Epicardiale uitgroei Cultuur en Assay

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Trembley, M. A., Velasquez, L. S., Small, E. M. Epicardial Outgrowth Culture Assay and Ex Vivo Assessment of Epicardial-derived Cell Migration. J. Vis. Exp. (109), e53750, doi:10.3791/53750 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Een enkele laag van epicardiale cellijnen het hart, waardoor paracriene factoren die cardiomyocyt proliferatie stimuleren en rechtstreeks bij cardiovasculaire progenitoren tijdens ontwikkeling en ziekte. Hoewel een aantal factoren zijn betrokken bij cel-epicard afgeleide (EPDC) mobiliseren, zijn de mechanismen die de latere migratie en differentiatie slecht begrepen. Hier presenteren we in vitro en ex vivo strategieën EPDC motiliteit en differentiatie te bestuderen. Ten eerste beschrijven we een methode voor het verkrijgen primaire epicardiale cellen door uitgroei Cultuur van de embryonale muis hart. We introduceren ook een gedetailleerd protocol om driedimensionale migratie van gelabelde EPDC beoordelen in een orgaan kweeksysteem. Wij leveren het bewijs met behulp van deze technieken die genetische deletie van-myocardin gerelateerde transcriptiefactoren in het epicard verzwakt EPDC migratie. Deze aanpak dient als een platform om de kandidaat-modifiers van EPDC evaluerenbiologie en kunnen worden gebruikt om genetische of chemische screens voor nieuwe regulatoren van EPDC mobilisatie die nuttig zijn voor cardiale regeneratie kan zijn kaart te brengen.

Introduction

Het epicard is een enkele laag van mesotheelcellen lijnen die het hart en effecten cardiale ontwikkeling, rijping en reparatie. Via een sterk gecoördineerde uitwisseling van paracriene signalen, de intieme dialoog tussen het myocardium en epicardium onontbeerlijk cardiale groei en de vorming van niet-cardiale myocyten lineages 1. -Epicardiale afgeleide cellen (EPDC) komen uit een subset van epicardiale cellen door een epitheliale naar mesenchymale transitie (EMT) 2, binnenvallen subepicardiale ruimte en onderliggende myocardium en differentiëren grotendeels in hart- mural cellen en fibroblasten, en een mindere mate, endotheelcellen en cardiomyocyten 3-9.

De mechanismen reguleren epicardiale EMT en EPDC invasie werden toegeschreven aan de gecoördineerde actie van verschillende moleculen, waaronder uitgescheiden liganden 10-13, celoppervlak receptoren en adhesiemoleculen 14,15, reguLators van apicale-basale polariteit 16,17, kleine GTPases 18,19 en transcriptiefactoren 2,20,21. Hoewel veel van de moleculaire effectoren van EPDC migratie zijn gedefinieerd, een beter begrip van de fysiologische signalen die EPDC mobilisatie stimuleren het embryo kan de ontwikkeling van strategieën versnellen dit proces te manipuleren in de volwassen verbeterde cardiale regeneratie.

Studies gericht op het identificeren van nieuwe regulatoren van EPDC mobilisatie een beroep doen op de zuivering van deze cel populatie of het opsporen van de migratie van individuele epicardiale cellen. Een of meer markergenen, waaronder WT1, Tcf21, Tbx18 en / of Aldh1a2, wordt vaak gebruikt om de foetale epicard 1 te identificeren. Het gebruik van deze merkers te sporen migratie EPDC niet optimaal expressie van epicardiale merkers afneemt in de loop van de ontwikkeling van het hart en wordt vaak verloren als epicardiale cellen transdif ondergaanferentiatie in mesenchymale cellen.

De toepassing van de Cre / loxP-systeem, in combinatie met-lineage tracing verslaggevers, is nuttig geweest in permanent het labelen van de epicard en de nakomelingen tijdens de ontwikkeling van het hart en de volgende ischemische schade in de volwassen 7,22,23. Verschillende-epicardiale beperkt Cre lijnen zijn gegenereerd en worden op grote schaal gebruikt om EPDC labelen en voor conditionele gen deletie strategieën 1. Deze studies hebben geleid tot de identificatie van verschillende epicardiale lijnen en de identificatie van kritische mediatoren van EPDC motiliteit en differentiatie. Echter, de opslag bewijs suggereert ook het epicard is een heterogene populatie van voorlopercellen 4,24,25. Derhalve zal slechts een deel van epicardiale cellen worden gericht met een bepaalde Cre driver.

Om de gehele epicard ongeacht Cre specificiteit label, hebben een aantal laboratoria uitgroei cul benuttuur systemen of ex vivo orgaan kweekmethoden trouw isoleren of het etiket epicardiale cellen zonder afhankelijk van de expressie van een genetische markers lijn 26-28. Voor ex vivo migratie studies, zijn embryonale harten die voorafgaand aan epicardiale EMT en gekweekt in medium, aangevuld met een groen fluorescerend eiwit (GFP) tot expressie brengen adenovirus (Ad / GFP) 9,18. Deze benadering maakt een efficiënte labeling van de gehele epicard plaats van een subset van cellen door Cre gemedieerde recombinatie. Hart culturen worden vervolgens blootgesteld aan bekende inductoren van EMT om de mobilisatie van EPDC 28,29 stimuleren. Ex vivo en in vivo analyses worden aangevuld door in vitro epicardiale explantatie culturen, die een bijzonder nuttige benadering voor het verkennen van gedetailleerde mechanismen achter EPDC migratie.

We beschrijven werkwijzen voor het isoleren primaire epicardiale cellen in vitro studies epicardial EMT, alsmede een orgaan kweeksysteem voor ex vivo analyses van EPDC motiliteit. We hebben onlangs aangetoond dat het nut en de robuustheid van deze methode door genetisch moduleren van de myocardin-gerelateerde transcriptiefactor (MRTF) / serum response factor (SRF) signalering as-actine gebaseerde migratie van EPDC 9 manipuleren. Terwijl onze bevindingen benadrukken een signaalroute die nodig zijn voor het regelen EPDC migratie, deze werkwijzen zijn geschikt voor het ontrafelen van de mechanismen die gezamenlijk orkestreren EPDC migratie en differentiatie. Bovendien zou het explantaat en ex vivo kweeksystemen in functionele screens worden uitgevoerd om nieuwe regulatoren van EPDC mobilisatie te identificeren voor therapeutische toepassingen in cardiale regeneratie.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

LET OP: Alle experimenten met muizen werden goedgekeurd door de Universiteit Commissie Animal Resources aan de Universiteit van Rochester.

1. Epicardiale uitgroei Cultuur Assay (Figuur 1A)

  1. voorbereidingen
    1. Bereid 5 ml medium A voor primaire epicardiale celisolatie aanvulling Medium 199 (M199) met 5% foetaal runderserum (FBS) en 1% penicilline / streptomycine (Pen / Strep).
    2. Voorverwarmen medium A en 100 ml Hanks 'Balanced Salt Solution (HBSS) in een 37 ° C waterbad.
    3. Sta-collageen beklede objectglaasjes kamer opwarmen tot kamertemperatuur gedurende 30 min.
    4. Voeg 100 ul medium A aan elk putje van de kamer glijbaan en voorzichtig zwenken gelijkmatig bekleden het collageen oppervlak. Herhaal dit voor 8-12 putten. Verwijder media na coating kamers.
    5. Aliquot voorverwarmde HBSS in twee 10 cm2 platen die 50 ml van HBSS.
  2. Isoleer Embryonale Harten van Zwangere Dam op 11.5 Days bericht coïtum (DPC).30
    1. Verdoven muis met 0,5 ml 13 mg / ml ketamine / 0,88 mg / ml xylazine cocktail in 1 x Dulbecco's fosfaat-gebufferde zoutoplossing (DPBS) via intraperitoneale injectie. Bevestig de juiste verdoving met behulp van een teen pinch-test. Een zachte pinch volstaat om te bepalen of de muis reageert. Elke beweging of poot te trekken geeft het dier onvoldoende verdoofd om een ​​operatie te doen. Euthanaseren door cervicale dislocatie.
    2. Leg de muis gericht ventrale zijde naar boven en spuit de buik met 70% ethanol om verontreiniging met haar te verminderen.
    3. Knijp de huid met een tang en snijd een laterale incisie in de buik met chirurgische schaar. Houd de huid stevig vast en trek uit elkaar in tegengestelde richtingen in de richting van de kop en de staart.
    4. Knijp het buikvlies met een pincet en snijd met een schaar om de buikholte bloot te leggen.
    5. Verwijder de decidua voorzichtig door te snijden langs de mesometrium. Breng de ontleed decidua aan voorverwarmde HBSS in de eerste10 cm 2 plaat.
    6. Scheid de decidua door te snijden tussen embryo's.
    7. Transfer een embryo tot de tweede 10 cm 2 plaat met voorverwarmde HBSS onder een dissectie microscoop. Verwijder de extra-embryonale weefsel en dooierzak, daarna onthoofden het embryo.
    8. Knijp de thoracale wand met een pincet en scheur het weefsel uit elkaar op de middellijn, waardoor de borstholte.
    9. Plaats de tang achter het hart. Pak de uitstroom-darmkanaal en trek het hart van het embryo. Scheid de luchtwegen en de longen uit het hart, als er nog aan.
  3. Transfer het hart om een enkel putje van de met collageen beklede glijbaan en plaats het dorsale zijde naar beneden (Figuur 1B). Herhaal stap 1.2.7-1.3 voor elk embryo.
  4. Zodra alle harten werden overgebracht naar afzonderlijke putjes Incubeer de kamer glijbaan voor 30 min bij 37 ° C, 5% CO 2 voldoende hechting aan de collageenmatrix mogelijk.
  5. voeg voorzichtig20-50 ul voorverwarmde explantatie medium A rond elk hart. Belangrijk: het medium niet te snel of op een niveau boven het hart toe te voegen, anders harten los te maken van het collageen substraat.
  6. Cultuur het hart bij 37 ° C, 5% CO2 gedurende ongeveer 24 uur tot epicardiale uitgroei mogelijk. Opmerking: uitwassen kan worden waargenomen zo vroeg 3-4 uur van de cultuur (figuur 1C) en voornamelijk bestaat uit mesotheelcelsuppletie weergeven van geplaveide morfologie, met een minimale mesenchymale cel contaminatie (figuren 1D, E). Representatieve resultaten werden verkregen onder toepassing van een dissectie microscoop uitgerust met een camera.

2. Genetische Ablation en inductie van EMT in Epicardial uitwassen

Let op: Behandel adenovirussen met zorg volgens de goedgekeurde richtlijnen bioveiligheid.

  1. Bereid 15 ml medium B (M199 aangevuld met 1% FBS en 1% Pen / Strep) en voorverwarmen tot 37 ° C in een waterbad.
  2. Voor excisie vanfloxed allelen, voor te bereiden explantatie medium B, aangevuld met 2,5 x 10 4 pfu / ml adenovirus uitdrukken Cre recombinase (Ad / Cre) of de controle virus.
    Opmerking: Adenovirale gemedieerde overexpressie van kandidaatgenen kan ook worden uitgevoerd om overexpressie-fenotypen evalueren. Virale titers worden bepaald door de eindgebruiker.
  3. Trek-epicard uitgeputte harten van uitgroei culturen behulp van een tang. Overdracht harten 1,5 ml buizen met 800 ul Trizol en bewaar bij -80 ° C voor latere RNA-isolatie en genexpressie analyse.
  4. Was elk putje DPBS met bloedcellen en overmatige celresten te verwijderen.
  5. Voeg 500 ul explantaat medium gesupplementeerd met B adenovirus (n) bij elke uitgroei cultuur en incubeer gedurende 24 uur bij 37 ° C, 5% CO2.
  6. Voor EMT inductie, verwijder de media en aan te vullen met 37 ° C explantatie medium B, aangevuld met recombinant transformerende groeifactor (TGF) -β1 [10 ng / ml] of voertuig (4 mm hydrochloric zuur (HCl) bevattende 1 mg / ml runderserumalbumine (BSA)). Explantaten cultuur nog eens 24 uur bij 37 ° C, 5% CO2. Ga verder met gen / eiwit expressie analyses of immunocytochemie zoals beschreven in de daaropvolgende protocollen.
    Noot: Inductie van epicardiale EMT werd gestimuleerd met diverse concentraties van TGF-β1 variërend van 0,5 ng / ml - 10 ng / ml 26,31-33. Hogere concentraties van ligand kan leiden tot niet-specifieke binding aan alle TGF-β receptoren. De concentratie van TGF-β1 moet de specifieke experimentele doelen weerspiegelen.

3. genexpressie analyse van Epicardial uitwassen

  1. Dooi-epicard uitgeputte harten eerder opgeslagen in Trizol (2.2).
  2. Aspireren media van EPDC culturen en twee keer wassen met DPBS.
  3. Voeg 800 ul kamertemperatuur Trizol culturen explantatie.
  4. Incubeer-epicard verarmd harten en EPDC culturen in Trizol gedurende 5 minuten bij kamertemperatuur tempera opnieuw. Pipet op en neer tien keer aan de gelyseerde monster homogeniseren.
    Opmerking: Hearts kan verder pipetteren nodig om volledig te homogeniseren.
  5. Transfer lysaten naar 1,5 ml buisjes en vult totaal RNA geïsoleerd volgens de instructies van de fabrikant. Voeg 10 pg glycogeen vóór precipitatie van RNA opbrengst te verhogen. Een gegeven explantaat wordt ongeveer 0,5-1,0 ug RNA werd verkregen.
  6. Verwijder verontreinigend DNA met DNase I en reverse transcriberen 0,5 ug mRNA instructies van de fabrikant.
  7. Valideer de zuiverheid van epicardiale explantaten en / of inductie van EMT kwantitatieve reverse transcriptie (qRT) -PCR 34 middels SYBR groen en de in Tabel 1 beschreven. Normaliseren mRNA niveaus glyceraldehyde 3-fosfaat dehydrogenase (GAPDH) markers en bereken relatieve expressie middels de 2 - methode ΔΔCt 35. Typische resultaten worden getoond in Figuur 2A.
title "> 4. Protein Analyse van Epicardial uitwassen

  1. Aspireren media van EPDC culturen en twee keer wassen met DPBS.
  2. Voeg 10 ul ijskoude eiwit lysisbuffer (50 mM Tris pH 7,5, 150 mM natriumchloride, 1 mM ethyleendiaminetetra-azijnzuur pH 8,0, 1% Triton X-100, 1x proteaseremmer cocktail) naar elke kamer goed en plaats de kamer dia ijs. Snijd ongeveer ¼ van de bodem op een P200 pipet tip en het gebruik van de resterende stuk naar de cellen af ​​te schrapen van de dia. Pipet op en neer om Lyse epicardiale cellen en transfer naar een 1,5 ml buis.
  3. Ultrasone trillingen gelyseerde explantaten op laag (160 W) gedurende 5 minuten in een ijswaterbad met 30 sec ON en OFF cycli.
  4. Centrifuge lysaten gedurende 10 min bij 10.000 xg, 4 ° C. Transfer supernatant naar een nieuwe buis en bepaal de eiwitconcentratie met behulp van een proteïne assay 36.
    Opmerking: Een gegeven explantatie tot 1,5 ug totaal eiwit werd verkregen. We hebben ontdekt dat het bundelen van explantaten uit twee harten eend laden 2 ug eiwit per putje is voldoende om gladde spier α-actine (ACTA2) en GAPDH 9 detecteren. De detectie van andere doeleiwitten nodig bundeling meerdere explantatie monsters zoals bepaald door de eindgebruiker.

5. Immunocytochemie van Epicardial uitwassen

  1. Verwijder het afdrukmateriaal uit Explantatie culturen en twee keer wassen met DPBS.
  2. Voorzichtig voeg 500 pl 4% (v / v) paraformaldehyde of ijskoude methanol aan elk putje en vast explantaten gedurende 5 minuten bij kamertemperatuur of 10 minuten bij -20 ° C, respectievelijk. Fix volgens antilichaam specificaties zoals aanbevolen door de fabrikant.
  3. Verwijder fixatief en spoel elk putje DPBS met driemaal gedurende 5 minuten.
  4. Permeabilize de cellen met 500 pl 0,1% (v / v) Triton X-100 in DPBS gedurende 5 min.
  5. Verwijderen permeabilisatie oplossing en spoelen met DPBS driemaal gedurende 5 minuten.
  6. Blokkeer de cellen met 10% serum in DPBS gedurende 30 minuten bij kamertemperatuur temperaopnieuw.
  7. Doorgaan met primair antilichaam kleuring volgens de aanbevelingen van de fabrikant en optimale condities zoals bepaald door de eindgebruiker.
  8. Verwijderen antilichaamoplossing en spoelen met DPBS driemaal gedurende 5 minuten.
  9. Solliciteer secundair antilichaam volgens de instructies en tegenkleuring van de fabrikant met een geschikte nucleaire kleurstof.
  10. Verwijderen antilichaamoplossing en spoelen met DPBS driemaal gedurende 5 minuten.
  11. Verwijder kamer glijwanden instructies van de fabrikant en deze direct in waterig montage medium aan de cellen. Plaats een dekglaasje over de cellen en de afdichting met nagellak. Typische resultaten worden getoond in Figuur 2B - 2D middels omgekeerde confocale scanning microscopie.

6. Ex Vivo Cultuur Assay (figuur 3A)

  1. voorbereidingen
    1. Bereid 12 ml ex vivo kweekmedium met een (1: 1) mengsel van Dulbecco's Modified Eagle Medium (DMEM): M199 aangevuld met 10%FBS en 1% Pen / Strep.
    2. In een 37 ° C waterbad, pre-warm ex vivo kweekmedium en 100 ml HBSS.
    3. Aliquot 1 ml voorverwarmd medium in 8-12 putjes van een plaat met 24 putjes.
    4. Overdracht voorverwarmd HBSS twee 10 cm 2 platen gemaakt met 50 ml elk.
  2. Isoleer muis embryonale harten in HBSS (zoals beschreven in 1.2) van zwangere dammen op 12,5 dpc.
  3. Transfer elk hart om een enkel putje van de plaat met 24 putjes met ex vivo kweekmedium. Incubeer de plaat bij 37 ° C, 5% CO 2 onder zacht schommelen handmatig of met behulp van een schudapparaat om hechting te voorkomen. Onmiddellijk ga dan naar stap 7.1.

7. Epicardiale Labeling en EMT inductie in Ex Vivo Cultures

  1. Om de epicard labelen, voor te bereiden 12 ml van 37 ° C ex vivo kweekmedium aangevuld met 3,0 x 10 6 pfu / ml van Ad / GFP. Voor gerichte ablatie van floxed allelen, overdracht 6 ml Ad / GFP aangevuld kweekmedium om een ​​nieuwe 15 ml conische buis. Voeg Ad / Cre of adenovirus regelen tot een uiteindelijke concentratie van 1,5 x 10 6 pfu / ml.
    Noot: overexpressie-analyses kunnen worden uitgevoerd met geschikte adenovirale gemedieerde genafgifte uitgevoerd.
  2. Verwijder voorzichtig het kweekmedium uit elk putje van de plaat met 24 putjes met behulp van een P1,000 pipet tip.
  3. Voorzichtig voeg kweekmedium aangevuld met adenovirus (n) aan elk putje.
  4. Incubeer de plaat bij 37 ° C, 5% CO2 gedurende 24 uur onder voorzichtig schommelen.
  5. Voor EMT inductie bereiden 12 ml van 37 ° C ex vivo kweekmedium dat 10 ng / ml TGF-β1 en 20 ng / ml van bloedplaatjes afgeleide groeifactor (PDGF) -BB of drager (4 mM HCl dat 1 mg / ml BSA ).
  6. Haal kweekmedium uit elk putje van de plaat met 24 putjes met behulp van een P1,000 pipet tip. Voorzichtig spoel de harten met 1 ml DPBS.
  7. Verwijder de DPBS en vul harten met ex vivo cultuur medium met TGF-β1 en PDGF-BB of voertuig.
  8. Incubeer gedurende 24 uur bij 37 ° C, 5% CO 2 onder voorzichtig schommelen.

8. Cryopreservatie en Immunohistochemie van ex vivo culturen

  1. Bereid de Harten voor Cryopreservatie.
    1. Verwijder het kweekmedium en was harten tweemaal met ijskoud DPBS.
    2. Voeg 1 ml van 4% (v / v) paraformaldehyde elk hart en vaststellen voor 2 uur bij 4 ° C onder voorzichtig schommelen.
    3. Verwijder het fixeermiddel en was tweemaal met DPBS harten. Breng de harten verse putjes met 1 ml 10% (w / v) sucrose bereid in DPBS. Incubeer de plaat overnacht bij 4 ° C met zachte wiegen.
    4. Zorgvuldig overdragen harten nieuwe putjes met 18% (w / v) sucrose bereid in DPBS. Incubeer de plaat overnacht bij 4 ° C met zachte wiegen.
    5. Transfer elk hart een cryomold die weefsel bevriezen medium. Onmiddellijk te bevriezen blokken met behulp van vloeibare stikstof en bewaar bij -80 & #176; C.
  2. Sectie harten op 5 micrometer met behulp van een cryostaat en plaats weefselcoupes op positief geladen objectglaasjes. WINKEL glijdt bij -80 ° C tot kleuring.
  3. Voer immunohistochemie op de afdelingen voor de detectie van de sub-epicardiale basaal membraan.
    1. Slides ontdooien gedurende ten minste 30 minuten bij kamertemperatuur.
    2. Hydrateren de secties door twee keer wassen in DPBS gedurende 5 min met zachte wiegen.
    3. Doorlaatbaar gedeelte met 0,1% (v / v) Triton X-100 in PBS gedurende 5 minuten bij kamertemperatuur.
    4. Was de dia's twee keer in DPBS gedurende 5 min met zachte wiegen.
    5. Dep het overtollige DPBS en definieer de kleuring regio met een hydrofobe etikettering pen. Blokdelen met 10% serum in DPBS gedurende 30 minuten bij kamertemperatuur.
    6. Verwijder blok en gelden collageen type IV antilichaam (ColIV, 1: 200) verdund in blok. Incubeer overnacht bij 4 ° C in een vochtigheid geregelde kamer.
    7. Was de glaasjes drie keer in DPBS voor5 min met zachte wiegen.
    8. Verdunnen fluorescent geconjugeerd secundair antilichaam (1: 500) en DAPI (1: 5000) in DPBS en gelden voor de glijbanen. Incubeer gedurende 1 uur bij kamertemperatuur geroerd. Kies een geschikte secundair antilichaam met een emissiegolflengte en excitatie onderscheiden van GFP.
    9. Was de dia's drie keer in PBS gedurende 5 minuten met zachte wiegen. Mount dia's met montage medium.

9. Imaging en kwantificering van ex vivo culturen

  1. Hebben afbeelding een geblindeerde gebruiker en kwantificeren gekleurde coupes. Van minimaal vijf niet-opeenvolgende weefselcoupes van een bepaald hart in 4-5 willekeurige plaatsen langs het epicard (rand van het hart) met een fluorescerende of confocale microscoop bij een vergroting van 40x. Typische resultaten worden getoond in figuur 3B middels omgekeerde confocale scanning microscopie.
  2. Handmatig tellen het aantal GFP-positieve cellen in dezelfde afbeelding. Identificeer migreren EPDC als GFP positive cellen die zich binnen of buiten de ColIV subepicardiale basaal membraan. Bepaal het percentage GFP migrerende cellen als het aantal migrerende GFP positieve cellen over het aantal GFP-positieve cellen in dezelfde afbeelding. Typische resultaten worden getoond in figuur 3C-D middels omgekeerde confocale scanning microscopie.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

De epicard kan efficiënt worden geïsoleerd met behulp van een uitloper cultuur assay door gebruik te maken van het exterieur locatie en het benutten van de ontwikkelingsplasticiteit en intrinsieke migratiegedrag van EPDC. Muriene embryonale harten zijn geïsoleerd aan E11.5 voorafgaand aan epicardiale EMT en beschaafde dorsale zijde naar beneden op de collageen-gecoate kamer dia's 26 (figuur 1 A, B). Geëxplanteerde harten zal blijven krimpen; Toch zal de epicard houden aan de collageenmatrix en migreren af van de hartspier binnen 24 h kweek (Figuur 1C). Epicardiale cellen kan worden waargenomen van het hart afkomstige met geplaveide morfologie, indicatief mesotheelcellen identiteit (Figuren 1C-E). Na 24 uur van de cultuur, zijn-epicard uitgeput harten verwijderd gen of eiwit expressie analyse.

Naast observeren epithelial morfologie, kan de zuiverheid van epicardiale celculturen verder gevalideerd door de expressie van epicardiale beperkte gen- en eiwit markers. Epicardiale cel explantaten tonen robuuste expressie van epicardiale en mesothelial markers (Aldh1a2, Tcf21 en WT1) en lage expressie van genen cardiomyocyt (Nkx2-5 en MYH7) in vergelijking met-epicard uitgeputte hearts (Figuur 2A). Om de identiteit verder te verifiëren, worden epicardiale celculturen vaste 48 uur na verwijdering van het hart en de co-gekleurd met antilichamen tegen Wilms tumor 1 (WT1) en zona occludens eiwit 1 (ZO1) naar mesotheelcelsuppletie en intercellulaire krappe kruispunten, respectievelijk 37,38 label ( figuur 2B). Deze uitgroei cultuur methode levert een relatief hoge zuiverheid van mesotheelcelsuppletie; Echter, kunnen gebruikers een klein percentage van cellen besmet observeren. Fibroblasten en gladde spiercellen vertonen een langwerpig mesenchymale fenotype met een opmerkelijke afwezigheid van nucleofiele exocyclische aminefunctiesar WT1 en georganiseerde krappe kruispunten (figuur 2C). Problemen oplossen technieken te beperken de hoeveelheid niet-epicardiale cel besmetting worden uitgebreid in de discussie.

De explantaat uitgroei test is een nuttig cultuur systeem voor het ondervragen epicardiale biologie in vitro. Epicardiale cellen plasticiteit te tonen, werden explantaten gestimuleerd met TGF-β1 [10 ng / ml] tot transdifferentiatie induceren in mesenchymale cellen 26,28. Na 24 uur stimulatie, EPDC keur een mesenchymale fenotype met verminderde ZO1 kleuring en robuuste de novo vorming van gladde spier α-actine positieve stressvezels (ACTA2 of SMA), met name aan de omtrek van de kweek 39 (figuur 2D, red). In tegenstelling tot vezelsamenstel wijzen aan de omtrek van explantaten, epicardiale confluente cellen met meer gedefinieerde intercellulaire contacten (ZO1, groen) in het midden van een monolayer vertoning ACTA2 eiwitexpressie in corticale actine.

Naast EMT ondergaan, zal EPDC het myocardium vallen en te differentiëren, een wezenlijk aandeel niet-cardiomyocyt populaties. De beweeglijkheid van EPDC kan worden beoordeeld met behulp van een eerder vastgestelde ex vivo orgelcultuur systeem waarbij de buitenkant van E12.5 harten zijn gelabeld met een adenovirus die GFP 9,18 (figuur 3A). Gelabelde hart verder gekweekt gedurende drie dagen in de aanwezigheid van TGF-β1 [10 ng / ml] en PDGF-BB [20 ng / ml] te EPDC migratie te bevorderen. Orgaankweken periodiek gedraaid om de hechting van ex vivo harten voorkomen dat het oppervlak van kweekplaten. Dit systeem maakt een efficiënte labeling van de gehele epicard en beoordeling van EPDC motiliteit in een driedimensionaal model tegenover directionele migratie in vitro assays scratch. De migratie van EPDC is opmerved de invasie van GFP positieve epicardiale cellen in of voorbij de ColIV (rode) subepicardiale basismembraan 16 (figuren 3B, C). Om de bruikbaarheid van dit systeem te illustreren, hebben we onlangs aangetoond dat manipulatie van de MRTF / SRF signalering as kan de beweeglijkheid van EPDC 9 beïnvloeden. Schrapping van Mrtfa en Mrtfb door Cre-gemedieerde excisie van floxed allelen (MRTFdKO) verzwakt de migratie van EPDC in de subepicardiale ruimte. Omgekeerd gedwongen expressie van MRTF-A (Ad / MRTF-A) C57BL / 6 harten resulteert in verhoogde EPDC migratie en verstoring van de ColIV basismembraan (Figuur 3C, D).

Gen vooruit Omgekeerde NCBI toetreding
Aldh1a2 GGCACTGTGTGGATCAACTG TCACTTCTGTGTACGCCTGC NM_009656
GAPDH CGTGCCGCCTGGAGAAAC TGGGAGTTGCTGTTGAAGTCG NM_001289726
MYH7 GTGGCTCCGAGAAAGGAAG GAGCCTTGGATTCTCAAACG NM_080728
Nkx2-5 GACGTAGCCTGGTGTCTCG GTGTGGAATCCGTCGAAAGT NM_008700
Tcf21 CATTCACCCAGTCAACCTGA CCACTTCCTTCAGGTCATTCTC NM_011545
WT1 ATCCGCAACCAAGGATACAG GGTCCTCGTGTTTGAAGGAA NM_144783

Tabel 1: Sequenties van Forward en Reverse primers gebruikt voor de validatie van epicardiale uitgroei Culture Zuiverheid door middel van analyse van epicard en myocard Restricted Genexpressie Genexpressie wordt bepaald door de qRT-PCR wi.ste de volgende parameters: denatureren bij 95 ° C gedurende 10 seconden; gloeien bij 60 ° C gedurende 30 seconden; herhaal 50x cycli.

Figuur 1
Figuur 1: Isolatie van primaire epicardiale cellen met behulp van een uitgroei Culture Assay (A) Een schematische voorstelling van de epicardiale uitgroei explantatie test met een aanbevolen tijdschema voor epicardiale modulatie en analyse.. (B - E) Vertegenwoordiger helderveld beelden van verschillende tijdstippen tijdens de explantatie test. (B) embryonale dag E11.5 muizen harten worden geplaatst dorsale zijde naar beneden op een collageen substraat. (C) epicardiale cellen (witte pijlpunten) zal beginnen te migreren het hart binnen 3-4 uur van de cultuur. Bloedcellen (zwarte pijlen) kan zich ophopen in de omgeving of bedek explantaten tijdens epicardiale uitgroei. (D, E) Naongeveer 24 uur van de cultuur, zijn hart verwijderd en epicardiale monolagen blijft gehecht aan de kamer dia. Cellular uitwassen tonen epitheliale morfologie met een geplaveide-achtige regeling van de cellen. Schaalbalken = 250 urn (BD) of 50 urn (C, E). H = hart, LA = linkerboezem, LV = linkerkamer, OFT = uitstroom, RA = rechts atrium, RV = rechter ventrikel. Klik hier om een grotere versie van deze figuur te bekijken.

figuur 2
Figuur 2: Evaluatie van Epicardial Cell uitgroei Purity (A) qRT-PCR validatie van epicardiale beperkt markers (Tcf21, Aldh1a2 en WT1) in uitgroei culturen ten opzichte van het myocard genexpressie (Nkx2-5 en MYH7) in-epicard uitgeputte E11.. 5 harten. gegevens vertegent de gemiddelde ± SEM (n = 8 per groep). Sterretjes geven statistische significantie onder toepassing van een Student t-proef met **** P <0,0001. (B) Representatieve co-immunofluorescentie kleuring van ongestimuleerde uitwassen voor epicardiale expressie (WT1, rood), intercellulaire tight junctions (ZO1, groen) en kernen (DAPI, blauw). (C) Een voorbeeld van een cel besmetting in een uitloper cultuur. Epicardiale cellen (asterisk) worden waargenomen aan de rechterkant van het panel met karakteristieke mesotheelcellen identiteit (nucleaire WT1, rood) en georganiseerde epitheliale tight junctions (ZO1, groen). De aangrenzende cellen in het centrum (witte pijlpunten) vertonen een langwerpig mesenchymale morfologie, getoond door differentiële interferentie contrast (DIC) beeldvorming, met een minimum aan nucleair WT1 eiwit en ongeorganiseerde ZO1 kleuring. (D) epicardiale celkweken werden gestimuleerd met vehiculum (4 mM HCl in 1 mg / ml BSA) of TGF-β1 [10 ng / ml] te induceren epicardialeEMT. TGF-β1 stimulatie bevordert robuuste expressie van ACTA2 (rood) in corticale gebieden van confluente cellen in het midden van explantaten of stressvezels cellen migreren aan de rand of omtrek van de monolaag. Cell verklevingen worden gelabeld door ZO1 (groen). Schaal bars = 25 pm (BD). Klik hier om een grotere versie van deze figuur te bekijken.

figuur 3
Figuur 3: Ex vivo bepaling van EPDC Beweeglijkheid (A) Een schematisch een tijdlijn van het ex vivo hart kweektest.. (B) Een representatieve 5 urn doorsnede van een C57BL / 6 E12.5 hart getransduceerd met Ad / GFP (groen) voor 24 uur aan de buitenkant van het hart labelen. Ex vivo harten werden vervolgens gekweekt gedurende nog 48 uur met TGF β1 [10 ng / ml]en PDGF-BB [20 ng / ml] te EPDC migratie stimuleren. Secties werden gekleurd voor co-ColIV (rood) naar de subepicardiale basaalmembraan en kernen (DAPI, blauw). Ex vivo hart cultuur morfologie wordt getoond door DIC labelen. LV = linkerkamer, RV = rechter ventrikel, RA = rechts atrium. (C, D) Een voorbeeldtoepassing van de ex vivo migratie assay door het moduleren van de MRTF / SRF regulerende as. Dit cijfer is gewijzigd ten opzichte van [9]. E12.5 harten werden geïsoleerd uit Mrtfa - / -;. Mrtfb fl / fl embryo en getransduceerd met Ad / GFP en controle virus of een adenovirus Cre recombinase voor 24 uur ex vivo kweken werden vervolgens gestimuleerd met TGF-β1 [10 ng / ml] en PDGF-BB [20 ng / ml] gedurende nog 48 uur. EPDC motiliteit (witte pijlen) wordt waargenomen als de migratie van GFP positieve cellen (groen) in of voorbij de ColIV (rood). Cre-gemedieerde deletie van Mrtfb in de <em> Mrtfa - / - achtergrond (MRTFdKO) leidt tot verzwakking van EPDC migratie in vergelijking met harten beheersen. Omgekeerd, gedwongen expressie van MRTF-A (Ad / MRTF-A) in E12.5 C57BL / 6 harten verbetert EPDC migratie. (D) Kwantificering van% GFP positieve cel migratie. Gegevens zijn weergegeven als gemiddelde ± SEM (n = 4 harten per conditie). Gegevens werden geanalyseerd met een eenzijdige ANOVA met sterretjes duiden statistische significantie door Tukey post-hoc testen met **** P <0,0001. Schaalbalken = 200 urn (B) of 25 urn (C). Alle beelden werden verkregen met behulp van omgekeerde confocale laser scanning microscopie. Klik hier om een grotere versie van deze figuur te bekijken.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Hier schetsen we gedetailleerde methoden om primaire epicardiale cellen te isoleren door uitgroei en volgen EPDC migratie in ex vivo hart culturen. Voor uitgroei culturen, het juiste moment om de epicard uitgeputte hart te verwijderen verschilt enigszins tussen de experimenten. Periodieke controle van de explantaten na een nacht incubatie wordt aanbevolen om te peilen naar de omvang van de epicardiale uitgroei en het hart uit te pakken voordat fibroblasten verschijnen. Om de zuiverheid te garanderen, moet harten worden verwijderd binnen 24 uur van explanterende tot ophoping van niet-epicardiale lijnen te voorkomen. Trimmen weg de uitstroom-darmkanaal en beide atria voorafgaand aan de overdracht van het hart om een kamer slide kan ook een vermindering van vervuilende types 27,40 cel. Aangezien foetale hart tijdens een smal tijdvenster van een muis nest zijn geïsoleerd en gekweekt onder dezelfde omstandigheden, de tijd voor uitwassen verschijnt is vrij gelijkaardig van het ene hart naar het andere binnen een experiment. Daarom moeten alle harten be verwijderd wanneer de meerderheid van de explantaten vertonen epicardiale uitwassen. In sommige gevallen hebben epicardiale cellen niet efficiënt migreren vanuit een hart dat krachtiger samentrekt dan de andere, waarbij deze explantaat uit het experiment moet worden uitgesloten.

De accumulatie van bloedcellen vaak verhullen een vlakke monolaag van epicardiale cellen (pijlen, Figuur 1C), waardoor het moeilijk uitwassen visualiseren. Buitensporige bijdrage bloedcellen voorkomen, kan harten in HBSS gedurende een paar minuten na dissectie van het embryo. Dit laat voldoende tijd voor het foetale hart te pompen uit de resterende bloed in de hartkamers alvorens te worden overgebracht naar een kamer dia. Als alternatief, ter aanvulling van de culturen met explantaat medium A na de eerste nacht incubatie zal helpen om weg te spoelen een aantal overtollige bloed en onthullen uitwassen; echter, moet het niveau van media niet boven het hart als de oppervlaktespanning het hart kan leidenweg van het substraat trekken. Robuuste epicardiale uitwassen worden waargenomen met behulp van collageen type I als de cultuur substraat; echter zijn andere substraten gemeld afhankelijk van het organisme en / of toepassing 27,40-42. Met behulp van dit protocol, kan primaire foetale epicardiale cellen gedijen voor 4 dagen na de verwijdering van het hart en de dagelijkse medium aanvullen; moet echter experimentele ontwerpen vereisen langere kweek worden bepaald door de eindgebruiker. Aangezien epicardiale EMT sterk tijdens de embryonale ontwikkeling is geactiveerd, wordt deze uitgroei kweektechniek beperkt tot de verrijking van foetale epicardiale cellen. Andere groepen hebben werkwijzen beschreven volwassen epicard cellen 43,44 isoleren.

Voor ex vivo migratie assays, hart extractie en epicardiale cellen labeling aanbevolen bij E12.5 om twee redenen. Ten eerste, harten geïsoleerd na E12.5 zijn groter en dus vereisen meer perfusie om de levensvatbaarheid te ondersteunen. Eenvoudige diffusie van voedingsstoffens is niet voldoende om orgaankweken handhaven van grotere harten. Ten tweede, epicardiale EMT en EPDC migratie optreden rond E12.5. Daarom moet het epicard worden gelabeld met een adenovirus een fluorescerend eiwit direct na extractie hart op de detectie van EPDC maximaliseren. Alternatief carboxyfluoresceïne diacetaat succinimidyl ester (CFSE) is eerder gemeld aan de buitenkant van het hart labelen en sporenelementen EPDC migratie 10,45.

In tegenstelling tot de uitgroei assays, moet ex vivo culturen periodiek worden geschud om het hart gehechtheid en epicardiale cel uitgroei voorkomen. Culturen kan ook continu worden geschud in een incubator uitgerust met een rocker op de laagste snelheid. Gebruikers zullen merken veranderingen in de cardiale morfologie binnen een paar dagen van de orgelcultuur en mag analyses dan 72 uur van het hart isolement te voorkomen. Gebruik van deze bepaling wordt EPDC invasie waargenomen binnen 48 tot 72 uur van de cultuur. Terwijl het Cre-loxP systeemis gebruikt in vivo voor de lokalisatie van EPDC toewijzen aan het coronaire vaatstelsel, het myocardium interstitium, en het septum 7,22 Dit ex vivo techniek is beperkt tot EPDC migratie binnen een paar cellagen van de sub-epicardiale space. Aldus is deze methode is geschikt voor het bepalen regulatoren van EPDC motiliteit en invasie plaats waarin de eindbestemming migreren EPDC.

Epicardiale cel isolaties en ex vivo migratie assays, in combinatie met de winst of het verlies van functie aanpak, hebben al nuttig zijn voor het evalueren van kandidaat-genen die invloed kunnen hebben EPDC biologie 9,18,46 bewezen. Deze methoden bieden ook een platform voor gain-of-functie of loss-of-function screens voor nieuwe regulatoren van EPDC migratie te identificeren. Deze strategie, in combinatie met fluorescentie-geactiveerde celsortering of enkele cel RNA-sequencing kan ook een mogelijkheid om epicardiale heterogeniteit sondeen EPDC differentiatie in meer detail. Tenslotte kunnen modificaties van deze procedures worden gebruikt om de schermen te ontwikkelen voor kleine moleculen die invloed epicardiale cellen en EPDC biologie behoeve van cardiale regeneratieve geneeskunde.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgements

EMS werd ondersteund door subsidies van de National Institutes of Health (NIH) [licentienummer R01HL120919]; de American Heart Association [subsidie ​​aantal 10SDG4350046]; University of Rochester CTSA onderscheiding van de NIH [toekenningsnummer UL1 TR000042]; en inbedrijfstelling fondsen van de Aab CVRI. MAT werd mede ondersteund door een subsidie ​​van de Universiteit van Rochester School of Medicine en Tandheelkunde van het Howard Hughes Medical Institute Med-Into-Grad Initiative; en een Institutioneel Ruth L. Kirschstein National Research Service Award van de NIH [toekenningsnummer GM068411].

Materials

Name Company Catalog Number Comments
Dulbecco's Modified Eagle Medium Hyclone  SH3002201 DMEM
Hanks' Balanced Salt Solution Hyclone SH3003102 HBSS
Medium 199 Hyclone SH3025301 M199
Dulbecco’s Phosphate-Buffered Saline  Hyclone SH3002802 DPBS
Fetal Bovine Serum  Gemini  100-106 FBS
Penicillin/Streptomycin Solution Hyclone SV30010
Corning Biocoat Collagen I, 4-Well Culture Slides Corning 354557
Multiwell 24-well plates Falcon 08-772-1
Dissecting microscope Leica M50 Equipped with Leica KL300 LED might source
Confocal miscroscope Olympus 1X81 Equipped with muli-argon laser 405/488/515, FV10-MCPSU laser 405/440/635, 559 laser, and mercury lamp
Bioruptor Diagenode  UCD-200
Transforming growth factor beta 1 R&D Systems 100-B-001 TGF-β1
Platelet-derived growth factor BB R&D Systems 220-BB-010 PDGF-BB
Trizol Reagent Applied Biosystems 15596-026 Caution, hazardous material
TURBO DNA-free Kit Life Technologies AM1907 DNaseI
iScript cDNA Synthesis Kit BioRad 1708891
UltraPure Glycogen Life Technologies 10814-010
SYBR Green BioRad 170-8880
Protease inhibtor cocktail tablets Roche 11836170001
Alexa Goat-anti-rabbit 488 Life Technologies A11008 Secondary antibody
Alexa Goat anti-rabbit 594 Life Technologies A-11012 Secondary antibody
Alexa Goat anti-mouse 594 Life Technologies A-11005 Secondary antibody
Mouse anti-smooth muscle alpha actin, Cy3-conjugated  Sigma-Aldrich C6198 monoclonal antibody, clone 1A4
Mouse anti-Wilms tumor 1 (WT1) Life Technologies MA1-46028 monoclonal antibody, clone 6F-H2
Rabbit anti-ZO1 Life Technologies 40-2200 polyclonal antibody
Rabbit anti-Collagen Type 4 Millipore AB756P polyclonal antibody
4',6-Diamidino-2-Phenylindole, Dihydrochloride  Life Technologies D1306 DAPI
Fluorescent mounting medium  DAKO S3023
16% Paraformaldehyde solution Electron Microscopy Sciences 15710 PFA diluted to 4% in DPBS. Caution, hazardous material
Sucrose Sigma-Aldrich S0389
Tissue Freezing Medium Triangle Biomedical Sciences TFM-B
Pap pen DAKO S2002
Disposable mictrotome blades  Sakura Finetek 4689
Microscope slides Globe Scientific 1358W positively charged, 25 mm x 75 mm x 1 mm
Cryostat  Leica CM1950
Forceps Fine Science Tools 11295-00
Surgical Scissors Fine Science Tools 91460-11
Disposable base molds Fisher Scientific 22-363-553
Ketamine Hospira NDC 0409-2051-05
Xylazine Akorn NADA 139-236

DOWNLOAD MATERIALS LIST

References

  1. von Gise, A., Pu, W. T. Endocardial and epicardial epithelial to mesenchymal transitions in heart development and disease. Circ Res. 110, 1628-1645 (2012).
  2. Martinez-Estrada, O. M., et al. Wt1 is required for cardiovascular progenitor cell formation through transcriptional control of Snail and E-cadherin. Nat Genet. 42, 89-93 (2010).
  3. Gittenberger-de Groot, A. C., Vrancken Peeters, M. P., Mentink, M. M., Gourdie, R. G., Poelmann, R. E. Epicardium-derived cells contribute a novel population to the myocardial wall and the atrioventricular cushions. Circ Res. 82, 1043-1052 (1998).
  4. Katz, T. C., et al. Distinct compartments of the proepicardial organ give rise to coronary vascular endothelial cells. Dev Cell. 22, 639-650 (2012).
  5. Mikawa, T., Gourdie, R. G. Pericardial mesoderm generates a population of coronary smooth muscle cells migrating into the heart along with ingrowth of the epicardial organ. Dev Biol. 174, 221-232 (1996).
  6. Wilm, B., Ipenberg, A., Hastie, N. D., Burch, J. B., Bader, D. M. The serosal mesothelium is a major source of smooth muscle cells of the gut vasculature. Development. 132, 5317-5328 (2005).
  7. Zhou, B., et al. Epicardial progenitors contribute to the cardiomyocyte lineage in the developing heart. Nature. 454, 109-113 (2008).
  8. Dettman, R. W., Denetclaw, W., Ordahl, C. P., Bristow, J. Common epicardial origin of coronary vascular smooth muscle, perivascular fibroblasts, and intermyocardial fibroblasts in the avian heart. Dev Biol. 193, 169-181 (1998).
  9. Trembley, M. A., Velasquez, L. S., de Mesy Bentley, K. L., Small, E. M. Myocardin-related transcription factors control the motility of epicardium-derived cells and the maturation of coronary vessels. Development. 142, 21-30 (2015).
  10. Mellgren, A. M., et al. Platelet-derived growth factor receptor beta signaling is required for efficient epicardial cell migration and development of two distinct coronary vascular smooth muscle cell populations. Circ Res. 103, 1393-1401 (2008).
  11. von Gise, A., et al. WT1 regulates epicardial epithelial to mesenchymal transition through beta-catenin and retinoic acid signaling pathways. Dev Biol. 356, 421-431 (2011).
  12. Lavine, K. J., et al. Endocardial and Epicardial Derived FGF Signals Regulate Myocardial Proliferation and Differentiation In Vivo. Dev Cell. 8, 85-95 (2005).
  13. Sanchez, N. S., Barnett, J. V. TGFbeta and BMP-2 regulate epicardial cell invasion via TGFbetaR3 activation of the Par6/Smurf1/RhoA pathway. Cell Signal. 24, 539-548 (2012).
  14. Dettman, R. W., Pae, S. H., Morabito, C., Bristow, J. Inhibition of 4-integrin stimulates epicardial-mesenchymal transformation and alters migration and cell fate of epicardially derived mesenchyme. Dev Biol. 257, 315-328 (2003).
  15. Rhee, D. Y., et al. Connexin 43 regulates epicardial cell polarity and migration in coronary vascular development. Development. 136, 3185-3193 (2009).
  16. Wu, M., et al. Epicardial spindle orientation controls cell entry into the myocardium. Dev Cell. 19, 114-125 (2010).
  17. Hirose, T., et al. PAR3 is essential for cyst-mediated epicardial development by establishing apical cortical domains. Development. 133, 1389-1398 (2006).
  18. Baek, S. T., Tallquist, M. D. Nf1 limits epicardial derivative expansion by regulating epithelial to mesenchymal transition and proliferation. Development. 139, 2040-2049 (2012).
  19. Lu, J., et al. Coronary smooth muscle differentiation from proepicardial cells requires rhoA-mediated actin reorganization and p160 rho-kinase activity. Dev Biol. 240, 404-418 (2001).
  20. Combs, M. D., Braitsch, C. M., Lange, A. W., James, J. F., Yutzey, K. E. NFATC1 promotes epicardium-derived cell invasion into myocardium. Development. 138, 1747-1757 (2011).
  21. Acharya, A., et al. The bHLH transcription factor Tcf21 is required for lineage-specific EMT of cardiac fibroblast progenitors. Development. 139, 2139-2149 (2012).
  22. Zhou, B., von Gise, A., Ma, Q., Hu, Y. W., Pu, W. T. Genetic fate mapping demonstrates contribution of epicardium-derived cells to the annulus fibrosis of the mammalian heart. Dev Biol. 338, 251-261 (2010).
  23. Zhou, B., et al. Adult mouse epicardium modulates myocardial injury by secreting paracrine factors. J Clin Invest. 121, 1894-1904 (2011).
  24. Singh, M., Epstein, J. Epicardial Lineages and Cardiac Repair. Journal of Developmental Biology. 1, 141-158 (2013).
  25. Braitsch, C. M., Combs, M. D., Quaggin, S. E., Yutzey, K. E. Pod1/Tcf21 is regulated by retinoic acid signaling and inhibits differentiation of epicardium-derived cells into smooth muscle in the developing heart. Dev Biol. 368, 345-357 (2012).
  26. Austin, A. F., Compton, L. A., Love, J. D., Brown, C. B., Barnett, J. V. Primary and immortalized mouse epicardial cells undergo differentiation in response to TGFbeta. Developmental dynamics : an official publication of the American Association of Anatomists. 237, 366-376 (2008).
  27. Kim, J., Rubin, N., Huang, Y., Tuan, T. L., Lien, C. L. In vitro culture of epicardial cells from adult zebrafish heart on a fibrin matrix. Nat Protoc. 7, 247-255 (2012).
  28. Compton, L. A., Potash, D. A., Mundell, N. A., Barnett, J. V. Transforming growth factor-beta induces loss of epithelial character and smooth muscle cell differentiation in epicardial cells. Developmental dynamics : an official publication of the American Association of Anatomists. 235, 82-93 (2006).
  29. Smith, C. L., Baek, S. T., Sung, C. Y., Tallquist, M. D. Epicardial-derived cell epithelial-to-mesenchymal transition and fate specification require PDGF receptor signaling. Circ Res. 108, 15-26 (2011).
  30. Shea, K., Geijsen, N. Dissection of 6.5 dpc Mouse Embryos. JOVE. 2, (2007).
  31. Witty, A. D., et al. Generation of the epicardial lineage from human pluripotent stem cells. Nature biotechnology. 32, 1026-1035 (2014).
  32. Iyer, D., et al. Robust derivation of epicardium and its differentiated smooth muscle cell progeny from human pluripotent stem cells. Development. 142, 1528-1541 (2015).
  33. Takeichi, M., Nimura, K., Mori, M., Nakagami, H., Kaneda, Y. The transcription factors Tbx18 and Wt1 control the epicardial epithelial-mesenchymal transition through bi-directional regulation of Slug in murine primary epicardial cells. PloS one. 8, e57829 (2013).
  34. Wong, M. L., Medrano, J. F. Real-time PCR for mRNA quantitation. BioTechniques. 39, 75-85 (2005).
  35. Schmittgen, T. D., Livak, K. J. Analyzing real-time PCR data by the comparative CT method. Nature Protocols. 3, 1101-1108 (2008).
  36. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical biochemistry. 72, 248-254 (1976).
  37. Moore, A. W., McInnes, L., Kreidberg, J., Hastie, N. D., Schedl, A. YAC complementation shows a requirement for Wt1 in the development of epicardium, adrenal gland and throughout nephrogenesis. Development. 126, 1845-1857 (1999).
  38. Kim, J., et al. PDGF signaling is required for epicardial function and blood vessel formation in regenerating zebrafish hearts. Proc Natl Acad Sci U S A. 107, 17206-17210 (2010).
  39. Kalluri, R., Weinberg, R. A. The basics of epithelial-mesenchymal transition. J Clin Invest. 119, 1420-1428 (2009).
  40. Dong, X. R., Maguire, C. T., Wu, S. P., Majesky, M. W. Chapter 9 Development of Coronary Vessels. Methods in Enzymology. 445, 209-228 (2008).
  41. Ruiz-Villalba, A., Ziogas, A., Ehrbar, M., Perez-Pomares, J. M. Characterization of epicardial-derived cardiac interstitial cells: differentiation and mobilization of heart fibroblast progenitors. PLoS One. 8, e53694 (2013).
  42. Garriock, R. J., Mikawa, T., Yamaguchi, T. P. Isolation and culture of mouse proepicardium using serum-free conditions. Methods. 66, 365-369 (2014).
  43. Smart, N., Riley, P. Derivation of epicardium-derived progenitor cells (EPDCs) from adult epicardium. Curr Protoc Stem Cell Biol. (2009).
  44. Zhou, B., Pu, W. T. Isolation and characterization of embryonic and adult epicardium and epicardium-derived cells. Methods Mol Biol. 843, 155-168 (2012).
  45. Morabito, C. J., Dettman, R. W., Kattan, J., Collier, J. M., Bristow, J. Positive and negative regulation of epicardial-mesenchymal transformation during avian heart development. Dev Biol. 234, 204-215 (2001).
  46. Grieskamp, T., Rudat, C., Ludtke, T. H., Norden, J., Kispert, A. Notch signaling regulates smooth muscle differentiation of epicardium-derived cells. Circ Res. 108, 813-823 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics