तरीके छोटे RNAs और की Ribosomal अधिभोग की नियामक भूमिका की जांच करने के लिए * These authors contributed equally

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

LaMonte, G., Walzer, K. A., Lacsina, J., Nicchitta, C., Chi, J. T. Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum. J. Vis. Exp. (106), e53214, doi:10.3791/53214 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

सिकल सेल एलील के लिए जिम्मेदार आनुवंशिक परिवर्तन (एचबीएस) मलेरिया परजीवी पी द्वारा संक्रमण का विरोध करने के लिए सक्षम बनाता है एरिथ्रोसाइट्स फाल्सीपेरम। बहुघटकीय होने के लिए जाना जाता है जो इस प्रतिरोध, के आणविक आधार, न समझा जा रहा है। हाल के अध्ययनों से एक बार मलेरिया परजीवी में translocated एरिथ्रोसाइट microRNAs के अंतर अभिव्यक्ति, जीन विनियमन और परजीवी विकास दोनों को प्रभावित पाया। ये miRNAs बाद में परजीवी mRNAs का विचारशील सबसेट के साथ 5 'आरएनए संलयन के माध्यम से एक कैमेरिक शाही सेना प्रतिलेख के गठन से mRNA के अनुवाद को बाधित करने के लिए दिखाया गया। इधर, इस्तेमाल किया गया है कि तकनीक जीन विनियमन और पी के translational क्षमता पर कार्यात्मक भूमिका और ख्यात तंत्र अंतर्निहित एरिथ्रोसाइट microRNAs अध्ययन करने के लिए फाल्सीपेरम, मेजबान एरिथ्रोसाइट्स में संशोधित सिंथेटिक microRNAs की अभिकर्मक सहित विस्तृत किया जाएगा। अंत में, एक polysome ढाल विधि टीआरए की सीमा निर्धारित करने के लिए प्रयोग किया जाता हैइन टेप के nslation। साथ में, इन तकनीकों हमें एरिथ्रोसाइट microRNAs की dysregulated स्तरों दरांती एरिथ्रोसाइट्स की सेल आंतरिक मलेरिया प्रतिरोध में योगदान को दिखाना है कि अनुमति दी।

Introduction

जीनस प्लाज्मोडियम की apicomplexan परजीवी की वजह से मलेरिया, विश्व स्तर पर हर साल लगभग 200 मिलियन लोगों को संक्रमित और लगभग 600,000 लोगों की मृत्यु 1, जिससे सबसे आम मानव परजीवी बीमारी है। मनुष्यों को संक्रमित है कि पांच प्लाज्मोडियम प्रजातियों में से, मानव रोग के लिए सबसे अधिक प्रासंगिक पी रहे हैं फाल्सीपेरम और पी गंभीर मलेरिया जटिलताओं के लिए उनके बड़े पैमाने पर वितरण और क्षमता के कारण वैवाक्स। मलेरिया परजीवी का जीवन चक्र मच्छरों और मनुष्य दोनों के संक्रमण की आवश्यकता है। एक संक्रमित मच्छर एक मानव काटता है, परजीवी प्रतिकृति की एक शुरुआती दौर होता है, जहां जिगर, रक्त के माध्यम से यात्रा करते हैं। मेजबान hepatocyte से खंडजाणु टूटना के बाद, वे अलैंगिक या यौन या तो प्रतिकृति की शुरुआत, आस-पास के लाल रक्त कोशिकाओं को संक्रमित। पी में 48 घंटा रहता है जो प्रतिकृति के अलैंगिक मंच, यह सबसे मल का स्रोत दोनों है, क्योंकि फाल्सीपेरम, इस अध्ययन का ध्यान केंद्रित हैआरिया के लक्षण और आसानी से इन विट्रो में recapitulated है।

सुधार हुआ मलेरिया रोधी चिकित्सा सहित सार्वजनिक स्वास्थ्य की पहल के एक नंबर, कुछ हद तक विश्व स्तर पर मलेरिया के बोझ को कम कर दिया है, वहीं दवा प्रतिरोधी परजीवी के सतत उद्भव मलेरिया नियंत्रण के प्रयासों के लिए एक समस्या प्रस्तुत करता है। नई चिकित्सकीय दृष्टिकोण की सलाह दे सकते, जो एक ऐसा क्षेत्र आनुवंशिक वेरिएंट मलेरिया के लिए प्रतिरोध प्रदान कैसे विभिन्न पर अध्ययन किया जाता है। मलेरिया-स्थानिक क्षेत्रों में, एरिथ्रोसाइटिक बहुरूपताओं की एक किस्म 2,3 बहुत आम हैं। सिकल सेल शायद सबसे प्रमुख होने के साथ ये परिवर्तन, अक्सर ही प्रतीक मलेरिया संक्रमण 4 की शुरुआत करने के लिए पर्याप्त प्रतिरोध के साथ जुड़े रहे हैं। वे मलेरिया संक्रमण का विरोध करने एरिथ्रोसाइट्स कारण है जिसके द्वारा अंतर्निहित तंत्र पूरी तरह से समझे जाते हैं। हीमोग्लोबिन परिवर्तन के साथ parasitized एरिथ्रोसाइट्स बढ़ाया सेलुलर कठोरता और निर्जलीकरण, के माध्यम से बढ़ाया phagocytosis के अधीन हैं, जोपी की कमी हुई आक्रमण के साथ जुड़ा हुआ है 5 फाल्सीपेरम। HbC एलील भी एरिथ्रोसाइट सतह पर और cytoskeleton के पुनर्गठन, आगे परजीवी विकास 6.7 बाधा के साथ प्रोटीन की अभिव्यक्ति को प्रभावित करता है। अंत में, पी फाल्सीपेरम समयुग्मक दरांती के भीतर खराब बढ़ता है (HBSS) मलेरिया प्रतिरोध के आंतरिक एरिथ्रोसाइटिक कारकों का सुझाव दे, इन विट्रो में 8,9 एरिथ्रोसाइट्स। इन तंत्रों के सभी एक भूमिका निभाने के लिए दिखाई देते हैं, जबकि हालांकि, वे पूरी तरह से मलेरिया के सिकल सेल प्रतिरोध के पीछे तंत्र की व्याख्या नहीं है।

खराब समझ रहते हैं जो एरिथ्रोसाइटिक कारकों में से एक संभावित सेट परिपक्व एरिथ्रोसाइट्स भीतर miRNA वर्तमान का बड़ा पूल है। MicroRNAs 3 'UTR भीतर आधार बाँधना द्वारा अनुवाद और / या लक्ष्य mRNAs की स्थिरता मध्यस्थता जो 19-25 NT आकार में छोटे गैर-कोडिंग RNAs, कर रहे हैं। वे दमन ओ सहित, स्तनधारी प्रतिरक्षा प्रतिक्रिया के नियंत्रण में फंसाया गया हैच वायरस प्रतिकृति 10, और पौधों में वायरस के लिए प्रतिरोध प्रदान करने के लिए दिखाया गया है वे भी एरिथ्रोपोएसिस 11,12 और लोहे के चयापचय 13 सहित कई एरिथ्रोसाइटिक प्रक्रियाओं, विनियमित करने के लिए दिखाया गया है। पिछले अध्ययनों से जिनकी अभिव्यक्ति नाटकीय रूप से HBSS में बदल गया था 14,15 एरिथ्रोसाइट्स एरिथ्रोसाइटिक miRNAs, का एक प्रचुर मात्रा में और विविध आबादी की पहचान की। परिपक्व एरिथ्रोसाइट्स सक्रिय प्रतिलेखन और अनुवाद की कमी के बाद से, इन एरिथ्रोसाइट miRNAs की कार्यात्मक भूमिका अस्पष्ट बनी हुई है। महत्वपूर्ण सामग्री विनिमय मेजबान सेल और पी के बीच होता है के रूप में intraerythrocytic विकास चक्र (आईडीसी) 16 के दौरान फाल्सीपेरम, यह एचबीएस एरिथ्रोसाइट्स भीतर बदल miRNA प्रोफ़ाइल सीधे सेल आंतरिक मलेरिया प्रतिरोध करने के लिए योगदान कर सकते हैं कि अनुमान लगाया गया था।

इन अध्ययनों अंत में, अलग-थलग पहचान करने और कार्यात्मक मीटर के दायरे में मानव miRNA की भूमिका का अध्ययन करने के लिए एक पाइप लाइन के विकास के लिए नेतृत्वalaria परजीवी, पी उन मेजबान / मानव miRNAs अंततः covalently फ्यूज और फिर translationally परजीवी mRNA टेप 17 को दबाने जो संकेत दिया कि फाल्सीपेरम,। इस पार splicing द्वारा गठित पहली पार प्रजातियों कैमेरिक टेप का एक उदाहरण प्रदान की है और इस miRNA mRNA के संलयन अन्य परजीवी सहित अन्य प्रजातियों में उत्पन्न हो सकता है कि implicates। सभी trypanosome mRNAs पार spliced ​​एक ब्याह-नेता (एसएल) के साथ polycistronic टेप 18 की जुदाई को विनियमित करने के लिए कर रहे हैं। पी के बाद से फाल्सीपेरम Dicer / पहले 19,20 के लिए orthologs का अभाव है, यह एरिथ्रोसाइट miRNAs पी में समान एसएल मशीनरी का अपहरण संभव है कि फाल्सीपेरम लक्ष्य जीन में एकीकृत करने के लिए। पी में हाल के अध्ययनों से फाल्सीपेरम वास्तव में 5 'ब्याह नेता दृश्यों 21 की उपस्थिति का संकेत है। इस अध्ययन transcriptomic और transla सहित दोनों, मानव परजीवी miRNA mRNA के संलयन टेप की खोज हुई कि तरीकों का विवरणराष्ट्रीय विनियमन तकनीक। इन तरीकों के समग्र लक्ष्यों पी के जीन विनियमन, phenotypes और अनुवाद क्षमता में छोटे RNAs के प्रभाव की जांच करने के लिए कर रहे हैं फाल्सीपेरम टेप।

मानव परजीवी कैमेरिक टेप की प्रारंभिक पहचान ऐसे बल्कि केवल छोटे RNAs पृथक जो तकनीक का उपयोग कर से कुल और छोटे दोनों आरएनए, जिसमें शामिल वास्तविक समय पीसीआर, transcriptome अनुक्रमण और ईएसटी पुस्तकालय पर कब्जा, के रूप में शाही सेना के विश्लेषण तकनीक के उपयोग पर भरोसा किया। एक बड़ा पूल में एक साथ सभी आरएनए अलग-थलग, बल्कि अलग से, परजीवी में दोनों translocated मानव छोटे RNAs की पहचान के रूप में अच्छी तरह के रूप में एक बड़ा अनुक्रम के हिस्से के रूप में इन छोटे आरएनए दृश्यों की उपस्थिति की अनुमति दी। यह तो इन Fusions की कार्यात्मक परिणाम निर्धारित करने के लिए इन संलयन mRNAs का अनुवाद राज्य के एक विश्लेषण की आवश्यकता है।

परजीवी के जीनोम एक के लक्षण वर्णन पर व्यापक प्रयासों जबकिडी transcriptome परजीवी के शरीर विज्ञान में 22-25 की समझ को जोड़ लिया है, अब तक कम पी के जीवन चक्र भर में mRNA transcriptome के translational विनियमन के बारे में जाना जाता है फाल्सीपेरम 26। परजीवी के proteome के इस सीमित समझ परजीवी के जीव विज्ञान की समझ और मलेरिया रोधी चिकित्सा विज्ञान की अगली पीढ़ी के लिए नए लक्ष्य की पहचान करने की क्षमता दोनों रुकावट है। परजीवी के सेलुलर जीव विज्ञान की समझ में यह अंतर पी में translational विनियमन जांच करने के लिए पर्याप्त तकनीक की कमी के कारण बड़े पैमाने पर कायम है फाल्सीपेरम। हाल ही में एक कागज पी के राइबोसोमल footprinting के प्रयोग का वर्णन फाल्सीपेरम वैश्विक अनुवाद स्थिति 21 निर्धारित करने के लिए। टेप के translational क्षमता में से एक अच्छी तरह से स्थापित माप polysome प्रोफाइलिंग द्वारा निर्धारित जुड़े राइबोसोम की संख्या है। हालांकि, जब इस तकनीक पी करने के लिए लागू किया जाता है फाल्सीपेरम </ Em>, यह सबसे polysomes ठीक करने में असमर्थ है और मुख्य रूप से monosomes कब्जा। हाल ही में, कई समूहों 27,28 पी अनुकूलित है polysomes के संरक्षण और मेजबान लाल कोशिकाओं 28 में उनकी अलैंगिक विकास के दौरान इन मलेरिया परजीवी के राइबोसोमल अधिभोग और translational क्षमता को चिह्नित करने के लिए एक साथ एरिथ्रोसाइट और परजीवी lysing द्वारा फाल्सीपेरम polysome तकनीक।

सामूहिक रूप से, इन तरीकों मानव miRNA और परजीवी mRNAs का मनाया संलयन पहले से सूचना दी तरीकों 27 का उपयोग कर प्रदर्शन किया गया है, जो उन लोगों के संलयन mRNAs के परजीवी प्रोटीन अनुवाद modulates, और HbAS में मलेरिया प्रतिरोध का एक प्रमुख कारक है और HBSS 17 एरिथ्रोसाइट्स कि प्रदर्शित करता है। इन विधियों उन संलयन आरएनए पी भीतर कर रहे हैं, चाहे वह शाही सेना splicing घटनाओं की पहचान करने और कार्यात्मक रूप से पता लगाने के लिए की तलाश में किसी भी प्रणाली में उपयोगी होगा फाल्सीपेरम या अन्य यूकेरियोटिक सिस्टम।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1: पी से छोटे आकार के RNAs के अलगाव आईडीसी के दौरान फाल्सीपेरम

  1. अलैंगिक संस्कृति 29 में मलेरिया परजीवी प्राप्त करते हैं।
    नोट: आवश्यक संस्कृति आकार वांछित आवेदन के आधार पर अलग अलग होंगे; हालांकि, 3-5% पेरासाइटिमिया और 5% हेमाटोक्रिट में एक 10 मिलीलीटर संस्कृति वास्तविक समय पीसीआर (आरटी पीसीआर) के लिए पर्याप्त आरएनए प्रदान करता है। तकनीक शुरू में अतुल्यकालिक संस्कृतियों के लिए अनुकूलित किया गया था, लेकिन संक्रमण चक्र के दौरान विशिष्ट समय बिंदुओं वांछित हैं, जब अंगूठी चरण परजीवी नहीं बाद में 10-12 घंटे के बाद आक्रमण से सोर्बिटोल तुल्यकालन द्वारा सिंक्रनाइज़ किया जा सकता। तुल्यकालन एक चक्र (लगभग 48 घंटा), 29 के बाद दोहराया जाना चाहिए।
  2. पूल संक्रमित कोशिकाओं को एक साथ (~ 5 एक्स 10 9 लाल रक्त कोशिकाओं 3-5% पेरासाइटिमिया पर) और लाल गोली कोशिकाओं के ब्रेक के बिना 5 मिनट के लिए 800 XG पर ट्यूब और सेंट्रीफ्यूज के ऊपर से ठंड पीबीएस भरें।
  3. Centrifugation के बाद, संलग्न, ध्यान से एक aspirating पिपेट का उपयोग कर सतह पर तैरनेवाला हटानेएक वैक्यूम करने के लिए, एरिथ्रोसाइटिक गोली के बाद से बेदखल करने के लिए आसान है। ठंड 1x पीबीएस के साथ एक बार फिर गोली धो लें।
  4. 30 मिनट के लिए बर्फ पर Resuspend सेल (1x पीबीएस में) ठंड 0.15% सैपोनिन में गोली और जगह।
  5. 4 डिग्री सेल्सियस पर 12 मिनट के लिए 1,500 XG पर अपकेंद्रित्र कोशिकाओं, ठंड पीबीएस में सतह पर तैरनेवाला (रंग में गहरे लाल हो जाएगा) और resuspend गोली निकाल दें। एक बार फिर इस चरण को दोहराएँ।
    नोट: वर्तमान microRNAs परजीवी के भीतर microRNAs की चिंतनशील, और नहीं एरिथ्रोसाइटिक संदूषण थे कि यह सुनिश्चित करने के लिए, परजीवी अलगाव शर्तों के एक नंबर का परीक्षण किया गया: 1) सैपोनिन सेल, 2) सैपोनिन सेल RNaseA मेजबान सेल miRNAs की उपचार और 3 के साथ संयुक्त ) मिथाइल-बीटा-cyclodextrin उपचार मेजबान एरिथ्रोसाइट से परजीवी को दूर करने के लिए। सभी उपचार समान परिणाम दे दी है।
  6. Lyse lysis बफर की सिफारिश की 600 μl उपयोग कर अलग परजीवी गोली। Lysis बफर की यह मात्रा ~ 2% hematocrit और 5% पेरासाइटिमिया पर 30 मिलीलीटर तक संस्कृतियों के लिए पर्याप्त है।
    नोट: थोड़ी परजीवी संस्कृतियों के लिए, इस मात्रा बढ़ाई जा सकती है। यह कम से कम 1 मिनट के लिए पूरी तरह से vortexing द्वारा परजीवी गोली की पूरी सेल सुनिश्चित करने के लिए महत्वपूर्ण है। इसके अलावा, निकासी में आसानी के लिए, lysed नमूने एक 1.7 मिलीलीटर microcentrifuge ट्यूब को हस्तांतरित किया जा सकता है।
  7. Homogenate additive (2 एम सोडियम एसीटेट, पीएच 4) के 60 μl, या चरण 6 में इस्तेमाल किया lysis बफर के 1/10 मात्रा में जोड़ें।
  8. 10 मिनट के लिए बर्फ पर नमूने छोड़ दें।
  9. 600 μl, या 1 मिनट के लिए प्रत्येक नमूना और भंवर एसिड फिनोल choloroform की, चरण 6 में जोड़ा lysis बफर की राशि के बराबर मात्रा में जोड़ें।
  10. 5 मिनट के लिए 10,000 XG पर नमूने centrifuging द्वारा जलीय और जैविक चरणों अलग करें। इस स्पिन सभी हीमोग्लोबिन / hemozoin जैविक चरण में है कि यह सुनिश्चित करने के लिए लंबे समय तक किट ने सुझाव दिया है कि अधिक से है।
  11. ऊपरी (जलीय) परत लीजिए और एक ताजा ट्यूब को हस्तांतरण। जलीय चरण समर्थक पता चलता है, जो रंग में (अधिक संभावना) भूरे, सफेद है या यदि दोहराएँ 9 और 10 कदमTein संदूषण।
  12. पिपेट द्वारा परिणामस्वरूप तैरनेवाला की मात्रा का निर्धारण और फिर 100% इथेनॉल (~ 800 μl) के 1.25 खंडों को जोड़ने और 1.7 मिलीलीटर microcentrifuge ट्यूब 5 बार inverting द्वारा मिश्रण।
  13. 1 मिनट के लिए या एक वैक्यूम कई गुना का उपयोग करके 14,000 XG पर या तो centrifugation द्वारा एक प्रदान की शाही सेना बाध्यकारी फिल्टर कारतूस के माध्यम से प्रत्येक नमूना (व्यावसायिक रूप से उपलब्ध हैं कई अलग अलग है, जिनमें से) से गुजरती हैं।
  14. MiRNA के 700 μl बफर 1 1 मिनट के लिए 14,000 XG पर कताई, एक microcentrifuge का उपयोग कर धोने के साथ फिल्टर कारतूस धो लें।
  15. दो बार 1 मिनट प्रत्येक के लिए 14,000 XG पर centrifuging द्वारा 500 μl धो बफर 2/3 के साथ फिल्टर कारतूस धो लें।
  16. 1 मिनट प्रत्येक के लिए 14,000 XG पर centrifuging, 50 μl के दो washes में, 95 डिग्री सेल्सियस के लिए छोड़ देते किया गया है जो 100 μl DEPC-पानी, साथ Elute आरएनए। 260nm पर यूवी absorbance के माध्यम से शाही सेना की एकाग्रता उपाय।
    नोट: एक आरएनए जेल (TBE-यूरिया एक्रिलामाइड या denaturing फॉर्मेल्डीहाइड agarose जेल या तो) कर सकते हैं खई पृथक RNAs के आकार के वितरण का आकलन किया।
    नोट: यह आरएनए माइक्रोएरे, आरएनए अनुक्रमण, उत्तरी धब्बा और ribonuclease संरक्षण परख द्वारा विश्लेषण के लिए उपयुक्त है।

2: पी से छोटे आकार के आरएनए के quantitation आईडीसी के दौरान फाल्सीपेरम

  1. 260 एनएम यूवी स्पेक्ट्रोफोटोमेट्री का उपयोग कर चरण 1 में अलग व्यक्ति के नमूनों की एकाग्रता का निर्धारण।
  2. वांछित आरएनए प्रजातियों के लिए वास्तविक समय पीसीआर प्राइमरों उत्पन्न करता है। MRNAs या संलयन miRNA mRNA के लिए हम SYBR हरे रंग के लिए प्राइमरों के लिए बनाया गया है, जबकि miRNA के लिए अकेले, हम premade miRNA qPCR assays इस्तेमाल किया। रिवर्स mRNA अनुक्रम (: ATCGAACATGCTGTGAACAT PKA-आर) में miRNA के बहाव के एक जीन विशिष्ट प्राइमर ~ 100 बीपी था, जबकि: संलयन आरएनए के लिए, आगे प्राइमर miRNA अनुक्रम में ही (AAACCGTTACCATTACTGAGTT मीर 451) था।
  3. का उपयोग करते हुए शाही सेना के नमूने या तो mRNA और / या miRNA के लिए miRNAs (शाही सेना के 20-40 एनजी का उपयोग करें) अकेले या यादृच्छिक hexamers के लिए एक बाल के लिये कांटा प्राइमर से सीडीएनए बनाओ-mRNA संलयन प्रजातियों (शाही सेना की 1 ग्राम का उपयोग)। कमरे के तापमान को तो शांत, 65 डिग्री सेल्सियस पर 5 मिनट के लिए शाही सेना और प्राइमरों मिलाएं। बाद में, रिवर्स ट्रांसक्रिपटेस मिश्रण जोड़ने (0.5 μl रिवर्स ट्रांसक्रिपटेस, 0.5 μl RNase अवरोध करनेवाला, 1 μl dNTPs (2.5 मिमी प्रत्येक), 4 μl 5x बफर, 2 μl 0.1M डीटीटी, 1 μl एच 2 ओ)।
    1. SYBR हरे या TaqMan जांच या तो पता लगाने में सक्षम एक thermocycler पर चलाने के नमूने हैं। विशिष्ट जीन के लिए पीसीआर 30 मात्रात्मक हरी SYBR एक का उपयोग कर, 40 चक्र के लिए, एक 3-कदम पीसीआर, 15 सेकंड के लिए 95 डिग्री सेल्सियस, न्यूनतम प्राइमर annealing तापमान शून्य से 30 सेकंड के लिए 5 डिग्री सेल्सियस के रूप में चलाने के लिए, और 30 सेकंड के लिए 68 डिग्री सेल्सियस था वाणिज्यिक SYBR हरी मास्टर मिश्रण। miRNA वास्तविक समय पीसीआर 40 चक्र के लिए, 1 मिनट के लिए, एक दो कदम पीसीआर के रूप में 15 सेकंड के लिए 95 डिग्री सेल्सियस और 60 डिग्री सेल्सियस चला गया था।
    2. ΔΔCt विधि का उपयोग assays यों और या तो रब GTPase (PF08_0110) या 18S rRNA 31 के खिलाफ उन्हें मानक के अनुसार।

3: परिचयमलेरिया परजीवियों में छोटे RNAs की

  1. अभिकर्मक प्रति लाल रक्त कोशिकाओं के 300 μl गोली ब्रेक 1 पर 5 मिनट के लिए 800 XG पर centrifugation द्वारा पूरा मलेरिया मीडिया में (लाल रक्त कोशिकाओं के 250 μl, लगभग 1.5 x 10 9 कोशिकाओं, अंत में इस्तेमाल किया जाएगा)।
  2. RPMI और पूर्ण cytomix (120 मिमी KCl में resuspend के साथ दो बार एरिथ्रोसाइट्स धो, 0.15 मिमी CaCl 2; 10 मिमी कश्मीर 2 4 HPO / के.एच. 2 4 पीओ, पीएच 7.6; 25 मिमी HEPES, पीएच 7.6, 2 मिमी EGTA, पीएच 7.6; 5 मिमी 2 MgCl, ब्रेक 1 पर 5 मिनट के लिए 800 XG पर Centrifuging के बाद 50% हेमाटोक्रिट पर) KOH के साथ समायोजित पीएच।
  3. एक 0.2 सेमी electroporation क्युवेट कोशिकाओं स्थानांतरण।
  4. Cuvettes करने के लिए कस्टम सिंथेटिक oligonucleotides के, 10 माइक्रोग्राम, या उचित मात्रा में जोड़ने और संस्कृतियों resuspend।
  5. 310 वी / 950 μF को electroporator समायोजित करें और प्रत्येक क्युवेट करने के लिए एक पल्स देने के लिए।
  6. पूर्व गर्म पूरा मल में क्युवेट भीतर लाल रक्त कोशिकाओं के 300 μl Resuspendआरिया मीडिया और 24 अच्छी तरह से प्लेट में उन्हें थाली और मलेरिया रक्त गैस मिश्रण के साथ एक कंटेनर में 37 डिग्री सेल्सियस पर सेते (3% ओ 2, 5% सीओ 2)।
  7. 4 घंटे के बाद, 1% की एक अनुमानित अंतिम पेरासाइटिमिया के लिए सिंक्रनाइज़ देर ट्रोफोजोइट्स साथ ट्रांसफ़ेक्ट लाल रक्त कोशिकाओं को संक्रमित।
  8. संक्रमित संस्कृतियों के लिए हर 4-6 दिनों के हौसले ट्रांसफ़ेक्ट लाल रक्त कोशिकाओं को जोड़ें और धारा 4 में संकेत के रूप में, yoyo-एक धुंधला का उपयोग FACS द्वारा% पेरासाइटिमिया निर्धारित करते हैं।

4: परजीवी संक्रमण की दर पर एरिथ्रोसाइट microRNAs प्रभाव का निर्धारण

  1. एक 1.7 मिलीलीटर microcentrifuge ट्यूब में micropipettor और जगह से resuspended संस्कृति के 100 μl ले लो। 5 मिनट के लिए 800 XG पर centrifugation द्वारा एक टेबलटॉप microcentrifuge में 1 1x पीबीएस के मिलीग्राम और सेंट्रीफ्यूज के साथ दो बार धोएं।
  2. 0.025% glutaraldehyde के 1 मिलीलीटर में resuspend गोली। आरटी पर 20 मिनट के लिए नमूने सेते हैं।
    नोट: नमूने 4 डिग्री सेल्सियस पर कई हफ्तों के लिए यहाँ संग्रहित किया जा सकता है। बाद में, संक्रमित आर गोली5 मिनट के लिए 800 XG पर centrifugation द्वारा बीसी। 1x पीबीएस के 1 मिलीलीटर के साथ दो बार धोएं।
  3. 0.015% सैपोनिन के 1 मिलीलीटर में resuspend गोली। 15 मिनट के लिए 4 डिग्री सेल्सियस पर सेते हैं। गोली 5 मिनट के लिए 800 XG पर centrifugation द्वारा लाल रक्त कोशिकाओं को संक्रमित। 1x पीबीएस के 1 मिलीलीटर के साथ दो बार धोएं। Repeat.4.3। 1x पीबीएस 1 μl (1,000X) डीएनए दाग युक्त के 1 मिलीलीटर में Resuspend कोशिकाओं।
  4. 488 एनएम उत्तेजना में, एक प्रवाह cytometer पर पेरासाइटिमिया की डिग्री का निर्धारण करते हैं और ~ 530 एनएम (फ्लोरिडा -1) उत्सर्जन।
  5. सबसे पहले, गेट FSC और एसएससी पर आधारित प्रवाह लाल रक्त कोशिकाओं पर ध्यान केंद्रित करने के लिए। फिर फ्लोरिडा -1 चैनल में प्रतिदीप्ति द्वारा gated आरबीसी में पेरासाइटिमिया की डिग्री (संक्रमित लाल रक्त कोशिकाओं) को मापने।
    नोट: बाद में मंच परजीवी पहले चरण परजीवी से 10X अधिक फ्लोरोसेंट रहे हैं, और असंक्रमित लाल रक्त कोशिकाओं के ऊपर ~ 100X। इसके अलावा, कम गति पर एकत्रित शोर को कम करने के लिए जाता है। अंत में, इस दृष्टिकोण 3 एच hypoxanthine समावेश और Giemsa धुंधला, पहले 13 सूचना दोनों के रूप में, और सभी तकनीकों Gav तुलना की गई हैइसी तरह के परिणाम ई।

5: miRNA mRNA के फ्यूजन उत्पाद की बायोटिन-टैगिंग और क्षालन

  1. सीधे covalently 5 'के अंत से जुड़ा हुआ desthiobiotin के साथ कस्टम सिंथेटिक आरएनए oligonucleotides (Db-) के आदेश।
  2. चरण 3 में संकेत के रूप में, Desthiobiotin संयुग्मित (Db-) miRNA और असंशोधित miRNA (नकारात्मक नियंत्रण) के साथ असंक्रमित लाल रक्त कोशिकाओं Transfect।
  3. पी के साथ ट्रांसफ़ेक्ट लाल रक्त कोशिकाओं को संक्रमित फाल्सीपेरम 0.5% (1.1 कदम) की एक प्रारंभिक पेरासाइटिमिया को परजीवी।
  4. चरण 1 में ऊपर वर्णित के रूप में परजीवी आरएनए बाद में 4 दिन (96 घंटे) निकालें।
  5. Streptavidin मोतियों पैक 50 μl के साथ परजीवी शाही सेना के 10 माइक्रोग्राम सेते हैं, micropipette के माध्यम से जोड़ा, और 4 डिग्री सेल्सियस पर 1 घंटे के लिए एक microcentrifuge ट्यूब रोटेटर पर बारी बारी से।
  6. 30 सेकंड के लिए 800 XG पर मोती गोली और 20 मिमी KCl और 1/1000 RNase एफडीए से धो लें।
  7. 2 मिमी बायोटिन के साथ और 200 μl आरएनए कब्जा क्षालन बफर (20 मिमी KCl, 1/1 के साथ प्रतियोगिता से मोतियों से Elute आरएनए4, 000 RNase अवरोध करनेवाला और 2 मिमी बायोटिन) डिग्री सेल्सियस रात भर रोटेशन के साथ।
  8. संकेत दिया पी के संवर्धन की डिग्री का निर्धारण चरण 2 में संकेत के रूप में SYBR हरी QRT- पीसीआर, और TaqMan qPCR द्वारा microRNA संवर्धन (सकारात्मक नियंत्रण) का उपयोग फाल्सीपेरम टेप।

6: पी के Ribosomal रिहाइश का निर्धारण करने के polysome पृथक्करण फाल्सीपेरम

  1. 5 मिलीलीटर 15% sucrose के समाधान (400 मिमी पोटेशियम एसीटेट, 25 मिमी पोटेशियम HEPES, पीएच 7.2, 15 मिमी मैग्नीशियम एसीटेट, 200 माइक्रोन cycloheximide, 1 मिमी डीटीटी, 1 मिमी PMSF, 40 यू / एमएल RNase अवरोध करनेवाला, और 15% सुक्रोज की जगह ) एक SW41 ultracentrifuge ट्यूब (14 x 89 मिमी) में।
  2. एक 5 मिलीलीटर सिरिंज का प्रयोग, 5 मिलीलीटर 50% sucrose के समाधान (400 मिमी पोटेशियम एसीटेट, 25 मिमी पोटेशियम HEPES, पीएच 7.2, 15 मिमी मैग्नीशियम एसीटेट, 200 माइक्रोन cycloheximide, 1 मिमी डीटीटी, 1 मिमी PMSF, 40 यू / एमएल RNase जोड़ने अवरोध करनेवाला, और एक लंबे स्टील सुई का उपयोग 15% सुक्रोज के नीचे 50% सूक्रोज), तो सुई को हटा दें।
  3. 2 घंटे के बाद, धीरे धीरे वापस ईमानदार ट्यूब झुकाव और यह पूर्व नमूना लोड हो रहा है कम से कम 15 मिनट (14 कदम) के लिए शांत करने के लिए अनुमति देता है, बर्फ के लिए ट्यूब हस्तांतरण।
  4. 100-500 कुल शाही सेना के माइक्रोग्राम, या 3-5% पेरासाइटिमिया पर मोटे तौर पर एक 100 मिलीलीटर अतुल्यकालिक संस्कृति पैदा करने के लिए पर्याप्त प्लाज्मोडियम -infected रक्त चरण संस्कृति लीजिए। 10x (2 मिमी) cycloheximide (CHX) युक्त मध्यम संस्कृति की मात्रा वें 1/10 जोड़ें और 10 मिनट के लिए 37 डिग्री सेल्सियस पर सेते हैं।
    1. Centrifugation द्वारा गोली संस्कृतियों सेंट्रीफ्यूज के साथ 7 मिनट (ब्रेक 1) के लिए 500 XG पर, तो पीबीएस 200 माइक्रोन CHX युक्त 1x कमरे के तापमान के साथ दो बार धो लें। 200 माइक्रोन CHX युक्त 1x पीबीएस में परजीवी संस्कृतियों Resuspend और बर्फ पर दुकान।
    आरबीसी गोली की मात्रा का अनुमान है। Lysis बफर (400 मिमी पोटेशियम एसीटेट, 25 मिमी पोटेशियम HEPES, पीएच 7.2, 15 मिमी मैग्नीशियम एसीटेट, 200 माइक्रोन CHX, 1 मिमी डीटीटी, 1 मिमी PMSF, 40 यू / एमएल RNase अवरोध करनेवाला, 1% (वी / वी) IGEPAL सीए जोड़ें -630, और 0.5% 4.25 मिलीलीटर की एक अंतिम मात्रा को आरबीसी गोली डॉक्टर) (w / v)। 4 पर lysate सेते जबकि घूर्णन 10 मिनट के लिए सी °।
  5. Microcentrifuge ट्यूबों को lysate स्थानांतरण, और फिर 16,000 XG और 4 पर एक microcentrifuge में नमूने अपकेंद्रित्र 10 मिनट के लिए सी °।
  6. एम 0.5 ठंड सुक्रोज तकिया समाधान (400 मिमी पोटेशियम एसीटेट, 25 मिमी पोटेशियम HEPES, पीएच 7.2, 15 मिमी मैग्नीशियम एसीटेट, 200 माइक्रोन cycloheximide, 1 मिमी डीटीटी, 1 मिमी PMSF, 40 यू / एमएल RNase के 1.25 मिलीलीटर pipetting द्वारा सुक्रोज कुशन तैयार एक SW55 ultracentrifuge ट्यूब (13 x 51 मिमी) में अवरोध करनेवाला, और 0.5 एम सूक्रोज)।
  7. ध्यान से एक सिरिंज और छोटे (~ 27) गेज सुई का उपयोग सुक्रोज तकिया के शीर्ष पर (चरण 7 से) lysate सतह पर तैरनेवाला के 3.75 मिलीलीटर परत। Storधारा 1 में संकेत के रूप में ई -80 डिग्री सेल्सियस पर शेष lysate (~ 500 μl), कुल शाही सेना के स्तर को निकालने के लिए।
  8. 4 से पूर्व ठंडा ultracentrifuge एक रोटर में नमूने लोड 13.2 मिलीलीटर ट्यूबों पकड़ सकता है, जो डिग्री सेल्सियस,। 366,000 XG पर नमूने अपकेंद्रित्र और 146 मिनट के लिए 4 डिग्री सेल्सियस।
  9. एक विंदुक का उपयोग करना, एक 15 मिलीलीटर शंक्वाकार ट्यूब में सतह पर तैरनेवाला हस्तांतरण। नि: शुल्क (राइबोसोम द्वारा अनबाउंड) RNAs के शाही सेना के अलगाव के लिए -80 डिग्री सेल्सियस पर सतह पर तैरनेवाला स्टोर।
  10. राइबोसोम मेजबान बफर (400 मिमी पोटेशियम एसीटेट, 25 मिमी पोटेशियम HEPES, पीएच 7.2, 15 मिमी मैग्नीशियम एसीटेट, 200 माइक्रोन cycloheximide, 1 मिमी डीटीटी, 1 मिमी PMSF, और 40 यू / एमएल RNase एफडीए) के 500 μl में राइबोसोम गोली Resuspend 5 मिनट के लिए pipetting द्वारा।
  11. 16,000 XG और 4 पर एक microcentrifuge में नमूने अपकेंद्रित्र   10 मिनट के लिए सी °।
  12. बर्फ पर कदम # 4 से ढाल रखते हुए, तो ध्यान से ढाल यूएसआई के शीर्ष पर राइबोसोम निलंबन परत, parafilm हटानेएनजी एक सिरिंज और छोटे (~ 27) गेज सुई।
  13. एक पूर्व ठंडा ultracentrifuge रोटर में ट्यूब लोड और 200,000 XG और 180 मिनट के लिए 4 डिग्री सेल्सियस पर भरी हुई ढ़ाल अपकेंद्रित्र। स्पिन पूरा हो गया है, स्टोर 4 में ढ़ाल centrifuged तैयार है जब तक डिग्री सेल्सियस fractionator पर लोड करने के लिए।
  14. ढाल fractionator में एक खाली ultracentrifuge ट्यूब (यह एक पिछले समय में इस्तेमाल एक ट्यूब हो सकता है) लोड, तो 100 x 10 गति से 5 मिनट के लिए RNase मुक्त पानी से धो लें।
  15. कदम 6.16 में धोने के दौरान, यूवी absorbance डिटेक्टर की संवेदनशीलता को निर्धारित किया है। एक अच्छा प्रारंभिक संवेदनशीलता 0.2 है, लेकिन बाद में इस (परजीवी संख्या, आदि के आधार पर भिन्न है) एक 254 संकेत के आधार पर रन में समायोजित किया जा सकता है।
  16. डिटेक्टर संवेदनशीलता के सेट होने पर पानी डिटेक्टर के माध्यम से बह रहा है, जबकि शून्य करने के लिए आधारभूत संकेत निर्धारित किया है।
  17. लाइनों तो रेम खाली कर रहे हैं और जब तक अंश कलेक्टर धोने के बाद, द्रव का प्रवाह रिवर्सखाली ultracentrifuge ट्यूब ove।
  18. यह सुई तंत्र से बाहर निकालता है, जब तक fractionator के माध्यम से 60% sucrose के समाधान चलाएँ।
  19. कस खत्म करने के लिए नहीं ख्याल रख रही है, लोडिंग चैम्बर के शीर्ष पर प्रथम ढाल युक्त ट्यूब डालें और सील कस लें। फिर, सुई के साथ ट्यूब के नीचे घुसाना।
  20. (पंप के मोर्चे पर प्रवाह की गति नियंत्रण दस्ता द्वारा नियंत्रित) 12.5 एक्स 10 के लिए तरल पदार्थ के प्रवाह की गति रीसेट तो 18 सेकंड अंशों इकट्ठा करने के लिए स्वचालित अंश कलेक्टर सेट (~ 330 μl / अंश) microcentrifuge ट्यूबों में।
  21. आगे 60% sucrose के समाधान का प्रवाह शुरू।
  22. ढाल समाधान की पहली बूंद microcentrifuge ट्यूब में चला जाता है, तो तुरंत अंश संग्रह और एक 254 संकेत के लाइव रिकॉर्डिंग दोनों लगते हैं।
  23. एक तेज गिरावट 50% और 60% sucrose के समाधान के बीच इंटरफेस के लिए, इसी का एक 254 संकेत में मनाया जाता है एक बार, द्रव का प्रवाह और ए 254 दोनों रोक
  24. ढाल अंशों पर स्टोर -80   बाद में उपयोग के लिए सी °।
  25. 60% sucrose के समाधान ultracentrifuge ट्यूब के बाहर खाली जब तक 100 x 10 गति से द्रव का प्रवाह उल्टा।
  26. Fractionate करने के लिए अतिरिक्त ढ़ाल कर रहे हैं, लोडिंग कक्ष से खाली ultracentrifuge ट्यूब को हटाने और कदम 6.21 से पुनः आरंभ। सभी नमूनों को पूरा कर रहे हैं, तो कदम 6.16 और 6.19 में प्रदर्शन किया गया था, के रूप में तंत्र धो लें।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

पी में मानव microRNA की वैश्विक प्रोफाइलिंग फाल्सीपेरम

यहाँ प्रस्तुत तकनीकों की स्थिति की एक किस्म में परजीवी से microRNAs निकालने के लिए इस्तेमाल किया गया। नोट करने के लिए एक बात अक्सर इस लेख और मूल अध्ययन 29 दोनों में प्रस्तुत microRNA डेटा के लिए एक संदर्भ बिंदु के रूप में सेवा की है, जो 32, में संकेत के रूप असंक्रमित लाल रक्त कोशिकाओं के लिए आरएनए एक्सट्रेक्शन प्रदर्शन किया गया है। उन पिछले अध्ययनों से यह भी HbSS एरिथ्रोसाइट्स कुछ miRNAs, विशेष रूप से मीर 451 का अभी तक अधिक से अधिक स्तर के पास कि प्रदर्शन किया। ऊपर संकेत तकनीक एचबीएस (HBAs या HBSS) को संक्रमित परजीवी में miRNA बहुतायत में परिवर्तन प्रदर्शित करने के लिए पर्याप्त थे। 18S rRNA के खिलाफ ऊपर और सामान्यीकृत संकेत के रूप में शाही सेना के नमूने निकाले गए थे। HbSS लाल रक्त कोशिकाओं से परजीवी नमूने, उदाहरण के लिए, मीर 451 (चित्रा 1) सहित कई microRNAs, के स्तर में उल्लेखनीय वृद्धि दिखा सकते हैं। मेजबान erythr से miRNA के तेजocyte भी पिछले अध्ययनों 34,35 के अनुरूप है।

मीर 451 के साथ HbAA एरिथ्रोसाइट्स के अभिकर्मक HbAA मीर 451 HbSS एरिथ्रोसाइट्स के समान स्तर के लिए (चित्रा 1) की वृद्धि हुई। प्रवाह cytometry तो परजीवी विकास पर miRNA स्थानान्तरण के प्रभाव का आकलन करने के क्रम में, परजीवी के संक्रमण को मापने के लिए इस्तेमाल किया गया था। उस पर आधारित, मीर 451, मीर 223 और मीर-181a के साथ ट्रांसफ़ेक्ट HbAA एरिथ्रोसाइट्स, एक ssDNA oligo के साथ-साथ, परजीवी विकास पर microRNAs के प्रभाव के लिए जांच की गई। केवल द्वारा कम किया जा सकता है, जो मीर 451 स्पष्ट रूप से कम पेरासाइटिमिया, साथ अभिकर्मक एक antisense मीर 451 oligo सह transfecting जबकि - (डी 2A चित्रा) ssDNA या मीर 181a के अभिकर्मक पेरासाइटिमिया पर कोई प्रभाव नहीं पड़ा।

2'-ओ-मेरे antisense microRNAs की अभिकर्मक द्वारा microRNAs की अवरुद्ध एक पारस्परिक प्रभाव का प्रदर्शन किया। HbSS एरिथ्रोसाइट्स, स्वाभाविक रूप से अधिक मीर 451 के स्तर के साथ ट्रांसफ़ेक्ट थे antisense मीर 451 या 2'-ओ-मिथाइल oligonucleotides (चित्रा 3) के साथ। मीर 451 का निषेध दोनों HbSS एरिथ्रोसाइट्स (- एफ चित्रा 3 सी) में परजीवी विकास में वृद्धि हुई। परजीवी प्रतिशत के औसत और HBSS विकास (चित्रा 3F) को गुना परिवर्तन रिश्तेदार के रूप में प्रस्तुत किया है, तो कम से कम 3 स्वतंत्र transfections से गणना की गई।

बायोटिन कब्जा परख द्वारा miRNA mRNA के संलयन आरएनए की कैद

5'-desthiobiotin-मीर 451 के अभिकर्मक के बाद (5'Db-मीर 451) और 5'Db-मीर 181, विधियों धारा 5 में संकेत के रूप में, यह देखा miRNA अनुक्रम मानव microRNA साथ जन्म लिया है कि निर्धारित किया गया था। QRT- पीसीआर विश्लेषण 5'Db-मीर 451 की अभिकर्मक PKA आर संलयन टेप के संवर्धन में (चित्रा 4) हुई कि संकेत दिया।

Polysome जुदाई पी के राइबोसोमल अधिभोग निर्धारित करने के लिए फाल्सीपेरम

तम्बू "> एक ठेठ ए 254 का पता लगाने के अंश घनत्व ग्राफ (बाईं ओर यानी हल्का अंशों)। प्रारंभिक ए 254 पर बाएं से दाएं बढ़ाने के साथ (चित्रा 5 ब में rRNA सामग्री के उत्तरी पुष्टि के साथ) चित्रा 5 ए में दिखाया गया है जल्दी भागों में हीमोग्लोबिन की वजह absorbance के लिए काफी अधिक है, लेकिन जल्दी आधारभूत करने के लिए चला जाता है। पहली बार छोटे शिखर छोटे ribosomal सबयूनिट (40s) से मेल खाती है, थोड़ा बड़ा है और बड़े से मेल खाती है, जो दूसरी चोटी से जल्दी पीछा ribosomal सबयूनिट (60)। आम तौर पर पी फाल्सीपेरम के लिए सबसे बड़ा है जो तीसरे शिखर, उसकी ऊंचाई के कारण monosome शिखर (80) को। से मेल खाती है, 80 के दशक यूवी डिटेक्टर की संवेदनशीलता को समायोजित करने के लिए एक गाइड के रूप में इस्तेमाल किया जाना चाहिए 60, monosome चोटी के शुरू में एक "कंधे" की तरह गड़बड़ करने के लिए संकेत के लिए बाद में रन (6.17 चरण) के लिए। इसके अलावा, 80 चोटी के आकार की वजह से, यह आम बात है कि अगर दोनों 60 और 80 के दशकसंकेतों बड़े हैं।

Monosome चोटी के बाद polysomes के लिए इसी चोटियों कर रहे हैं। एक के बाद एक शिखर राइबोसोम की उत्तरोत्तर बड़ी संख्या में प्रतिनिधित्व करने वाले एक polysome अंश (2, 3, 4, आदि) का प्रतिनिधित्व करता है। प्रत्येक polysome चोटी एक के बाद एक polysome संख्या के साथ 2-3 गुना से ऊंचाई में कम हो रही है, पिछले शिखर से भी छोटा होता है। ठेठ रन सामग्री शुरू करने की एक बड़ी राशि के साथ कुछ रन में देखा गया है एक 9 मेर polysome अप करने के लिए की है, हालांकि संकल्प, 5-7 राइबोसोम की रचना polysomes के संकल्प की अनुमति देगा। उच्च आदेश polysomes ट्रेस के शेष रचना, और इन ढाल की शर्तों के तहत हल नहीं किया जा सकता है।

आकृति 1
चित्रा 1: मीर 451 HbSS एरिथ्रोसाइट्स में बुलंद कर रहे हैं Intraparasitic मीर 451 के स्तर, वास्तविक समय पीसीआर द्वारा निर्धारित और 18S rRNA के खिलाफ सामान्यीकृत के रूप में संकेत दिया से अलग परजीवी से।एरिथ्रोसाइट प्रकार के। मूल्यों ± एसई मतलब हैं।

चित्र 2
चित्रा 2: मीर 451 की overexpression सामान्य एरिथ्रोसाइट्स में परजीवी विकास को रोकता है (एक - सी) कुल आरबीसी का एक प्रतिशत, दिखाया एरिथ्रोसाइट प्रकारों के लिए, एम 1 से संकेत कर रहे हैं, के रूप में संक्रमण दर का संकेत प्रतिनिधि FACS भूखंडों।। (डी) कम्पोजिट संक्रमण दर FACS से ली गई है और untransfected HbAA लाल रक्त कोशिकाओं के खिलाफ सामान्यीकृत। डी मतलब ± एसई है, जबकि पैनल एसी में मूल्यों प्रतिनिधि FACS भूखंडों हैं।

चित्र तीन
चित्रा 3:। सिकल सेल एरिथ्रोसाइट्स में मीर 451 का निषेध परजीवी विकास उठ (ए - ई) संक्रमण दर का संकेत प्रतिनिधि FACS भूखंडों, कुल आरबीसी के प्रतिशत के रूप में दिखाया गया एर के लिए, एम 1 के संकेत हैंythrocyte प्रकार के। Untransfected HbAA लाल रक्त कोशिकाओं के खिलाफ एक सामान्यीकृत मूल्य के रूप में FACS से ली गई है और साजिश रची (एफ) कम्पोजिट संक्रमण दर। पैनल एई में मूल्यों प्रतिनिधि FACS भूखंडों हैं, एफ ± एसई मतलब है।

चित्रा 4
चित्रा 4: मीर 451 के अभिकर्मक PKA आर संलयन से टेप के लिए समृद्ध करती है और जुड़े miRNA मूल में एरिथ्रोसाइटिक पता चलता है कि streptavidin द्वारा कब्जा कर लिया गया है कि संकेत दिया desthiobiotin संयुग्मित miRNA mRNA के संलयन टेप के संवर्धन।। मूल्यों वास्तविक समय पीसीआर का उपयोग करके मापा और गैर ट्रांसफ़ेक्ट परजीवी बनाम एक रिश्तेदार मूल्य के रूप में प्लॉट किए जाते थे। मूल्यों ± एसई मतलब हैं।

चित्रा 5
चित्रा 5:। परजीवी राइबोसोम सुक्रोज ढाल के माध्यम से अलग किया जा सकता है (ए - बी) exampLe प्लाज्मोडियम फाल्सीपेरम से निकाले एक polysome प्रोफ़ाइल के निशान। (संबद्ध राइबोसोम की संख्या का संकेत # एस) के साथ 40, 60, 80 और polysome चोटियों के साथ प्लाज्मोडियम फाल्सीपेरम से निकाले एक polysome प्रोफाइल, (ए) ट्रेस प्रदर्शन किया। (बी) राइबोसोमल अंशों भर में 18S और 28S rRNA के उत्तरी धब्बा। मूल्यों ± एसई मतलब हैं।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

एचबीएस यह पी की वजह से गंभीर मलेरिया के खिलाफ सुरक्षा प्रदान करता है, क्योंकि मोटे तौर मलेरिया प्रभावित क्षेत्रों में सबसे आम हीमोग्लोबिन वेरिएंट में से एक है फाल्सीपेरम। तकनीक पी के जीन विनियमन में मानव microRNA की भूमिका को चिह्नित करने की जरूरत फाल्सीपेरम इस पांडुलिपि भर में विस्तृत रहे हैं। सभी छोटे RNAs शामिल करने के लिए इस तरह के रूप में कुल शाही सेना को निकालने के लिए, और एक अपेक्षाकृत सरल परजीवी सेल प्रक्रिया के प्रदर्शन से करके, इन संलयन आरएनए स्वतंत्र तकनीक की एक किस्म के माध्यम से पहचाना जा करने में सक्षम थे।

ये कदम अपेक्षाकृत सरल हैं, लेकिन समस्याओं और ठीक से पालन नहीं करता है, तो प्रदूषण के प्रति संवेदनशील हैं। परजीवी निकासी के दौरान, यह मेजबान एरिथ्रोसाइट्स दूषित दूर करने के लिए सैपोनिन सेल प्रदर्शन करने के लिए महत्वपूर्ण है। इस शाही सेना के अलगाव की सैपोनिन सेल चरण के दौरान विशेष रूप से सच है। मेजबान लाल रक्त कोशिकाओं की miRNA घटक परिमाण जी के कई आदेशों हैयह जितना संभव हो उतना एरिथ्रोसाइटिक संक्रमण को दूर करने के लिए महत्वपूर्ण है, इसलिए की वजह से सबसे अधिक लाल रक्त कोशिकाओं के हिस्से में परजीवी, की तुलना में reater, असंक्रमित किया जा रहा है। यह (संक्रमण चक्र में एक विशिष्ट बिंदु की आवश्यकता होती है तो) एक सटीक miRNA प्रोफ़ाइल प्राप्त करने के लिए एक स्वस्थ और उचित मंच में मलेरिया संस्कृति को बनाए रखने के लिए भी महत्वपूर्ण है। इसी तरह, फिनोल के क्लोरोफॉर्म निष्कर्षण के दौरान, यह जलीय चरणों यदि नहीं, तो किसी भी शेष संक्रमण से बचने के फिनोल के क्लोरोफॉर्म निष्कर्षण दोहराने, स्पष्ट कर रहे हैं और यह सुनिश्चित करना महत्वपूर्ण है।

इसके अलावा, desthiobiotin कब्जा प्रयोग में, यह बायोटिन की एक अतिरिक्त के साथ elute करने के लिए और उचित विशिष्ट क्षालन सुनिश्चित करने के लिए इतनी के रूप में, streptavidin मोतियों का न्यूनतम उपयोग करने के लिए महत्वपूर्ण है। मोतियों की बायोटिन के साथ प्रतिस्पर्धा है, बजाय पूरा विकृतीकरण स्वयं के माध्यम से बाध्य RNAs के क्षालन, नाटकीय रूप से पृष्ठभूमि आरएनए संवर्धन कम करने के लिए कार्य किया। अंत में, desthiobiotin कब्जा प्रयोग डाला गया था एकइन miRNAs कब्जा कर लिया गया है, लेकिन कई अन्य तकनीकों में भी इस तरह के उत्तरी दाग और ribonuclease संरक्षण assays के 29 के रूप में इन संलयन आरएनए, प्रदर्शित करने के लिए पिछले अध्ययनों में इस्तेमाल किया गया है कि कैसे प्रदर्शित करने के लिए एक महत्वपूर्ण तरीका है। ऐसे ट्रांसफ़ेक्ट miRNAs की परिवहन और प्रसंस्करण मध्यस्थता कर सकते हैं कि संबद्ध प्रोटीन परिसरों की शुद्धि के रूप में व्यापक आवेदन, हो सकता है संशोधित टेप को पुनः प्राप्त करने के लिए ट्रांसफ़ेक्ट microRNAs का उपयोग कर के इस तरह के तरीकों।

विभिन्न जीनोम चौड़ा दृष्टिकोण मलेरिया proteome और transcriptome 22-25 अध्ययन करने के लिए इस्तेमाल किया गया है, वहाँ के लिए कुछ तरीकों से विश्व स्तर पर कर रहे हैं, पी में translational विनियमन की जांच 21,26 फाल्सीपेरम। इस पद्धति सीमा पी में translational विनियमन के वैश्विक विश्लेषण precludes फाल्सीपेरम। Translational विनियमन अध्ययन करने के लिए सबसे आम प्रयोगात्मक दृष्टिकोण से एक समग्र अनुवाद का आकलन है जो polysome रूपरेखा, हैहित के विशिष्ट mRNAs पर लादा राइबोसोम पर आधारित अल गतिविधि। इस पांडुलिपि में विस्तृत संक्रमित एरिथ्रोसाइट और भीतर परजीवी दोनों lyses कि मलेरिया परजीवी में उपयोग के लिए एक अनुकूलित polysome प्रोफाइलिंग विधि है। पिछले विधियों polysomes के बहुमत की वसूली और मलेरिया परजीवी polysomes की पर्याप्त आबादी नहीं था के रूप में हालांकि यह प्रतीत नहीं बनाया था। पोटेशियम एसीटेट और मैग्नीशियम के एक उच्च एकाग्रता के साथ एक बफर का उपयोग बरकरार polysomes का कब्जा अनुमति देने के लिए झिल्ली ही सीमित राइबोसोम solubilizing जबकि यह संभव लाल रक्त कोशिकाओं और परजीवी दोनों lyse करने के लिए बनाया है।

राइबोसोमल शुद्धि और रूपरेखा की यह लागत प्रभावी तरीका मलेरिया transcriptome और proteome के बीच मौजूदा ज्ञान में खाई पाटने में मदद मिलेगी और पी के translational राज्य के जीनोम चौड़ा विश्लेषण सक्षम हो जाएगा फाल्सीपेरम। यह दृष्टिकोण जल्दी और देर चरण ख का अनुवाद राज्य तुलना करने के लिए इस्तेमाल किया गया हैlood चरण कसकर जीन अभिव्यक्ति का समन्वय है जो 28, परजीवी। टेप के राइबोसोमल लोडिंग पर डेटा आसानी से प्राप्त की और विशिष्ट mRNAs पर राइबोसोम के घनत्व निर्धारित करने के लिए विश्लेषण किया जा सकता है। सोर्बिटोल तुल्यकालन के साथ संयुक्त इसके अलावा, जब राइबोसोमल घनत्व में परिवर्तन अनुवाद परजीवी जीवन चक्र के दौरान नियंत्रित किया जाता है कैसे स्थापित करने के लिए इस्तेमाल किया जा सकता है। इस दृष्टिकोण का उपयोग राइबोसोम के अलगाव दुर्भाग्य से यह प्रदर्शन किया जा सकता है, जिसमें मलेरिया जीवन चक्र के चरणों की सीमा जो संस्कृति की एक बड़ी राशि की आवश्यकता है। इनपुट सामग्री की बड़ी राशि भी प्लाज्मोडियम फाल्सीपेरम की इन विट्रो प्रयोगशाला उपभेदों के लिए इसके उपयोग दोनों को सीमित कर देगा, और अन्य संक्रामक जीवों के लिए इसके लागू सीमित कर सकते हैं। इस प्रक्रिया का उपयोग कर किसी भी जीन विनियमन के वैकल्पिक तरीकों को दर्शाती है, राइबोसोम के साथ संबद्ध नहीं हैं, जो विशेष रूप से टेप में असामान्य अनुवाद प्रोफाइल, बताते हैं कि जीन के लिए स्क्रीन करने में सक्षम हो जाएगा। अंत में,इस दृष्टिकोण उपन्यास मलेरिया रोधी एजेंट प्रोटीन अनुवाद प्रभावित कैसे मूल्यांकन करने के लिए सक्षम हो जाएगा और नशीली दवाओं के प्रतिरोध का अनुवाद आधारित तंत्र की पहचान करने के लिए। इस पाइप लाइन की पहचान करने और कई प्रायोगिक प्रणाली में पोस्ट-ट्रांसक्रिप्शनल विनियमन का निर्धारण करने में महान उपयोगिता है।

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
REAGENTS-All reagents must be RNAse-free.
Diethyl pyrocarbonate Sigma D5758 DEPC
DEPC-treated water (see REAGENT SETUP)
Yoyo-1 DNA fluorescent dye Thermo Fisher
Gene Pulser II electroporator Bio-Rad
0.2 cm Electroporation cuvettes
4 M potassium acetate Mallinckrodt 6700
2 M potassium HEPES Sigma H0527 pH 7.2
1 M magnesium acetate Sigma M-2545
1 M dithiothreitol Research Products International D11000 DTT
100 mM phenylmethylsulfonate fluoride Sigma P7626 PMSF, dissolved in isopropanol
10% (v/v) Igepal CA-630 Sigma-Aldrich I3021
10% (w/v) sodium deoxycholate Sigma D-6750 DOC
Cycloheximide Sigma C-7698 CHX
Sucrose Mallinckrodt 8360-04
RNAseOUT (Invitrogen, cat. no. 100000840) Invitrogen 100000840
RPMI-1640 w/ L-glutamine Cellgro 10-040-CV
10% AlbuMAX I Invitrogen 11020-039 w/v in sterile water
Gentamicin Gibco 15750-060
HT supplement (100x) (Invitrogen, cat. no. 11067030)
45% (w/v) sucrose (Sigma, cat no. G8769)
1 M HEPES buffer (Gibco, cat. no. 15630-080)
1x phosphate buffered saline (PBS; Cellgro, cat. no. 2109310CV)
Corning 500 ml vacuum filter flask (VWR, cat. no. 430769)
Glass slides (VWR, cat. no. 48311-702)
Giemsa stain (50X) (VWR, cat no. m708-01)
mirVana miRNA isolation kit (Ambion, ThermoFisher Scientific).
5' Biotin conjugated mature miRNA (sequence varies by miRNA of interest) (Dharmacon)
Biotin powder (Sigma-Aldrich)
1 M Potassium Chloride
Streptavidin Sepharose High Performance Beads (GE Healthcare)
Ribosome resuspension buffer (see REAGENT SETUP)
Lysis buffer (see REAGENT SETUP)
15% (w/v) sucrose gradient solution (see REAGENT SETUP)
50% (w/v) sucrose gradient solution (see REAGENT SETUP)
0.5 M sucrose cushion (see REAGENT SETUP)
60% (w/v) sucrose chase solution (see REAGENT SETUP)
Plasmodium cell culture media (see REAGENT SETUP)
RNA capture Wash Buffer (see REAGENT SETUP)
RNA Elution Buffer (see REAGENT SETUP)
REAGENT SETUP
Solutions
Plasmodium cell culture media
500 ml RPMI-1640 w/ L-glutamine
0.5 ml gentamicin
5 ml HT supplement
2.5 ml 45% glucose
25 ml 10% AlbuMAX I
12.5 ml 1 M HEPES
Sterile filter with 0.2 mm vacuum filter flask.
Plasmodium cell culture media containing 10x CHX
Same recipe as Plasmodium cell culture media above, with the addition of:
2 mM cycloheximide
Media is prepared as normal, then add CHX to a final concentration of 2 mM and filter. 
1x PBS containing cycloheximide
Cycloheximide is added fresh to 1x PBS to a final concentration of 200 mM, and kept at 4 OC until use.
Ribosome resuspension buffer
400 mM potassium acetate
25 mM potassium HEPES, pH 7.2
15 mM magnesium acetate
200 mM cycloheximide (add fresh)
1 mM DTT (add fresh)
1 mM PMSF (add fresh)
40 U/ml RNaseOUT (add fresh)
Lysis buffer
Same recipe as ribosome resuspension buffer above, with the addition of:
1% (v/v) Igepal CA-630
0.5% (w/v) DOC
Sucrose solutions
Same recipe as ribosome resuspension buffer above, with the addition of varying amounts of sucrose:
15% (w/v) sucrose to make 15% sucrose gradient solution
50% (w/v) sucrose to make 50% sucrose gradient solution
0.5 M sucrose to make 0.5 M sucrose cushion
As above, cycloheximide, DTT, PMSF, and RNaseOUT must be added fresh.
The 60% sucrose chase solution requires only sucrose and water, no other components
60% (w/v) sucrose in DEPC-treated water to make 60% sucrose chase solution
RNA Capture Wash Buffer
20 mM  KCl
5 unit/ml Rnase Out (Invitrogen)
RNA Capture Elution Buffer
Same recipe as RNA Capture Wash Buffer, with the addition of:
2 mM Biotin
EQUIPMENT
SW55 Ti ultracentrifuge rotor (Beckman, cat. no. 342194)
SW41 Ti ultracentrifuge rotor (Beckman, cat. no. 331362)
Ultra-ClearTM ½ x 2 in (13 x 51 mm) ultracentrifuge tubes for the SW55 (Beckman, cat. no. 344057)
Polyallomer 9/16 x 3 ½ in (14 x 89 mm) ultracentrifuge tubes for the SW41 (Beckman, cat. no. 331372)
L8-80M ultracentrifuge (Beckman)
Steel blunt syringe needle, 4 inch, 16 G (Aldrich, cat. no. Z261378)
1 ml syringe with 27 G½ needle (Becton Dickinson, cat no. 309623)
5 ml syringe (Becton Dickinson, cat. no. 309646)
Parafilm
Tube rotator, end-over-end
Microcentrifuge, refrigerated
Density gradient fractionation system (Teledyne Isco, cat. no. 69-3873-179)
TracerDAQ (Measurement Computing)
Eppendorf 5810R centrifuge
Eppendorf A-4-81 rotor (Eppendorf, cat. no. 022638807)

DOWNLOAD MATERIALS LIST

References

  1. World Health Organization. World Malaria Report. (2014).
  2. Livincstone, F. B. Malaria and human polymorphisms. Annu Rev Genet. 5, 33-64 (1971).
  3. Nagel, R. L., Roth, E. F. Malaria and red cell genetic defects. Blood. 74, 1213-1221 (1989).
  4. Aidoo, M., et al. Protective effects of the sickle cell gene against malaria morbidity and mortality. Lancet. 359, 1311-1312 (2002).
  5. Tiffert, T., et al. The hydration state of human red blood cells and their susceptibility to invasion by Plasmodium falciparum. Blood. 105, 4853-4860 (2005).
  6. Fairhurst, R. M., et al. Abnormal display of PfEMP-1 on erythrocytes carrying haemoglobin C may protect against malaria. Nature. 435, 1117-1121 (2005).
  7. Cyrklaff, M., et al. Hemoglobins S and C interfere with actin remodeling in Plasmodium falciparum-infected erythrocytes. Science. 334, 1283-1286 (2011).
  8. Friedman, M. J. Erythrocytic mechanism of sickle cell resistance to malaria. Proceedings of the National Academy of Sciences of the United States of America. 75, 1994-1997 (1978).
  9. Pasvol, G., Weatherall, D. J., Wilson, R. J. Cellular mechanism for the protective effect of haemoglobin S against P. falciparum malaria. Nature. 274, 701-703 (1978).
  10. Lecellier, C. H., et al. A cellular microRNA mediates antiviral defense in human cells. Science. 308, 557-560 (2005).
  11. Niu, Q. W., et al. Expression of artificial miroRNAs in transgenic Arabidopsis thaliana confers virus resistance. Nature biotechnology. 24, 1420-1428 (2006).
  12. Zhao, G., Yu, D., Weiss, M. J. MicroRNAs in erythropoiesis. Curr Opin Hematol. 17, 155-162 (2010).
  13. Lee, Y. T., et al. LIN28B-mediated expression of fetal hemoglobin and production of fetal-like erythrocytes from adult human erythroblasts ex vivo. Blood. 122, 1034-1041 (2013).
  14. Sangokoya, C., Doss, J. F., Chi, J. T. Iron-responsive miR-485-3p regulates cellular iron homeostasis by targeting ferroportin. PLoS genetics. 9, e1003408 (2013).
  15. Chen, S. Y., Wang, Y., Telen, M. J., Chi, J. T. The genomic analysis of erythrocyte microRNA expression in sickle cell diseases. PLoS ONE. 3, e2360 (2008).
  16. Sangokoya, C., Telen, M. J., Chi, J. T. microRNA miR-144 modulates oxidative stress tolerance and associates with anemia severity in sickle cell disease. Blood. 116, 4338-4348 (2010).
  17. Deitsch, K., Driskill, C., Wellems, T. Transformation of malaria parasites by the spontaneous uptake and expression of DNA from human erythrocytes. Nucleic acids research. 29, 850-853 (2001).
  18. Liang, X. H., Haritan, A., Uliel, S., Michaeli, S. trans and cis splicing in trypanosomatids: mechanism, factors, and regulation. Eukaryotic cell. 2, 830-840 (2003).
  19. Baum, J., et al. Molecular genetics and comparative genomics reveal RNAi is not functional in malaria parasites. Nucleic acids research. 37, 3788-3798 (2009).
  20. Hall, N., et al. A comprehensive survey of the Plasmodium life cycle by genomic, transcriptomic, and proteomic analyses. Science. 307, 82-86 (2005).
  21. Caro, F., Ahyong, V., Betegon, M., DeRisi, J. L. Genome-wide regulatory dynamics of translation in the asexual blood stages. eLife. 3, (2014).
  22. Oehring, S. C., et al. Organellar proteomics reveals hundreds of novel nuclear proteins in the malaria parasite Plasmodium falciparum. Genome biology. 13, R108 (2012).
  23. Lasonder, E., et al. Analysis of the Plasmodium falciparum proteome by high-accuracy mass spectrometry. Nature. 419, 537-542 (2002).
  24. Bozdech, Z., et al. The transcriptome of the intraerythrocytic developmental cycle of Plasmodium falciparum. PLoS biology. 1, E5 (2003).
  25. Gardner, M. J., et al. Genome sequence of the human malaria parasite Plasmodium falciparum. Nature. 419, 498-511 (2002).
  26. Zhang, M., Joyce, B. R., Sullivan, W. J. Jr., Nussenzweig, V. Translational control in Plasmodium and toxoplasma parasites. Eukaryotic cell. 12, 161-167 (2013).
  27. Lacsina, J. R., LaMonte, G., Nicchitta, C. V., Chi, J. T. Polysome profiling of the malaria parasite Plasmodium falciparum. Molecular and biochemical parasitology. 179, 42-62 (2011).
  28. Bunnik, E. M., et al. Polysome profiling reveals translational control of gene expression in the human malaria parasite Plasmodium falciparum. Genome biology. 14, R128 (2013).
  29. LaMonte, G., et al. Translocation of sickle cell erythrocyte microRNAs into Plasmodium falciparum inhibits parasite translation and contributes to malaria resistance. Cell host & microbe. 12, 187-199 (2012).
  30. Lambros, C., Vanderberg, J. P. Synchronization of Plasmodium falciparum erythrocytic stages in culture. The Journal of parasitology. 65, 418-420 (1979).
  31. Bourgeois, N., et al. Comparison of three real-time PCR methods with blood smears and rapid diagnostic test in Plasmodium sp. infection. Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases. 16, 1305-1311 (2010).
  32. Abruzzo, L. V., et al. Validation of oligonucleotide microarray data using microfluidic low-density arrays: a new statistical method to normalize real-time RT-PCR data. Biotechniques. 38, 785-792 (2005).
  33. Sangokoya, C., LaMonte, G., Chi, J. T. Isolation and characterization of microRNAs of human mature erythrocytes. Methods in molecular biology. 667, 193-203 (2010).
  34. Rathjen, T., Nicol, C., McConkey, G., Dalmay, T. Analysis of short RNAs in the malaria parasite and its red blood cell host. FEBS Lett. 580, 5185-5188 (2006).
  35. Xue, X., Zhang, Q., Huang, Y., Feng, L., Pan, W. No miRNA were found in Plasmodium and the ones identified in erythrocytes could not be correlated with infection. Malar J. 7, 47 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics