significativa da infertilidade é devido a uma falha de decidualização 23. Além disso, a relação entre as doenças, tais como hiperplasia do endométrio e endometriose para a infertilidade é apenas recentemente a ser avaliada. A capacidade de estudar cânceres ginecológicos uterinos através in vitro modelagem também é inestimável porque apesar sarcoma endometrial avançado é rara, pode ser letal. Ao estabelecer em culturas primárias in vitro, estudamos o impacto dos eventos moleculares associados com as doenças e pode gerar aplicações clínicas putativos.

Em conclusão, gerando representativa e eficaz em modelos in vivo para muitas destas aplicações é difícil. Isso faz com que o desenvolvimento de emvitro de culturas primárias de endométrio para estudar diversas funções in vivo crítico. Estes dois métodos de isolamento do endométrio, "o método de raspagem" e "o método de tripsina," ajudará a fornecer o ponto de apoio para a nossa compreensão da fisiologia e patologia endometrial.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada a divulgação.

Acknowledgements

Agradecemos os esforços de colaboração do Dr. Dang Thao e membros de seu laboratório para o uso de seus equipamentos de imagem e microscópio. Agradecemos também a biorepository e Tissue Research Facility (BTRF) núcleo, Jeff Harper, e os moradores da Universidade de Virginia por nos fornecer o tecido uterino. Agradecemos Karol Szlachta pela ajuda com esquemática Overview.

Materials

Name Company Catalog Number Comments
0.25 Trypsin or 0.05% Trypsin  Hyclone SH3023602 or SH30004202
1.7 micro Centrifuge Tube   Genesee Scientific 22-272A
1 µl, 20 µl, 200 ml and 1,000 µl Pipette   Genesee Scientific 24-401,24-402, 24-412, 24-430
15 ml Conical Tube  Hyclone 339650
50 ml Conical Tube  Hyclone 339652
6 cm Cell Culture Dish  Thermo scientific 12-556-002
8 well Chambers  Thermo Scientific AB-4162
Acetate  Fisher scientific C4-100
AMV RT Enzyme/Buffer  Bio Labs M077L
Bovine Serum Albumin (BSA)  Fisher Scientific BP-1605-100
Buffered Zinc Formalin  Thermo 59201ZF
Charcoal strip FBS  Fisher NC9019735
Chloroform  Fisher Scientific BP1145-1
Cover slip  Fisher Brand 12-544D
Cyclic AMP (cAMP)  Sigma B7880
DMEM/High Glucose  Hyclone SH30243FS
dNTP  Bioline BIO-39025
Donkey Anti Goat -TRITC  Santa Cruz SC-3855
Donkey Serum  Jackson’s lab 017-000-002
E Cadherin Antibody   Epitomics 1702-1
Ethanol  Fisher Scientific BP2818-1
Fetal Bovine Serum (FBS)  Fisher Scientific 03-600-511
Fungizone Amphotericin B  Gibco 15290-018
GAPDH Probe  Life Technologies HS99999905
Glycogen  5Prime 2301440
Goat Anti Mouse - FITC  Jackson’s Lab 115-096-003
Isopropanol  Fisher Scientific BP2618-1
Kanamycin   Fisher Scientific BP906-5
Medroxyprogesterone acetate (MPA)  Sigma M1629
MeOH (Methanol)  Fisher Scientific A4-08-1
Mounting Media (w/DAPI)  Vector Labratories H-1500
N6 DNA Oligos  Invitrogen
Number 15 Scraper   BD 371615
Pan Cytokeratin  Mouse mAB  Cell Signaling 4545
PBS (phosphate buffered saline)  Fisher Scientific BP-399-4
Penicillin-Streptomycin Glutamine Solution 100X   Hyclone SV30082.01
PML Anti Goat Anti body  Santa Cruz SC-9862
Primer(s)  Eurofins
RPMI  Hyclone SH30027FS
RPMI (Phenol free)  Gibco 11835
Sybr Green   Thermo Scientific AB-4162
Taqman  Thermo AB-4138
Trizol  Life Technologies 15596018
Vimentin Antibody  Epitomics 4211-1

DOWNLOAD MATERIALS LIST

References

  1. Heller, D. in The endometrium: a clinicopathologic approach. Heller, D. 56-75 (1994).
  2. Emera, D., Romero, R., Wagner, G. The evolution of menstruation: a new model for genetic assimilation: explaining molecular origins of maternal responses to fetal invasiveness. Bioessays. 34, 26-35 (2011).
  3. Gudjonsson, T., Villadsen, R., Ronnov-Jessen, L., Petersen, O. W. Immortalization protocols used in cell culture models of human breast morphogenesis. Cell Mol Life Sci. 61, 2523-2534 (2004).
  4. Brosens, J. J., Hayashi, N., White, J. O. Progesterone receptor regulates decidual prolactin expression in differentiating human endometrial stromal cells. Endocrinology. 140, 4809-4820 (1999).
  5. Jones, M. C., et al. Regulation of the SUMO pathway sensitizes differentiating human endometrial stromal cells to progesterone. Proc Natl Acad Sci U S A. 103, 16272-16277 (2006).
  6. Salamonsen, L. A., et al. Proteomics of the human endometrium and uterine fluid: a pathway to biomarker discovery. Fertil Steril. 99, 1086-1092 (2013).
  7. Haouzi, D., Dechaud, H., Assou, S., De Vos, J., Hamamah, S. Insights into human endometrial receptivity from transcriptomic and proteomic data. Reprod Biomed Online. 24, 23-34 (2012).
  8. Chen, J. I., et al. Proteomic characterization of midproliferative and midsecretory human endometrium. J Proteome Res. 8, 2032-2044 (2009).
  9. Talbi, S., et al. Molecular phenotyping of human endometrium distinguishes menstrual cycle phases and underlying biological processes in normo-ovulatory women. Endocrinology. 147, 1097-1121 (2006).
  10. Punyadeera, C., et al. Oestrogen-modulated gene expression in the human endometrium. Cell Mol Life Sci. 62, 239-250 (2005).
  11. Ponnampalam, A. P., Weston, G. C., Susil, B., Rogers, P. A. Molecular profiling of human endometrium during the menstrual cycle. Aust N Z J Obstet Gynaecol. 46, 154-158 (2006).
  12. Zhang, L., Rees, M. C., Bicknell, R. The isolation and long-term culture of normal human endometrial epithelium and stroma. Expression of mRNAs for angiogenic polypeptides basally and on oestrogen and progesterone challenges. J Cell Sci. 108, (1), 323-331 (1995).
  13. Richards, R. G., Brar, A. K., Frank, G. R., Hartman, S. M., Jikihara, H. Fibroblast cells from term human decidua closely resemble endometrial stromal cells: induction of prolactin and insulin-like growth factor binding protein-1 expression). Biol Reprod. 52, 609-615 (1995).
  14. Gellersen, B., Brosens, J. Cyclic AMP and progesterone receptor cross-talk in human endometrium: a decidualizing affair. J Endocrinol. 178, 357-372 (2003).
  15. Marsh, M. M., Hampton, A. L., Riley, S. C., Findlay, J. K., Salamonsen, L. A. Production and characterization of endothelin released by human endometrial epithelial cells in culture. J Clin Endocrinol Metab. 79, 1625-1631 (1994).
  16. Siegfried, J. M., Nelson, K. G., Martin, J. L., Kaufman, D. G. Histochemical identification of cultured cells from human endometrium. In Vitro. 20, 25-32 (1984).
  17. Rawdanowicz, T. J., Hampton, A. L., Nagase, H., Woolley, D. E., Salamonsen, L. A. Matrix metalloproteinase production by cultured human endometrial stromal cells: identification of interstitial collagenase, gelatinase-A, gelatinase-B, and stromelysin-1 and their differential regulation by interleukin-1 alpha and tumor necrosis factor-alpha. J Clin Endocrinol Metab. 79, 530-536 (1994).
  18. Dimitriadis, E., Robb, L., Salamonsen, L. A. Interleukin 11 advances progesterone-induced decidualization of human endometrial stromal cells. Mol Hum Reprod. 8, 636-643 (2002).
  19. Sakai, N., et al. Involvement of histone acetylation in ovarian steroid-induced decidualization of human endometrial stromal cells. J Biol Chem. 278, 16675-16682 (2003).
  20. Logan, P. C., Ponnampalam, A. P., Steiner, M., Mitchell, M. D. Effect of cyclic AMP and estrogen/progesterone on the transcription of DNA methyltransferases during the decidualization of human endometrial stromal cells. Mol Hum Reprod. 19, 302-312 (2013).
  21. Tamura, I., et al. Induction of IGFBP-1 expression by cAMP is associated with histone acetylation status of the promoter region in human endometrial stromal cells. Endocrinology. 153, 5612-5621 (2012).
  22. American Society for Reproductive Medicine: Quick facts about infertility. Available from: http://www.asrm.org/detail.aspx?id=2322 (2013).
  23. Salker, M., et al. Natural selection of human embryos: impaired decidualization of endometrium disables embryo-maternal interactions and causes recurrent pregnancy loss. PLoS One. 5, (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics