Etablering av cancerstamcellskulturer från Human Konventionell osteosarkom

Cancer Research
 

Summary

Närvaron av cancerstamceller (CSCs) i bensarkom har nyligen satts i samband med deras patogenes. I den här artikeln presenterar vi isoleringen av CSCs från primära cellkulturer som erhållits från mänskliga biopsier av konventionell osteosarkom (OS) med hjälp av förmågan hos CSCs att växa under ickeadherenta förhållanden.

Cite this Article

Copy Citation | Download Citations

Palmini, G., Zonefrati, R., Mavilia, C., Aldinucci, A., Luzi, E., Marini, F., Franchi, A., Capanna, R., Tanini, A., Brandi, M. L. Establishment of Cancer Stem Cell Cultures from Human Conventional Osteosarcoma. J. Vis. Exp. (116), e53884, doi:10.3791/53884 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

De nuvarande förbättringar i terapi mot osteosarkom (OS) har förlängt livet för cancerpatienter, men överlevnaden av fem år fortfarande dålig när metastaser har inträffat. Cancer Stem Cell (CSC) teori menar att det är en delmängd av tumörceller inom tumören som har stamceller liknande egenskaper, inklusive förmågan att upprätthålla tumören och att motstå multi kemoterapi. Därför behövs för att främja utvecklingen av riktade terapier för att utrota denna undergrupp och att minska sjukligheten och dödligheten bland patienter en bättre förståelse för OS biologi och patogenes. Isolera CSCs, upprättande av cellkulturer av CSCs, och studera deras biologi är viktiga steg för att förbättra vår förståelse av OS biologi och patogenes. Inrättandet av humanhärrörande OS-CSCs från biopsier av OS har möjliggjorts med hjälp av flera metoder, bland annat förmågan att skapa 3-dimensionella stamcellskulturer enligt nonadherent villkor. Under dessa betingelser, CSCs kan skapa sfäriska flytande kolonier bildade av dotterstamceller; dessa kolonier benämns "cellulära sfärer". Här beskriver vi en metod för att etablera CSC kulturer från primära cellkulturer av konventionell OS erhållen från OS-biopsier. Vi beskriver tydligt flera passager krävs för att isolera och karakterisera CSCs.

Introduction

Sarkom är en heterogen grupp av sällsynta maligna bindvävnadstumörer härrör främst från den embryonala mesoderm en. De olika typerna inkluderar ben sarkom och mjukdelssarkom. Bensarkom, en grupp av förhållandevis ovanliga primära tumörer, bestå av flera undertyper, inklusive osteosarkom (OS). OS en av de vanligaste primära tumörer i ben, är en mesenkymala malignitet som uppvisar omfattande klinisk, histologiska och molekylära heterogeniteter 2, 3. Tyvärr inträffar OS främst barn och unga vuxna 4, 5 och står för 60% av gemensamma histologiska subtyper av ben sarkom i barndomen 6, 7. OS drabbar oftast de skelettområden, som kännetecknas av snabb tillväxt ben (t.ex. metafysen långa ben). Bland de histologiskt olika subtyper av OS, konventionell OS, även kallad medullär eller central OS har en hög grad av malignitet och en sha kvotre av 80% 8. Denna 80% består av 60% konventionell osteoblastisk OS, 10% chondroblastic OS och 10% fibroblastisk OS 6, 8-10. Andra OS subtyper inkluderar anaplastisk, telangiectatic, jätte cell rika och småcellig OS. Trots framsteg inom kombinerad kirurgi och kemoterapi i OS management, förblir resultatet dålig, med en långsiktig överlevnad på 65-70% hos patienter utan metastaser 11, 12. Distant återfall inträffar ofta som lungmetastaser eller mindre ofta, eftersom metastaser till avlägsna ben och lokala återfall 13. Metastaser är ofta resistenta mot konventionella behandlingar. Detta motstånd är anledningen till den 10-åriga sjukdomsfri överlevnad är ungefär 30% hos patienter med metastaserande sjukdom vid diagnos 14, 15.

Som med normal vävnad, är cancervävnad sammansatt av en heterogen samling av celltyper. Celler inom tumören verkar motsvara olika utvecklingsstadier. Inom varje normal vävnad befinner sig en subpopulation av celler med förmågan att selfrenew, vilket ger progenitorer och mogna celler för vävnads homeostas. På samma sätt är cancer består av en liknande heterogen population av celler i olika stadier av utveckling, med olika grader av proliferation och tumörframkallande potential. En undergrupp av dessa cancerceller, benämnda cancerstamceller (CSCS), utgör en reservoar av selfsustaining celler med den exklusiva förmåga att selfrenew och upprätthålla malign potential av tumörer, vilket genererar de olika cellinjer som utgör tumören bulk 16. Under 1990-talet, studier av akut myeloisk leukemi, förutsatt att första övertygande bevis för att det finns CSC subpopulationer 17, 18. CSCs har sedan isolerats från ett stort antal solida tumörer 19 och blir därmed en av de mest utforskade ämnen i cancerforskning. CSCs kan faktiskt uppstå från normala stamceller av mutationer i gener som gör den normalastamceller cancer 20-23. Flera transformerande mutationer och interaktion med mikro skulle också kunna bidra till friska stamceller och mogna celler förvärvar selfrenewal kapacitet och odödlighet som är typiska CSCs. Det finns flera hypoteser om denna omvandling. Friska stamceller, friska mogna celler och cancerceller, kan dedifferentiate till stamceller, få en stam-liknande fenotyp genom att aktivera selfrenewal associerade gener 24-28. Trots flera nya studier, ursprunget till CSCs har ännu inte upptäckt.

En särskild egenskap hos CSCs är att deras förmåga att motstå multiterapi tillvägagångssätt, som består av kombinerade kirurgi och kemoterapi med olika läkemedel. Nyligen genomförda studier har visat att CSCs också kan förvärva resistens mot cytotoxisk kemoterapi agenter. Möjliga förklaringar till detta motstånd inkluderar överuttryck av ATP-bindande kassett (ABC) multi transportör (dvs.MDR1 och BCRP1), överuttryck av kemoterapi enzymer såsom aldehyddehydrogenas en (ALDH1), och / eller förändringar i cellcykelkinetiken 30-33. Den direkta följden av alla dessa koncept som har beskrivits så här långt är att en cancerterapi skulle vara effektiv endast om den CSC subpopulation var helt elimineras, medan lokalt återfall eller avlägsen metastas kan inträffa om ens en enda CSC levde.

Upptäckten av CSCs i mänsklig sarkom 34, i synnerhet OS 35, eller i något annat ben och mjukdelscancer, har stor klinisk betydelse eftersom det ger en möjlig förklaring till varför många behandlingar verkar vara effektiva i början, men patienterna senare återfall. Därför är det hopp för framtiden kampen mot konventionell OS för att hitta nya och särskilda riktade terapier baserade på utvecklingen av innovativa läkemedel riktade mot OS-CSCS tack vare den molekylära karakteriseringen av denna underbefolkningen och att studiet av CSC biologi.

1992, Reynolds och kollegor, som var att undersöka huruvida en undergrupp av stamceller var närvarande i den vuxna däggdjurshjärnan, utvecklat en metod för att isolera celler som misstänks vara stam-liknande celler 36, 37. Denna metod är baserad på den speciella förmågan hos dessa celler för att bilda sfäriska kolonier när odlas under icke-vidhäftande förhållanden. Liknande tekniker användes av Gibbs och kollegor i 2005 för att studera en subpopulation av stamceller-liknande celler i ben sarkom 38. Att isolera och karakterisera OS-CSCs från primära cellkulturer av olika typer av konventionell OS, bestämde vi oss för att anpassa denna teknik för OS-cellinjer.

Här beskriver vi här anpassad metod av sfären bildningsanalysen, benämnd "sarcosphere analys", som kan användas för att isolera OS-CSCs från ändliga primära cellinjer härledda från humana biopsier av konventionell OS. Vi beskriver också alla tekniker used att validera stammen liknande CSC fenotyp av linjerna cell isolerad genom denna analys: 1) utvärdering av uttrycket av gener som kännetecknar pluripotenta embryonala stamceller (ESCS) och CD133-genen, som är en markör för CSCs; 2) kolonibildande enhet (CFU) -analys; 3) utvärdering av förmågan hos dessa celler att differentiera till osteoblaster och adipocyter under lämpliga differentieringsförhållanden; 4) undersökning av ytmarkörer av mesenkymala stamceller (MSC) (dvs, CD44, CD105 och Stro-1) genom immunofluorescens färgning och genom flödescytometrisk analys; 5) Utvärdering av ALDH-aktivitet hos dessa celler.

Protocol

Alla experiment med mänskliga vävnader beskrivs häri godkändes av den lokala etiska kommittén (Rif. N. 141/12). Informerat samtycke för insamling av vävnadsprover och för användning och lagring av proverna erhölls från givare på AOUC.

1. Förberedelse för kultur

  1. Förbereda tillväxtodlingsmedium (GM) genom tillsats av 10% fetalt bovint serum (FBS), 100 lU / ml penicillin och 100 | ig / ml streptomycin till Coon modifierade Hams F12-medium. Filtrera och sterilisera GM användning av ett 0,22 pm filter. Store GM upp till en månad vid 4 ° C.
  2. Förbereda kollagenas medium (CM) genom tillsats av 20% FBS, 100 lU / ml penicillin, 100 | ig / ml streptomycin och 3 mg / ml kollagenas typ II till Coon modifierade Hams F12-medium. Filtrera och sterilisera CM användning av ett 0,22 pm filter. Store CM upp till en månad vid -20 ° C.
  3. Beredning av medium för cell frysning (FM) genom att tillsätta 40% FBS, 100 lU / ml penicillin, 100 | ig / ml streptomycin och 60,5% dimetylsulfoxid (DMSO) till Coon modifierade Hams F12-medium. Filter och sterilisera FM användning av ett 0,22 pm filter. Store FM upp till en månad vid 4 ° C.
  4. Förbereda medium för CFU-analys (CFUM) genom tillsats av 20% FBS, 100 lU / ml penicillin och 100 | ig / ml streptomycin till Coon modifierade Hams F12-medium. Filter och sterilisera CFUM med användning av ett 0,22 pm filter. Store CFUM upp till en månad vid 4 ° C.
  5. Förbereda trypsin genom upplösning av 400 mg trypsin, 200 mg EDTA och 1000 mg D (+) - glukos vattenfri i 1000 ml Dulbeccos fosfatbuffrad saltlösning (DPBS) utan Ca2 + och Mg2 +.
    OBS: Dela färskt trypsin-EDTA i 50 ml alikvoter i 25 cm 2 kolvar med användning av ett 0,22 pm filter och frys vid -20 ° C i upp till 3 månader. Store tinade filtersteriliserade alikvoter vid 4 ° C utan förlust av aktivitet.
  6. Förbereda stamcelltillväxtmedium (SCGM) genom tillsats av 10% FBS, 100 lU / ml penicillin, 100 | ig / ml streptomycin, och 10 ng / ml bFGF (25 ^ g / ml lager) till Coon modifierade Hams F12-medium. Filtrera SCGM med användning av ett 0,22 pm filter och lagra SCGM upp till 2 veckor vid 4 ° C.
  7. Förbereda 2% metylcellulosa (MC) genom upplösning av MC i ultrarent H2O vid 4 ° C under 3 d. När MC är fullständigt upplöst, autoklavera den och förvara vid 4 ° C.
    OBS: Efter MC steriliseras, blir det fast. Att föra MC till ett flytande tillstånd, förvara vid 4 ° C.
  8. Förbereda sarcosphere tillväxtmedium (SGM). Förbereda detta medium färsk (inte mer än 2 veckor före användning) genom att tillsätta 100 lU / ml penicillin, 100 | ig / ml humant bFGF (25 ^ g / ml stock), 20 nM progesteron (10 pM stock), 100 | iM putrescin, 30 nM natriumselenit (30 pM stock), 25 | ig / ml transferrin (25 mg / ml lager), 20 | ig / ml insulin (20 mg / ml lager), och 10 ng / ml human EGF (10 ^ g / ml lager) till 2X coon modifierade Hams F12-medium. Filtrera och sterilisera SGM användning av ett 0,22 um filter. Lagra upp till 2 veckor vid 4 ° C.
  9. Förbereda osteogen medium (OM) genom tillsats av 10% FBS (sydamerikanska ursprung), 100 lU / ml penicillin, 100 | ig / ml streptomycin, 10 nM dexametason (100 pM stock), 0,2 mM natrium-L-askorbyl-2-fosfat (en M stock), 10 mM β-glycerofosfat (5 mg / ml lager) och 1 pg / ml kalcein (200 | ig / ml stock) till Coon modifierade Hams F12-medium. Filter och sterilisera OM användning av ett 0,22 pm filter. Lagra vid 4 ° C.
    OBS: Förvara dexametason stamlösningar under flytande kväve för att upprätthålla sin verksamhet. Framställ färsk OM var 2 veckor för att bibehålla aktiviteten av dexametason för att upprätthålla differentiering potentialen av mediet.
  10. Förbereda erytrocyt lyseringsbuffert (ELB) genom att lösa upp 1,66 mg NH4CI, 0,2 mg K 2 HPO 4 och 0,007 mg EDTA i 200 ml destillerat vatten (dH 2 O). Filtrera och sterilisera ELB användning av ett 0,22 pm filter. Förvaras vid 4 °C.
  11. Förbereda adipogena medium (AM) genom att tillsätta 10% FBS (Sydamerika ursprung), 100 lU / ml penicillin, 100 | ig / ml streptomycin, 1 | iM dexametason (1 mM stamlösning), 1 ^ M bovint insulin (10 mM stock), 0,5 mM isobutylmetylxantin (IBMX) (500 mM stock), och 100 | iM indometacin (200 mM) till Coon modifierade Hams F12-medium. Filtrera och sterilisera AM användning av ett 0,22 pm filter. Lagra vid 4 ° C.
    OBS: Förvara dexametason stamlösningar under flytande kväve för att upprätthålla sin verksamhet. Framställ färsk AM var 2 veckor för att bibehålla aktiviteten av dexametason för att upprätthålla differentiering potentialen av mediet.
  12. Bered två% bovinserumalbumin (BSA) i DPBS (BSA / DPBS). Lös 10 g BSA i 500 ml DPBS och förbereda stamlösningen genom aliquotting 50 ml stamlösning i 50 ml koniska rör. Förvara vid -20 ° C.
  13. Bered en lösning av 4% paraformaldehyd (PFA) i DPBS (PFA / DPBS). I en chemical huva, späd paraformaldehyd i DPBS och förbereda stamlösningen genom aliquotting 50 ml stamlösning i 50 ml koniska rör. Lagra vid 4 ° C.

2. Upprättande Primär OS cellkulturer och OS Finite cellinjer (OSA)

OBS: Primär OS cellkulturer bereddes från färska prover av konventionella OS biopsier samlats på "Unità Ortopedia Oncologica e Ricostruttiva", AOUC Careggi, Florens. Alla biopsier, vilka erhölls genom nålen aspiration eller kirurgisk resektion av en liten del av tumören (Figur 1A, B), placerades omedelbart i odlingsmedium kompletterat med 100 lU / ml penicillin och 100 | ig / ml streptomycin (pH 7,4) och transporteras till laboratoriet där de bearbetas. Alla beskrivna manipulationer utfördes under aseptiska betingelser med användning av ett dragskåp med laminärt flöde.

  1. Isolering av OS-celler
    1. Placera biopsi i ett100 mm petriskål med en liten volym av GM. Med en steril lansett och Perry pincett, finhacka OS vävnadsprover genom att skära dem i bitar så små som möjligt (0,5-1 mm) (Figur 2A, B).
    2. Täcka vävnadsfragment med 10 ml CM för enzymatisk digerering (Figur 2B) och inkubera under 3 h i en 37 ° C, 5% CO2 inkubator. Försiktigt bort upphävandet av fragment med hjälp av en pipett och överföra den till en 15 ml koniskt rör för omedelbar centrifugering (400 x g under 5 min) för att pelle fragmenten.
      OBS: Efter centrifugering, om biopsier är rika på erytrocyter, en röd insättning bestående av erytrocyter kan ses över fragmenten. Därför, innan man går vidare till mekanisk dispersion behandla provet med erytrocyt lyseringsbuffert. Kasta bort supernatanten genom aspiration och tillsätt 5 ml ELB.
    3. Suspendera pelletsfragment under 1 min och centrifugera suspensionen vid 400 xg under 2min. Avlägsna supernatanten genom aspiration. Tillsätt 5 ml GM och mekaniskt skingra fragmenten med hjälp av en 10 ml serologisk pipett (öppningsstorlek, 1,5 mm inner Ø) 10 - 20 gånger.
    4. Centrifugera suspensionen vid 400 xg under 5 min. Avlägsna supernatanten genom aspiration, suspendera cellpelleten med 10 ml GM, och sedan överföra den resulterande cellsuspensionen i en 100 mm petriskål. Inkubera petriskål i en 37 ° C, 5% CO2 inkubator och ersätta GM med färskt fullständigt GM varje 3 d.
      OBS: Ganska ofta OS vävnadsprover erhållna genom nålen aspiration är mycket små och innehåller benfragment, som inte bryts ner genom enzymatisk digerering med kollagenas. Därför, efter supernatanten har avlägsnats, försök att separera cellerna från benvävnaden genom att mosa pelletsfragment med en pipett.
  2. Subkultur
    OBS:
    Att upprätta en OSA, när cellerna når ungefärlig sammanflödet, ta bort dem från their odlingskärl, späd, och placera i en ny platta för att möjliggöra fortsatt tillväxt. Denna subkultur förfarande uppnås med hjälp av den enzymatiska förfarande kallas trypsinering.
    1. Ta bort mediet genom aspiration. Att dissociera cellmonoskiktet, tillsätt 2-3 ml trypsin vid RT (max 18-20 ° C), skaka försiktigt en gång, och avlägsna trypsin omedelbart genom aspiration. Upprepa två gånger. Inkubera cellerna vid 37 ° C under 3-4 min tills de börjar lossna.
      OBS: Bra trypsinisering kan ses av erfarna användare som små hål bildas i något ogenomskinlig mono när skålen hålls mot ljuset. Denna dissociation kan också övervakas med hjälp av ett inverterat mikroskop; detta tillvägagångssätt rekommenderas för nybörjare.
    2. Stoppa trypsin reaktionen genom tillsats av 10 ml GM och tvätta skålen väl med användning av en pipett för att lösgöra alla cellerna. Överföring 1 ml av suspensionen till en ny 100 mm petriskål och till 9 ml GM (1/10 split av celler).
      NOTERA:
  3. Kryokonservering av OS primära kulturer och OSA
    OBS: Frys en sammanflytande 100 mm petriskål i 4-5 cryovials. Processen för frysförvaring måste utföras snabbt eftersom DMSO, som skyddar cellmembranen under frysning, är giftigt för celler vid icke-frystemperaturer.
    1. Dissociera cellkulturer från monolagret genom trypsinering (se avsnitt 2.2), Pelletera celler genom centrifugering vid 400 xg under 5 min, avlägsna supernatanten genom aspiration, och sedan snabbt suspendera cellpelleten i FM.
    2. Alikvotera 1 ml av denna suspension per kryogen flaska. Omedelbart placera de fyllda flaskorna i en frys box med en mantel av 2-propanol och lagra Immediabart vid -80 ° CO / N. Överföring kryokärl till flytande kväve följande dag för långtidsförvaring.
  4. Avfrostning OS cellinjer och primära kulturer
    1. Avfrostning OS cellinjer från lagring flytande kväve, upptinings cryovials snabbt genom att placera dem i en laboratorie vattenbad vid 37 ° C. Överför innehållet i cryovials i en 15 ml koniska rör och tillsätt ca 10 ml GM (se avsnitt 2.3 för att avlägsna DMSO). Avlägsna supernatanten genom aspiration och suspendera cellpelleten i 10 ml GM. Plate cellsuspensionen i en 100 mm petriskål och inkubera i ett 37 ° C, 5% CO2 inkubator.

3. Sarcosphere analys för att Isolera OS-CSCs

OBS: Detta experiment utförs på OSA. Varaktigheten av detta experiment är relaterad till kapaciteten hos cellerna för att bilda dessa sfär kolonier (sarcospheres), och tidsintervallet som är 7, 14, 21, och 28 d.

  1. Estabgränsvärden för sarcosphere assay
    1. Förbered hemocytometer kammaren och alla reagens i förväg.
    2. Ta bort mediet genom aspiration och dissociera cellerna från monolagret genom trypsinering (se avsnitt 2.2). Blanda cellsuspensionen ordentligt, pipettering för att skingra några klumpar, och samla 10 mikroliter med en 20 mikroliter pipettspets.
    3. Överför 10 mikroliter cellsuspensionen omedelbart till hemocytometer kammaren kanten, utvisa suspensionen, och att den kan dras under täckglaset genom kapillärverkan.
    4. Observera hemocytometer kammaren under faskontrast. Välj ett 10X objektiv och fokusera på de linjer i i kammaren. Räkna celler som ligger i detta 1 mm 2-område med hjälp av underavdelningar (även bunden av tre parallella linjer) och enstaka rutnätslinjer som ett hjälpmedel för räkning.
    5. Mäta koncentrationen och tillämpa följande ekvation: 1 ml = n * 10 4 / z (n: hela antalet celler i samtliga räknadetorg 1 mm 2; z: antalet räknade rutor 1 mm 2). Beräkna volymen av cellsuspensionen nödvändigt att plattan ett totalt belopp på 240.000 celler delas in i 40.000 celler för varje brunn i 6-väl ultralåga fästplatta.
      OBS: Var noga med att plattan rätt antal celler genom plätering celler till en extra bra. Därför är den totala mängden av celler som skall pläteras 280.000 celler.
    6. Förbered 35 ml SGM genom tillsats av 50% 2% MC (SGM-MC) i en 25 cm 2 kolv. Förbereda den totala volymen av SGM väger 5 ml extra för att plätera ett extra brunn.
    7. Lägg den beräknade volymen av cellsuspensionen till SGM-MC framställts i kolven och blanda försiktigt med en pipett för att skingra några klumpar. Platta cellerna i en 6-brunnars ultralåg fastsättningsplatta och använda ett inverterat mikroskop för att observera hur cellerna visas efter pläteras.
    8. Inkubera cellerna i en 37 ° C, 5% CO2 inkubator. Varje 3 d, lägga frESH alikvoter av bFGF och EGF till varje brunn för att uppdatera koncentrationen av tillväxtfaktorerna. Lägg 2 mikroliter bFGF och 5 mikroliter EGF att bibehålla både vid slutkoncentration av 10 ng / ml i varje brunn.
  2. Isolering av sarcospheres
    OBS: Övervaka den goda utvecklingen av sarcosphere analysen vid 7, 14, 21, och 28 d för att bestämma när det är nödvändigt att isolera de sarcospheres som bildade.
    1. Förbered alla reagenser och utrustning i laminärt flöde huva (Figur 3A, B). Montera filtreringsenheten genom att placera en netto filter av 25 mm diameter och en 40 | j, m mesh in i en membranfilterhållare; sterilisera i autoklav (Figur 4A-E).
    2. För varje brunn, överföra det medium som innehåller de sarcospheres till en spruta med en steril membranfilterhållare med användning av en steril pipett med en 1000 mikroliter spets. Efter fullständigt avlägsnande av mediet som innehåller de sarcospheres, tvätta väl av adding 5 ml GM att vara säker på att överföra alla sfärer en spruta. Använd mikroskop för att bekräfta om alla sarcospheres har återvunnits. Om inte, fortsätt genom att upprepa detta steg.
    3. Filtrera suspensionen med ett membranfilter innehavaren enbart genom gravitation utan tryck för att förhindra skada sfärerna och att slippa sarcospheres passerar genom filtret, varigenom förlusten av sfärer. Avlägsna luftbubblor genom att försiktigt med en steril glas pasteurpipett.
      OBS: Ibland filtreringen är blockerad av närvaron av en luftbubbla i membranfilterhållaren.
    4. Tvätta filtreringsenheten genom att tillsätta 10 ml GM till sprutan och låta det filtrerar utan tryck för att vara säker på att eliminera de enskilda cellerna. Ta isär filterenheten från sprutan och lägg den i en petriskål.
    5. Ta ut nätfiltret från membranfilterhållaren med hjälp av Perry pincett och tvätta den genom att skaka den försiktigt med pincett i en 60 mmPetriskål för att frigöra sarcospheres från härva av membranet. Sedan placera membranet i en brunn och bekräfta genom mikroskopisk observation att det inte finns fler områden trassla i membranet. Om sfärer fortfarande fastnat i membranet, fortsätta med en annan tvätt som beskrivs i steg 3.2.4.
    6. Observera de frigjorda sarcospheres med användning av ett mikroskop. Inkubera de frigjorda sarcospheres i en 37 ° C, 5% CO2 inkubator. Upprepa alla steg för varje brunn i en 6-brunnars ultralåg fästplatta.

4. OS-CSC Lines

OBS: OS-CSCs erhålls från sarcospheres som uppvisar vidhäftande expansionen genom att återinföra och reculturing dessa celler i ett monolager efter att de stryks i små 60 mm petriskålar inte längre under extremt låga anslutningsvillkor.

  1. OS-CSC kulturer
    1. För att möjliggöra ytterligare tillväxt, subkultur cellerna när de når ungefär 90% konfluens i en 60mm petriskål. Upprepa steg 2.2.1 att etablera OS-CSC kulturer.
    2. Stoppa trypsinering genom att tillsätta 4 ml SCGM och tvätta skålen väl med hjälp av en pipett för att frigöra alla celler. Överför cellsuspensionen till en ny 100 mm petriskål och tillsätt 6 ml SCGM. När OS-CSCs når 90% sammanflödet, subkultur genom att upprepa avsnitt 2.2.
      OBS: För in vitro-analys för att karakterisera stamcellsliknande fenotyp av isolerade OS-CSCs kan celler pläteras i olika typer av plattor.
    3. Bevara de etablerade OS-CSC linjer genom kryokonservering (upprepa alla steg i avsnitt 2.3). Avfrosta frysförvarade OS-CSCs genom att upprepa alla steg i avsnitt 2.4.

5. In vitro ANALYS för att karaktärisera OS-CSCs:

  1. Beredning av celler för immunofluorescens
    OBS: Celler fixerades i paraformaldehyd när de når rätt graden av sammanflödet i varje brunn på en 24 brunnar plate. Graden av sammanflödet är relaterad till den typ av experiment.
    1. Platt OS-CSCs i en 24-brunnars platta för att studera ytan mesenkymala stamceller (MSC) markörer genom immunofluorescens. Fixera cellerna i varje brunn när de når 50-60% konfluens. Avlägsna SCGM genom aspiration och tvätta två gånger i DPBS 24-brunnar.
    2. Enligt en kemisk huv, tillsätt 500 | il 4% PFA / DPBS till varje brunn. Inkubera vid RT i 10 min. Ta bort PFA / DPBS och tvätta 3x med ultrarent dH 2 O. Tillåta 24-brunnar för att torka i dragskåp.
  2. Immunofluorescens för MSC-markörer
    OBS: Immunofluorescens färgning av OS-CSCs fixerades i 4% PFA / DPBS kan användas för att undersöka MSC-liknande fenotyp av OS-CSCs med användning av antikroppar riktade mot CD44, Stro-1 och CD105. Följande metod används rutinmässigt av författarna.
    1. I en kemisk huva, permeabilisering celler som har fastställts i 4% PFA / DPBS genom att tillsätta 500 mikroliter 0,2% Triton X-100 / DPBS till varje brunn. Inkubera cellerna vid 37 ° C under 30 min. Försiktigt tvätta cellerna 3x med DPBS. Tillsätt 300 mikroliter RNas utspätt 1/1000 med 2% BSA / DPBS till cellerna och inkubera vid 37 ° C under 30 min.
    2. Försiktigt tvätta cellerna 3x med 2% BSA / DPBS. Färga cellerna för MSC-markörer. Lägga till den primära antikroppen enbart till brunnarna som valts ut som positiva kontroller för varje antikropp.
      1. Tillsätt 300 mikroliter anti-CD105 utspädd 1/10 med 2% BSA / DPBS, 300 mikroliter anti-CD44 utspädd 1/10 med 2% BSA / DPBS, 300 mikroliter anti-Stro-1 späddes 1/10 med 2% BSA / DPBS och bara 200 mikroliter 2% BSA / DPBS till brunnarna valda som negativa kontroller för varje antikropp.
      2. Inkubera cellerna i en fuktig miljö vid 4 ° CO / N. Tvätta brunnarna 3x med DPBS och därefter två gånger med 2% BSA / DPBS.
    3. Avslöjar primära antikroppar genom att lägga till specifika sekundära antikroppar.
      1. Tillsätt 300 mikroliter anti-kanin-IgG (åsne-anti-kanin-IgG [H + L]) utspädd 1/100med 2% BSA / DPBS i varje brunn valdes som positiv och negativ kontroll för CD44 och CD105. Tillsätt 300 mikroliter FITC-anti-mus-Ig (FITC-kanin-anti-mus-IgG [H + L]) utspädd 1/100 med 2% BSA / DPBS i varje brunn valdes som positiv och negativ kontroll för Stro-1. Inkubera cellerna i mörker vid RT i 60 min. Tvätta brunnarna 6x med DPBS.
    4. Stain MSC markör positiva celler för cytoskelettala aktin genom att lägga till 300 mikroliter falloidin utspädd 1/100 med 2% BSA / DPBS i varje brunn färgas för MSC markör immunofluorescens.
    5. Inkubera cellerna i 40 min vid RT. Tvätta brunnarna 3x med DPBS och sedan tvätta dem två gånger med ultrarent dH 2 O. Fortsätt till motfärgning av kärnorna efter immunofluorescensfärgning beskrivits ovan. Bered propidiumjodid lösning 10 -5 M i DPBS (lager 1,5 x 10 -3 M) i ett dragskåp.
      1. Tillsätt 200 | il propidiumjodid-lösning till varje brunn färgas, såsom beskrivits ovan. Inkubera cellens 2 - 3 min vid RT. Tvätta brunnarna två gånger med ultrarent dH2O
        OBS: Upprepa alla stegen i avsnitt 5.1 - 5.2 på cellinje HCT8, en primär kontinuerlig differentierad tjocktarmscancer cellinje som används som en negativ kontroll.
  3. Osteogen differentiering assay
    OBS:
    Osteogen differentiering varar i 20 d.
    1. Platt OS-CSCs i 24-brunnsplattor vid en celldensitet av 1 x 10 4 celler / cm 2 i SCCGM. Tillåta cellerna att växa i SCGM tills de når 80-90% konfluens i varje brunn.
    2. Börja osteogen differentiering genom att ändra SCGM till OM. Låt cellerna att växa i OM och uppdatera medel var 3 - 4 d. Stoppa osteogen differentiering analysen vid 10 d för att utvärdera närvaron av alkaliskt fosfatas (ALP).
    3. Fix celler i 4% PFA / DPBS (se avsnitt 5.1). Utvärdera osteoblastiska fenotypen genom cytokemisk färgning för ALP och HAanvändning av Alizarin Red S färgning.
    4. ALP cytokemisk färgning
      OBS: Förbered färgblandningen i en kemisk huva omedelbart innan färgningen.
      1. Lös upp 40 mg Fast Blue BB eller Fast Red Violet LB salt i 50 ml Tris-HCl, pH 9 (lösning A). Lös upp 5 mg naftol-AS-MX-fosfat-natriumsalt i 1 ml DMSO (lösning B). Lägg Lösning B helt till lösning A och blanda väl, få lösning C. Tvätta cellerna två gånger med DPBS.
      2. Tillsätt 500 mikroliter - 1 ml lösning C till varje brunn och inkubera vid 37 ° C och 5% CO2. Övervaka förloppet av färgning var 10 min genom att observera cellerna under mikroskop.
      3. Stoppa färgning när ALP-positiva celler blir intensivt färgade (blå med Fast Blue BB salt eller röd med Fast Red Violet LB salt), vilket vanligtvis sker inom 30 minuter. Tvätta cellerna 3x med ultrarent dH 2 O för att avlägsna alla rester av lösning C. Om en fällning av fläcken iär närvarande, tvätta cellerna snabbt en gång med absolut etanol.
      4. Fortsätt till motfärgning av kärnorna efter ALP färgning som beskrivs i steg 5.2.5 och 5.2.5.1.
    5. Alizarin Red S cytokemisk färgning
      OBS: Förbered färgämnesblandningen innan försöket.
      1. Förbered 2% Alizarin Red S (2 g Alizarin Red S i 100 ml ultrarent H2O). Tillsätt 2,5% NH 3-2% Alizarin Red S för att nå pH 6,0. Store 2% Alizarin Red S-lösning vid 4 ° C. Tvätta cellerna en gång med DPBS.
      2. Lägg Alizarin Red S till cellerna för endast ett fåtal sekunder.
      3. Tvätta brunnarna med ultrarent dH 2 O för att kontrollera graden av färgning; Om HA insättningar är inte intensivt färgade, upprepa steg 5.3.5.2. Stoppa färgning när HA insättningar blir intensivt rödfärgad, vilket vanligtvis sker inom några minuter. Tvätta brunnarna med ultrarent dH 2 O.
    6. adipogena differentiering
      OBS: Analys varaktighet beror på OS-CSC linjer. Analysen kan pågå 14-30 d.
      1. Platt OS-CSCs i 24-brunnsplattor vid en celldensitet av 1 x 10 4 celler / cm 2 i SCGM. Tillåta cellerna att växa i SCGM tills de når 80-90% konfluens i varje brunn. Initiera adipogena differentiering genom att ändra SCGM till AM. Tillåta cellerna att växa i AM och uppdatera AM två gånger i veckan.
      2. Stoppa adipogena differentiering analysen när lipidvesiklar är synliga. Utvärdera adipogena fenotypen genom Oil Red O färgning och hematoxylin motfärgning för kärnor.
      3. Hematoxylin motfärgning för kärnor
        OBS: Förbered färgämnesblandningen innan försöket.
        1. Förbered hematoxylin lösning 5%, kallad Emallume Carazzi 39. Lagra lösningen vid 4 ° C. Lägg Emallume Carazzi för endast två minuter. Tvätta brunnarna med ultrapure dH 2 O.
    7. CFU-analys
      OBS: Detta experiment måste utföras i tre exemplar.
      1. Platt OS-CSCs i 100 mm Petri-skålar vid en celltäthet av 450 celler / cm 2 i CFUM. Inkubera cellerna i en 37 ° C, 5% CO2 inkubator under 4 veckor. Uppdatera CFUM två gånger i veckan.
      2. Färga CFU med toluidinblått. Räkna färgade kolonierna med hjälp av ett inverterat mikroskop. Beräkna CFU effektivitet i enlighet med följande formel: (antal bildade kolonier / antal celler såddes) * 100.
    8. ALDH aktivitetsanalys
      OBS: ALDH-aktivitet har utvärderats med användning av en ALDH-aktivitet kolorimetrisk analyssats på de två OS-CSC linjer och på en ändlig fibroblast linje, som användes som en negativ kontroll. Detta kit kvantifierar ALDH enzymatiska aktiviteten genom absorbans läsning vid 450 nm. Alla tester har utförts i tre exemplar.
      1. Dissociera cellkulturer från monolagret genom trypsinering (se avsnitt 2.2). Pelletera cellerna genom centrifugering vid 400 xg under 5 min. Följ tillverkarens protokoll.
    9. Flödescytometrisk analys:
      OBS: Enkelcellsuspensioner krävs för optimal färgning av prover för flödescytometri. En enda cell suspensionen måste vara förberedda för varje antikropp som skall testas. Dissociera cellkulturer från monolagret genom trypsinering (se avsnitt 2.2).
      1. Placera cellsuspensionen i ett koniskt rör, utför en cellräkning med användning av Biirker räknekammare, centrifugera celler vid 400 xg och återsuspendera i en lämplig volym av separationsbuffert för att erhålla en cellsuspension vid en slutlig cellkoncentration av 1 x 10 5 celler / ml.
      2. Centrifugera cellsuspensionen i 5 minuter vid 4 ° C. Kassera supernatanten och tvätta pelleten med separationsbuffert. Upprepa detta steg två gånger.
      3. Fläcken celler för MSC markörer (dvs. CD44, CD105 och Stro-1) 40.
      4. Analysera positivt färgade cellsuspensioner i en flödescytometer. Analysera de markerade prover inom ett d. Inkubera dessa prover vid 4 ° C fram till analys.
    10. RT-PCR
      1. Extraktion och isolering av RNA
        1. Tillsätt 1 ml lyseringsreagens till de cellulära frysta packade prover av OS-CSCs och lysera cellerna direkt i röret genom att pipettera pelleten upp och ned flera gånger.
        2. Centrifugera proverna vid 12.000 xg i 1 min vid 4 ° C. Försiktigt bort supernatanten. Överför supernatanten till ett nytt rör, tillsätt 200 | il kloroform, och locket röret säkert. Skaka röret kraftigt i 15 sek och inkubera provet under 5 min vid RT.
        3. Centrifugera proverna vid 12.000 xg under 15 min vid 4 ° C. Blandningen separerar i tre olika faser. RNA är uteslutande i den färglösa övre vattenfasen.
        4. att vara particularly försiktig, ta bort bara vattenfasen och överföra denna fas i ett nytt rör för att gå vidare med RNA-isolering. Tillsätt 500 mikroliter isopropanol till röret innehållande den vattenhaltiga fasen. Skaka röret försiktigt för hand. Inkubera provet vid RT under 10 min. Centrifugera provet vid 12.000 xg under 10 min vid 4 ° C.
          OBS: Efter det att provet centrifugeras, är det möjligt se RNA, som bildar en gelliknande pellet på sidan och på botten av röret.
        5. Avlägsna supernatanten från röret, var noga med att lämna pelleten av RNA på botten. Tillsätt 1 ml 75% etanol till röret. Vortex röret för hand under några sekunder och sedan centrifugera röret vid 7500 xg under 5 min vid 4 ° C.
        6. Kassera etanol och lufttorka RNA-pelleten. När pelleten är torr, resuspendera RNA-pelleten i RNas-fritt vatten (10-50 | il) genom att pipettera lösningen upp och ner flera gånger.
        7. Bestämma utbytet och renheten av RNA genom measnder absorbansen vid 260 nm och 280 nm med användning av en spektrofotometer. Utvärdera integriteten hos den totala RNA på standard 1% agarosgel. Förvara RNA vid -80 ° C.
      2. Omvänd polymerase chain reaction
        1. Syntetisera första sträng cDNA från 500 ng RNA-prov med hjälp av en omvänd transkription kit. Tina RNA-prover på is och tina nödvändiga lösningar som ingår i satsen vid RT. Fortsätta att syntetisera cDNA följande tillverkarens protokoll.
      3. Semi-kvantitativ omvänd transkriptas-polymeraskedjereaktion (RT-PCR)
        1. Utför alla PCR med användning av en mikroliter cDNA för varje prov som en mall i en slutlig reaktionsvolym av 24 | il. Använda primersekvenserna som anges i tabell 1 för amplifieringen av Nanog, oktober 3/4, Sox2 och CD133-gener.
        2. Separera RT-PCR-produkter med 1,8% agarosgelelektrofores och färgning med etidiumbromid. Fotografi under UV Illumnering.

Representative Results

OS prover erhållna genom nålen aspiration eller kirurgisk resektion av en liten del av tumören (Figur 1A, B) tillåter isolering av endast en OSA om de behandlas exakt såsom beskrivs i protokollet sektionen (figur 2A, B). Tyvärr är antalet celler som isolerats från de biopsier låg, med en utgångsområdet från 30 - 50%. Utsignalen beror på typen och dimensionen av biopsier (Figur 5A, B). Dessa celler måste behandlas exakt. Följaktligen är det nödvändigt ungefär en månad för de primära kulturer att nå konfluens i en 100 mm petriskål. Efter denna tid är OSA erhålles från två OS-prover märkta OSA5 och OSA6 (Figur 6A, B). Då, är det nödvändigt att subkultur den primära cellinjen för att erhålla ett tillräckligt antal celler för att utföra karakterisering analys och för att cryopreserve cellen lines. På 3: e passagen av subkultur, när båda OSA primära cellinjer når konfluens, de pläterade i 6-väl ultralåga fästplattor för sarcosphere analysen. Denna typ av plattan används eftersom den tillåter oss att behålla celler i ett suspenderat tillstånd, för att förhindra de stamceller från fäst-medierad differentiering, för att förhindra de förankringsberoende cellerna från att dela, och slutligen, för att minska fastsättning vid substratet. Därför tillåter användningen oss att skapa en stressande villkor för cancerceller, vilket är nödvändigt för valet av CSCs. Vid 24 h efter starten av analysen, visas celler isolerade från varandra (Figur 7). Efter 7 dygn för att övervaka utvecklingen av analysen, har små sfäriska kolonier började bildas och är synliga (Figur 8). Vid 28 d, kan observeras flera stora sfäriska kolonier som har bildats i varje brunn (Figur 9A, B). Efter de sarcospheres have odlats under 28 d kan dessa stora sfäriska kolonier isoleras. Figur 10 visar stegen för isolering sarcospheres från 6-brunnars ultralåg fastsättningsplattor och reculturing dem under adherenta förhållanden. Figur 11 visar de flytande sfäriska kolonier efter isolering. De stora sfäriska kolonier pläterade i normala fästplattor visar vidhäftande expansion efter isolering (Figur 12A, B). Celler som expanderar från de enskilda sarcospheres är förmodligen cancerceller med stamcellsliknande fenotyp. Därför, efter isolering, OS-CSCs troligen erhålls. Dessa celler benämns OSA5-CSCs och OSA6-CSCs (Figur 13A, B).

Vid denna punkt, är det nödvändigt att fortsätta med karakterisering av stamcellsliknande fenotyp för de två OS-CSC linjer enligt beskrivningen ovan. Analyserna för karakterisering av den stamcellsliknande fenotyp were utförs på 4: e passagen av subkultur efter sarcospheres för varje OS-CSC linje isolerades. De två cellinjer, OSA5-CSCs och OSA6-CSCs, visade en stark positivitet för ytan MSC markörer (CD105 och CD44) (Figur 14A, B och Figur 15A, B), medan de visade måttlig positivitet för ytan MSC markör Stro- 1 (Figur 16A, B). Våra observationer har bekräftats av negativa resultat som erhölls med det kommersiella och differentierad koloncancer-cellinjen HCT8 (Figur 14C, Figur 15C, Figur 16C). En total brist på specifik och icke-specifik färgning för dessa ytmarkörer i HCT8 cellinjen observerades.

För att utvärdera MSC fenotypen av de två OS-CSCs vi också utfört flödescytometriska analyser. Både OS-CSC linjer uttryckte höga nivåer av CD44 och CD105. Emellertid av cellerna i båda cellinjerna, endast 1,14% uttryckt Stro-1. Därför denna nyatatet bekräftade måttlig förekomst av Stro-1 såsom visas genom immunofluorescens-färgning. I kontrast, 99,62% av den OSA5-CSCs uttryckte CD44 och 87,38% av dessa celler uttryckte CD105; 99,88% av den OSA6-CSCs uttryckte CD44 in och 95,79% av dessa celler uttryckte CD105. Dessutom båda cellinjer är CD45-.

Vi bedömde uttrycket av 3 ESC markörer (nanog, oktober 3/4, Sox2) och i CD133-genen, en annan CSCs markör, genom RT-PCR. Vi märkte att alla dessa gener uttrycktes i både OS-CSC linjer (Figur 17). De adipogena och osteogena differentieringsanalyser visade kapaciteten hos både isolerade OSA-CSC linjer att differentiera till osteoblaster (Figur 18A - D och figur 19A - D) och i adipocyter (Figur 20A - D).

Vidare CFU en ssay (Figur 21) visade en bra hastighet av klonogen effektivitet, med 13% för OSA5-CSCs och 14% för OSA6-CSC. Flera nya studier har visat att höga nivåer av ALDH-aktivitet är karakteristiska för olika typer av cancer. Denna parameter skulle kunna användas som en cancerstamcells markör och är korrelerad med en dålig prognos. Den ALDH aktivitetsanalysen visade att båda OS-CSC linjer har höga halter av ALDH-aktivitet (Figur 22), medan ALDH-aktivitet observerades vid den lägre mätbara gränsen på fibroblast linje som användes som en negativ kontroll i denna analys.

Figur 1
Figur 1. Exempel på OS biopsiprov. (A). Biopsiprov erhålles genom nål aspiration. (B). Biopsiprov erhålles genom kirurgisk resektion av en del av tumören.884 / 53884fig1large.jpg "target =" _ blank "> Klicka här för att se en större version av denna siffra.

figur 2
Figur 2. Mekanisk Uppdelning av en OS prov. (A) Fragmentering av ett prov med hjälp av Perry pincett och en lansett. (B) Fragment suspenderade i CM (indikeras av pilen). Klicka här för att se en större version av denna siffra.

Figur 3
Figur 3. Utrustning och konsumtionsvaror som behövs för att isolera Sarcospheres. (A). All utrustning som är nödvändig för cellisolering. 1. En steril spruta med en steril membranfilterhållare; 2. Två olika medier: GM ennd SCGM; 3. En steril glas pasteurpipett. (B) Detalj av sprutan monterad på ett stöd, med membranfilterhållaren. Klicka här för att se en större version av denna siffra.

figur 4
Figur 4. Filtrering Unit. Flera komponenter som behövs för att montera filtreringsenheten (A) (netto filtret indikeras av pilen). Fas kontrast observation av 40 pm maskor (en mask indikeras av pilen) av nätfiltret (B). Ursprunglig förstoring: 10X. Filtreringsenheten monteras (C - D). Filtreringsenhet steriliseras (E). Klicka här för att se en större version av denna siffra.

figur 5
Figur 5. primära cellkulturer av konventionell OS. Faskontrast observation av primära cellkulturer av hög kvalitet OS. I (A), flera ljusa benfragment är synliga, medan i (B), flera små rundade och flytande erytrocyter är närvarande. Ursprunglig förstoring: 10X. Bar storlek. 100 pm Klicka här för att se en större version av denna siffra.

figur 6
Figur 6. Konventionell Osteosarkom Finite cellinjer (OSA). (A) OSA5 och (B) OSA6. Observation i faskontrast.Ursprunglig förstoring: 10X. Bar storlek. 100 pm Klicka här för att se en större version av denna siffra.

figur 7
Figur 7. Sarcosphere Analys av OSA5 och OSA6. Efter 24 h från början av analysen ades celler flytande och isolerade från varandra (celler indikeras med pilar). Observation i faskontrast. Ursprunglig förstoring. 20X Klicka här för att se en större version av denna siffra.

Figur 8
Figur 8. Sarcosphere Analys av OSA5 och OSA6 på 7 D. 7 d i analysen, flera små spherical kolonier omgivna av enskilda celler kunde observeras. De sarcospheres (vissa av dessa sarcospheres anges med pilar) visas flytande i mediet eller något slagit sig ner in i botten av brunnen. Observation i faskontrast. Ursprunglig förstoring: 20X. Bar storlek. 100 pm Klicka här för att se en större version av denna siffra.

figur 9
Figur 9. Sarcosphere Analys av OSA5 och OSA6 vid 28 D. Efter 28 d, är flera stora bärnsten sarcospheres observerades i varje brunn i plattorna för varje OSA cellinje, OSA5 (A) och OSA6 (B). Bar Storlek: 100 nm. Klicka här för att se en större version av denna siffra. </ P>

Figur 10
Figur 10. Passager för isolering av Sarcospheres stegen för isolering sarcospheres från 6-väl ultralåga fästplattor och deras reculturing enligt vidhäftande förhållanden visas (A) All utrustning som behövs för isolering..: 1. En 6-väl ultralåg platta med formade sarcospheres i varje brunn, 2. spruta med nettofilterhållaren 3. pipett 4. 1000 mikroliter sterila tips, 5. 2 sterila Perry pincett, 6. 2 olika odlingsmedier , 7. steril pasteurpipett 8. petriskålar. (B) Insamling av sarcospheres. Mediet som finns i varje brunn samlas in med hjälp av en pipett med en steril 1000 mikroliter spets. (C) Samla suspensionen i sprutan. Den uppsamlade suspensionen överföres till sprutan för att starta den naturliga filtreringsprocessen med användning av denmembranfilterhållaren. (D) Naturlig filtrering. (E) Demontering av membranfilterhållaren från sprutan. När allt suspensionen filtreras, är nettofilterhållaren tas isär och sätta i en petriskål, (F) Demontering av membranfilterhållaren. Sarcospheres finns i porerna i nätfiltret i nätet filterhållaren, så de måste frigöras med hjälp av Perry pincett. (G, H) Borttagning av sarcospheres från membranfilter. Klicka här för att se en större version av denna siffra.

Figur 11
Figur 11. Sarcosphere Isolering. Isolerade sarcospheres flyta i mediet i 60 mm petriskål. Observation i fas-kontrast.Ursprunglig förstoring: 40X. Bar storlek. 100 pm Klicka här för att se en större version av denna siffra.

Figur 12
Figur 12. Sarcosphere efter isolering. Sarcospheres från OSA5 (A) och OSA6 (B) cellinjer i början av vidhäftande expansionen efter återinförande och reculturing i ett monolager i vidhäftande förhållanden vid 48 timmar efter isolering. Observation i fas-kontrast. Ursprunglig förstoring: 20X. Bar storlek. 100 pm Klicka här för att se en större version av denna siffra.

Figur 13 Figur 13. Sarcospheres på 7 D efter isolering. Sarcospheres från OSA5 (A) och OSA6 (B) cellinjer uppvisade vidhäftande expansionen efter återinförande och reculturing i ett monoskikt i enlighet med adherenta betingelser vid 7 d efter isolering. Observation i fas-kontrast. Ursprunglig förstoring: 20X. Bar storlek. 100 pm Klicka här för att se en större version av denna siffra.

Figur 14
Figur 14. immunofluorescensfärgning för CD105. Immunofluorescens färgning för CD105 i OSA-CSC linjer OSA5-CSCs (A) och OSA6-CSCs (B) och i den kontinuerliga cellinjen HCT8 (C), som användes som en negativ kontroll. LSCM vid konventionell färg: Grönt för CD105 och rött för cytoskelettet. Ursprunglig förstoring: 10X. Bar storlek. 100 pm Klicka här för att se en större version av denna siffra.

Figur 15
Figur 15. Immunofluorescens färgning för CD44. Immunofluorescens färgning för CD44 i OSA-CSC linjer OSA5-CSCs (A) och OSA6-CSCs (B) och i den kontinuerliga cellinjen HCT8 (C), som användes som en negativ kontroll. LSCM i konventionella färger: grönt för CD44 och rött för cytoskelettet. Ursprunglig förstoring: 10X. Bar storlek. 100 pm Klicka här för att se en större version av denna siffra.


Figur 16. Immunofluorescens färgning av Stro1. Immunofluorescens färgning för Stro-1 i de OSA-CSC linjer OSA5-CSCs (A) och OSA6-CSCs (B) och i den kontinuerliga cellinjen HCT8 (C), som användes som en negativ kontrollera. LSCM i konventionella färger: grönt för Stro-1 och rött för cytoskelettet. Ursprunglig förstoring: 10X. Bar storlek. 100 pm Klicka här för att se en större version av denna siffra.

Figur 17
Figur 17. Expression av Nuclear ESC Markörer och CD133 Gene. RT-PCR som visar uttrycket av Nanog, oktober 3/4, Sox2 och CD133 i OSA5-CSCs (A) och i OSA6-CSCs ( Klicka här för att se en större version av denna siffra.

Figur 18
Figur 18. Osteogen Differentiering Assay -. ALP osteogent differentiering vid 0 d (A, B) och efter 10 d (C, D) av induktion såsom bestämts genom cytokemisk färgning för ALP med användning av Fast Blue BB. I blått, ALP + celler; i rött, den kärna motfärgades med propidiumjodid. Komposit iakttagelse i bright och i fluorescens. Ursprunglig förstoring: 20X. Bar storlek. 100 pm Klicka här för att se en större version av denna siffra.

Figur 19 Figur 19. Osteogen Differentiering analys -. HA osteogent differentiering vid 0 d (A, B) och efter 20 d (C, D) induktion bestämd genom cytokemisk färgning för hydroxyapatit (HA) med Alizarin Red S. Cellerna kontrasteras i blå / grå, och korniga fyndigheter av HA färgas i rött. Observation i faskontrast. Ursprunglig förstoring: 40X. Bar storlek. 100 pm Klicka här för att se en större version av denna siffra.

Figur 20
Figur 20. adipogena Differentiering Assay. Adipogena differentiering vid 0 d (A, B) och efter 14 d (C, D) av induktion såsom bestämts genom cytochemical färgning med Oil Red O. I rött, de lipida vesiklar (de större vesiklar anges med svart / röd pilar; de mindre vesiklar indikeras av de vita / svarta pilar); i blått / violett, kärnorna motfärgades med hematoxylin. Observation i ljusfält. Ursprunglig förstoring: 40X. Bar storlek. 100 iM Klicka här för att se en större version av denna siffra.

Figur 21
Figur 21. CFU-analys. CFU analys av OSA-CSC linjer färgade med toluidinblått. Klicka god här för att se en större version av denna siffra.

Figur 22 /> Figur 22. ALDH Aktivitetsanalys. Det ALDH kolorimetrisk analys upptäckt höga halter av ALDH-aktivitet i de två OS-CSC linjer, OSA5-CSCs och OSA6-CSCs, medan analysen detekterade avsaknad av denna verksamhet i den ändliga differentierade cellinjen av fibroblaster, FIB. Felstaplar: SD. **: P <0,001 vs FIB; *. P <0,01 vs FIB klicka god här för att se en större version av denna siffra.

2 "> CCCAGCTGTGTGTACTCAAT GGTTCAGGATGTTGGAGAGTT
Gen oligonukleotider Sekvens (5¹-3¹) Amplicon storlek (bp) Tₐ (° C)
nanog Framåtriktad primer Omvänd primer 87 60
oktober 3/2 Framåtriktad primer Omvänd primer GGGAGGAGCTAGGGAAAGA TCCTTCCTTAGTGAATGAAGAACT 77 60
Sox2 Framåtriktad primer Omvänd primer TGCAGTACAACTCCATGACC GGACTTGACCACCGAACC 125 55
CD133 Framåtriktad primer Omvänd primer CCAGAAGCCGGGTCATAAAT ATTCACTCAAGGCACCATCC 127 56
bp, baspar av amplicon storlek, Tₐ, glödgningtemperatur

Tabell 1. detaljerad lista över primersekvenser för Nanog, oktober 3/4, Sox2 och CD133 med Amplicon storlek och glödgningstemperatur

Discussion

CSCs har flera egenskaper som gör det möjligt att identifiera denna särskilda cellulära underuppsättning i tumören bulk. På grundval av dessa egenskaper, såsom förvärvad resistens mot cytostatika medel för överuttryck av ATP-bindande kassett multi uttransportörer 28, 32, 33, eller för uppreglering av uttrycket av avgiftning enzymer såsom ALDH 32, för uttrycket av en speciell ytmarkör, såsom CD133, CD44, CD34, CD90, och andra 30, 34, 35, 41, ett flertal olika metoder för att isolera CSCs har utvecklats 42-44. En av dessa tekniker är den sfär-bildningsanalysen, som är baserad på förmågan hos CSCs att växa under icke-vidhäftande tillstånd.

Förmågan av vävnad stamceller och CSCs att bilda sfärer beskrevs första gången i studier på identifieringen av neurala stamceller av Reynolds et al. 37. Därefter, Gibbs et al. 38 ossed dessa studier att börja isolera CSCs från solida tumörer, i synnerhet från ben sarkom. Vi har beslutat att använda området bildandet analysmetoden illustreras av Gibbs et al. Att isolera CSCs från OSA cellinjer som erhållits från konventionella OS biopsier. Vi anpassat den ursprungliga metoden för att förbättra resultaten av denna analys och underlätta dess reproducerbarhet för andra cancercellinjer. Med hänvisning till upprättandet av sfären bildningsanalys verifierade vi att plätering 40.000 celler / brunn är en god praxis för att upprätthålla celler i isolering i början av analysen. Detta trick är mycket viktigt att undvika risken att de sfäriska kolonier kommer från cellulär aggregering och inte från den speciella och exklusiva kapaciteten hos en enda CSC att växa under icke-vidhäftande betingelser och bildar en sfärisk koloni. Denna förmåga är en särskilt kritisk punkt i denna analys.

Vi certifierade också att för att erhålla en bra hastighet av sfär bildningÄr det tillräckligt att uppdatera alikvoter av tillväxtfaktorer varje 3 d och inte varje dag, såsom beskrivs i den ursprungliga metoden. I denna studie har vi också etablerat och beskrivits utförligt en bra metod för att isolera de sfäriska kolonier som bildas när odlas under icke vidhäftande betingelser. Detta steg är kritiskt i denna analys eftersom det är mycket viktigt att försöka isolera så många av de sfärer som möjligt som bildas i varje brunn utan att skada dem. Det är också viktigt att isolera enbart de sfärer och inte de enskilda celler, vilket skulle kunna förbli i suspension under hela analysen. För att övervinna dessa kritiska punkter, har vi utvecklat en särskild isoleringsmetoden, vilket, såsom visas ovan, gav goda resultat för CSC isolering. Uppenbarligen finns det en möjlighet att inte alla de sfärer som bildas kan återvinnas, men förlusten i procent är mycket låg. I själva verket har vi också möjlighet att använda ett filter med 40 um porer för att isolera områden när de blir stora (blanketted cirka 100-200 celler).

Denna isolering stannar sfär formation men medger att enskilda celler, en del av metylcellulosa återstoden och minsta sfärer filtreras. Denna eliminering utförs genom noggrann filtrering som beskrivs i protokollet.

Dessutom valet av de största sfäriska kolonier genom 40 um mesh med åtföljande förlust av de minsta sfäriska kolonier gör att man kan välja CSCs med den högsta kapaciteten att bilda sfäriska kolonier och med större stemness. Alla dessa ändringar genomfördes för att förbättra analysen och att hjälpa forskare som studerar CSCs att förstå och återge det mest kritiska steget i den ursprungliga metoden av sfären bildningsanalys.

Bland de studier om in vitro-metoder för att isolera CSCs denna studie syftar till att visa hur detta anpassade sfär bildningsanalys kan vara en bra metod för att isolera CSCs frånOSA-cellinjer. De anpassningar till den ursprungliga metoden och den detaljerade isoleringsteknik beskrivs förbättra dess effektivitet. På kort tid kan god antal CSCs erhållas och användas för flera experiment. Därför är det möjligt att snabbt bekräfta stammen liknande fenotyper och i synnerhet, för att studera den dubbla stammen-liknande fenotyp som kännetecknar OS-CSCs. Således kan denna modifierade analys vara en bra teknik för att isolera CSCs och studera deras biologi. I framtiden, denna metod, med ytterligare anpassningar, kan också användas för att isolera CSCs från andra finita cancercellinjer som erhållits genom biopsier av sällsynta fasta tumörer.

Möjligheten att isolera CSCs från sällsynta solida tumörer, såsom OS, tillåter inte bara en förbättring av studier om detta särskilt cancer utan även omfattar studier av olika typer av cancer för att utveckla bättre metoder för deras isolering och framtida studier av biologi denna viktiga cellulära delmängden. Därför, som vihar gjort i denna studie, är det viktigt att förbättra metoderna för CSC isolering genom studier av CSC biologi, med det slutliga målet att hitta molekylära mål och utveckla en mycket specifik cancerbehandling riktad mot denna cellulära delmängd, som är troligen ansvarig för upprätthållandet av den primära tumören, utvecklingen av dess återkommande, och uppkomsten av metastaser i flera organ. Studiet av CSC biologi är också viktigt för att hitta behandlingar som kan vara skarp i bota cancer, såsom OS, där överlevnaden efter neoadjuvant behandling är fortfarande mycket dålig.

Materials

Name Company Catalog Number Comments
Dulbecco's Phosphate Buffered Saline with Ca2+ and Mg2+ (DPBS) LONZA BE17-513F _
Dulbecco's Phosphate Buffered Saline  without Ca2+ and Mg2+ (DPBS) LONZA BE17-512F _
Porcine Trypsin 1:250 BD Difco 215310 Solvent: DPBS. Stock concentration: Powder
Ethylenediamine tetraacetic acid disodium salt dihydrate(EDTA) Sigma-Aldrich E4884 Solvent: DPBS. Stock concentration: Powder
Collagenase from Clostridium histolyticum Sigma-Aldrich C0130 Solvent: Buffer Solution, pH 7.4. Stock concentration: Powder
Dimethyl sulphoxide (DMSO) BDH Chemicals-VWR 10323 _
Nutrient Mixture F-12 Ham Sigma-Aldrich F6636 Solvent: Ultrapure dH2O. Stock concentration: Powder
2-Phospho-L-ascorbic acid trisodium salt Sigma-Aldrich 49752 Solvent: DPBS. Stock concentration: 5 mg/mL
β-Glycerol phosphate disodium salt pentahydrate Sigma-Aldrich 50020 Solvent: DPBS. Stock concentration: 1 M
Insulin. Human Recombinant Sigma-Aldrich 91077 Solvent: NaOH 0.1 M. Stock concentration: 10 mM
3-Isobutyl-1-methylxanthine Sigma-Aldrich I5879 Solvent: DMSO. Stock concentration: 500 mM
Indomethacin Sigma-Aldrich I7378 Solvent: DMSO. Stock concentration: 200 mM
Dexamethasone Sigma-Aldrich D4902 Solvent: DMSO. Stock concentration:  1 mM / 100 µM. Store in liquid nitrogen to maintain the biological activity
Fetal Bovine Serum (FBS) Sigma-Aldrich F7524 _
Fetal Bovine Serum South America  EUROCLONE ECS0180L _
Penicillin-Streptomycin (PEN-STREP) 10,000 U/mL LONZA DE17-602E _
Methyl cellulose Sigma-Aldrich 274429 Solvent: Ultrapure dH2O. Stock concentration: 2%
Putresceine dihydrochloride Sigma-Aldrich P5780 Solvent: Ultrapure dH2O. Stock concentration: Powder
apo-Transferrin  Sigma-Aldrich T-1147 Solvent: DPBS. Stock concentration: 25 mg/mL
Human Epidermal Growth Factor (EFGF) Sigma-Aldrich E5036 Solvent: DPBS pH 7.4. Stock concentration: 10 µg/mL
Fibroblast Growth Factor-Basic Human Sigma-Aldrich F0291 Solvent: DPBS + 0.2% BSA. Stock concentration: 25 µg/mL
Selenous Acid Sigma-Aldrich 211176 Solvent: DPBS. Stock concentration: 30 mM
Progesterone Sigma-Aldrich P8783 Solvent: ETOH. Stock concentration: 10 mM
Toluidine Blue O Sigma-Aldrich 198161 Solvent: Ultrapure dH2O. Stock concentration: Powder
Oil Red O ICN Biochemicals 155984 Solvent: 2-Propanol. Stock concentration: Powder
Naphtol AS-MX Phosphate Disodium Salt Sigma-Aldrich N5000 Solvent: DMSO. Stock concentration: Powder
Fast Blue BB Salt Sigma-Aldrich F3378 Solvent: Tris HCL, pH 9.0. Stock concentration: Powder
Fast Red Violet LB Salt Sigma-Aldrich F3381 Solvent: Tris HCL, pH 9.1. Stock concentration: Powder
Bovine Serum Albumin, Fraction V (BSA) Sigma-Aldrich A-4503 Solvent: DPBS. Stock concentration: 2%
Alizarin Red S ICN Biochemicals 100375 Solvent: Ultrapure dH2O. Stock concentration: Powder
Formaldehyde solution Sigma-Aldrich 533998 4%
Triton-100X MERCK 11869 Solvent: DPBS. Stock concentration: 0.2%. Danger - Use only under chemical hood
Calcein MERCK 2315 Solvent: DPBS . Stock concentration: 200 µg/mL
2-Propanol MERCK 109634 Danger - Use only under chemical hood
Ab-CD105                                                    (Mouse monoclonal [SN6] to CD105 (FITC) Abcam ab11415 Liquid. Application:               Flow Cytometry (Flow Cyt)
Ab-CD44                                       (Mouse monoclonal             [F10-44-2] to CD44 (PE/Cy7®) ) Abcam ab46793 Liquid. Application:               Flow Cytometry (Flow Cyt)
Ab-CD45                                              (Mouse monoclonal             [MEM-28] to CD45 (PerCP))  Abcam ab65952 Liquid. Application:               Flow Cytometry (Flow Cyt)
Ab-CD105                                                    (Human CD105 Purified Antibody)  Invitrogen MHCD10500 Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
Ab-CD44                                       (Anti-CD44 Antibody)  Abcam EPR1013Y(ab51037) Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
Ab-Stro-1                                   (Mouse anti-STRO-1)  Invitrogen 398401 Solvent: DPBS. Stock concentration: Lyophilized. Application:               Flow Cytometry (Flow Cyt)       Immunofluorescence staining (IF)
Alexa Fluor 488             (Anti-Rabbit IgG (Alexa Fluor 488 Donkey Anti-Rabbit IgG (H+L)) Invitrogen A-21206 Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
FITC Anti-Mouse IG (FITC-Rabbit Anti Mouse IgG (H+L)) Invitrogen 61-6511 Solvent: DPBS. Stock concentration: Lyophilized. Application:               Flow Cytometry (Flow Cyt)       Immunofluorescence staining (IF)
Alexa Fluor 635 Phalloidin  Invitrogen A34054 Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
AutoMACS™Running Buffer MACS Separation Buffer Miltenyi 130,091,221 Liquid. Store at 4 °C
QIAzol®Lysis Reagent QIAGEN 79306 Danger - Use only under chemical hood
QUANTITECT®                             Reverse Transcription Kit QIAGEN 205314
Chlorophorm Sigma-Aldrich C2432 Liquid. Danger - Use only under chemical hood
Laminar flow hood GELAIRE BSB6A
Chemical hood ARREDI TECNICI                             Villa Modello                                                      DYNAMICA
Centrifuge EPPENDORF 5415R
Laser Scanning Confocal Microscopy LSM 5109 Meta  ZEISS
iCycler PCR Thermalcycler  BIORAD
CyFlow®SPACE  (PARTEC)
Inverted Micrposcope Axiovert 200M  ZEISS
Freezing container , Nalgene
Original Pipet-Aid pbiBrand
Micropipettes EPPENDORF
Glass Pasteur Pipette SIGMA
VICTOR3™                       PERKIN ELMER
Conical tubes                         (15 and 50 mL)                             BD FALCON 352096 (for 15 mL)          352070 (for 50 mL)
24-Well Clear Flat Bottom TC-Treated Multiwell-Cell-Culture-Plate BD FALCON 353047
6-Well Clear Flat Bottom Ultra Low Attachment Multiple-Well-Plates CORNING 3471
Serological pipettes                    (5 and 10 mL)                                           BD FALCON 357543 (for 5 mL)              357551 (for 10mL)
Syringe (5mL)                              B|BRAUN 4617053V
Petri dish 100X20 mm              BD FALCON 353003
Röhren Tubes                     (3.5 mL, 55x12mm, PS)                SARSTEDT 55,484
Petri dish 60X15 mm                 BD FALCON 353004
Cryovials 1.5 mL             NALGENE 5000-1020
Cell-Culture Flasks 25 cm²       BD FALCON 353014
Nylon Net Filter, Hydrophilic MERCK NY4104700
Swinnex Filter Holder MERCK SX0002500
Perry tweezer 
Lancet
Dounce _ _ _

DOWNLOAD MATERIALS LIST

References

  1. Reddick, R. L., Michelitch, H. J., Levine, A. M., Triche, T. J. Osteogenic sarcoma: a study of the ultrastructure. Cancer. 45, (1), 64-71 (1980).
  2. Gatta, G., et al. Childhood cancer survival trends in Europe: a EUROCARE Working Group study. J. Clin. Oncol. 23, (16), 3742-3751 (2005).
  3. Olstad, O. K., et al. Molecular heterogeneity in human osteosarcoma demonstrated by enriched mRNAs isolated by directional tag PCR subtraction cloning. Anticancer. Res. 23, (3B), 2201-2216 (2003).
  4. Geller, D. S., Gorlick, R. Osteosarcoma: a review of diagnosis, management, and treatment strategies. Clin Adv Hematol Oncol. 8, (10), 705-718 (2010).
  5. Tang, N., Song, W. X., Luo, J., Haydon, R. C., He, T. C. Osteosarcoma development and stem cell differentiation. Clin. Orthop. Relat. Res. 466, (9), 2114-2130 (2008).
  6. Kempf-Bielack, B., et al. Osteosarcoma relapse after combined modality therapy: an analysis of unselected patients in the Cooperative Osteosarcoma Study Group (COSS). J. Clin. Oncol. 23, (3), 559-568 (2005).
  7. Meyers, P. A., et al. Osteosarcoma: a randomized, prospective trial of the addition of ifosfamide and/or muramyl tripeptide to cisplatin, doxorubicin, and high-dose methotrexate. J. Clin. Oncol. 23, (9), 2004-2011 (2005).
  8. Gorlick, R., et al. Biology of childhood osteogenic sarcoma and potential targets for therapeutic development: meeting summary. Clin. Cancer Res. 9, (15), 5442-5453 (2003).
  9. Hayden, J. B., Hoang, B. H. Osteosarcoma: basic science and clinical implications. Orthop. Clin. North Am. 37, (1), 1-7 (2006).
  10. Thomas, D., Kansara, M. Epigenetic modifications in osteogenic differentiation and transformation. J. Cell. Biochem. 98, (4), 757-769 (2006).
  11. Araki, N., et al. Involvement of the retinoblastoma gene in primary osteosarcomas and other bone and soft-tissue tumors. Clin. Orthop. Relat. Res. 270, (270), 271-277 (1991).
  12. Chou, A. J., Gorlick, R. Chemotherapy resistance in osteosarcoma: current challenges and future directions. Expert. Rev. Anticancer Ther. 6, (7), 1075-1085 (2006).
  13. Arndt, C. A. S., Crist, W. M. Common musculoskeletal tumorsof childhood and adolescence. N. Engl. J. Med. 341, (5), 342-352 (1999).
  14. Longhi, A., Errani, C., De Paolis, M., Mercuri, M., Bacci, G. Primary bone osteosarcoma in the pediatric age: state of the art. Cancer. Treat. Rev. 32, (6), 423-436 (2006).
  15. Bacci, G., et al. Long-term outcome for patients with nonmetastatic osteosarcoma of the extremity treated at the istituto ortopedico rizzoli according to the istituto ortopedico rizzoli/osteosarcoma-2 protocol: an updated report. J. Clin. Oncol. 18, (24), 4016-4027 (2000).
  16. Clarke, M. F., et al. Cancer stem cells-perspectives on current status and future directions: AACR workshop on cancer stem cells. Cancer. Res. 66, (19), 9339-9344 (2006).
  17. Lapidot, T., et al. A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature. 367, (6464), 645-648 (1994).
  18. Bonnet, D., Dick, J. E. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat. Med. 3, (7), 730-737 (1997).
  19. Visvader, J. E., Lindeman, G. J. Cancer stem cells in solid tumors: accumulating evidence and unresolved questions. Nat. Rev. Cancer. 8, (10), 755-768 (2008).
  20. Bapat, S. A. Evolution of cancer stem cells. Semin. Cancer Biol. 17, (3), 204-213 (2007).
  21. Rubio, D., et al. Spontaneous human adult stem cell transformation. Cancer. Res. 65, (8), 3035-3039 (2005).
  22. Burns, J. S., et al. Tumorigenic heterogeneity in cancer stem cells evolved from long-term cultures of telomerase-immortalized human mesenchymal stem cells. Cancer. Res. 65, (8), 3126-3135 (2005).
  23. Zhang, M., Rosen, J. M. Stem cells in the etiology and treatment of cancer. Curr. Opin. Genet. Dev. 16, (1), 60-64 (2006).
  24. Li, Y., et al. Evidence that transgenes encoding components of the Wnt signaling pathway preferentially induce mammary cancers from progenitor cells. Proc. Natl Acad. Sci. USA. 100, (26), 15853-15858 (2003).
  25. Sell, S. Cellular origin of cancer: dedifferentiation or stem cell maturation arrest? Environ Health Perspect. 101, (Suppl 5), 15-26 (1993).
  26. Wernig, M., et al. In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state. Nature. 448, (7151), 318-324 (2007).
  27. Niwa, H., Miyazaki, J., Smith, A. G. Quantitative expression of oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat. Genet. 24, (4), 372-376 (2000).
  28. Hochedlinger, K., Jaenisch, R. Nuclear reprogramming and pluripotency. Nature. 441, (7097), 1061-1067 (2006).
  29. Dean, M., Fojo, T., Bates, S. Tumor stem cells and drug resistance. Nat. Rev. Cancer. 5, (4), 275-284 (2005).
  30. Ma, S., Lee, T. K., Zheng, B. J., Chan, K. W., Guan, X. Y. CD133+ HCC cancer stem cells confer chemoresistance by preferential expression of the Akt/PKB survival pathway. Oncogene. 27, (12), 1749-1758 (2008).
  31. Wu, C., et al. Side population cells isolated from mesenchymal neoplasms have tumor initiating potential. Cancer. Res. 67, (17), 8216-8222 (2007).
  32. Ma, I., Allan, A. L. The role of human aldehyde dehydrogenase in normal and cancer stem cells. Stem. Cell. Rev. 7, (2), 292-306 (2011).
  33. Awad, O., et al. High ALDH activity identifies chemotherapy-resistant Ewing's sarcoma stem cells that retain sensitivity to EWS-FLI1 inhibition. PLoS One. 5, (11), e13943 (2010).
  34. Fujii, H., et al. Sphere-forming stem-like cell populations with drug resistance in human sarcoma cell lines. Int. J. Oncol. 34, (5), 1381-1386 (2009).
  35. Di Fiore, R., et al. Genetic and molecular characterization of the human osteosarcoma 3AB-OS cancer stem cell line: a possible model for studying osteosarcoma origin and stemness. J. Cell. Physiol. 228, (6), 1189-1201 (2013).
  36. Reynolds, B. A., Tetzlaff, W., Weiss, S. A multipotent EGF-responsive striatal embryonicprogenitor cell produces neurons and astrocytes. J. Neurosci. 12, (11), 4565-4574 (1992).
  37. Reynolds, B. A., Weiss, S. Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. Science. 255, (5052), 1707-1710 (1992).
  38. Gibbs, C. P., et al. Stem-like cells in bone sarcomas: implications for tumorigenesis. Neoplasia. 7, (11), 967-976 (2005).
  39. Beccari, N., Mazzi, V. Manuale di tecnica microscopic. Casa Editrice Dr. Francesco Vallardi Società Editrice Libraria. 99-100 (1966).
  40. Majumdar, M. K., Thiede, M. A., Mosca, J. D., Moorman, M., Gerson, S. L. Phenotypic and functional comparison of cultures of marrow-derived mesenchymal stem cells (MSCs) and stromal cells. J. Cell. Physiol. 176, (1), 57-66 (1998).
  41. Tirino, V., et al. Human primary bone sarcomas contain CD133+ cancer stem cells displaying high tumorigenicity in vivo. FASEB J. 25, (6), 2022-2030 (2011).
  42. Tirino, V., et al. Cancer stem cells in solid tumors: an overview and new approaches for their isolation and characterization. FASEB J. 27, (1), 13-24 (2013).
  43. Martins-Neves, S. R., et al. Therapeutic implications of an enriched cancer stem-like cell population in a human osteosarcoma cell line. BMC Cancer. 12, (1), 139 (2012).
  44. Tang, Q. L., et al. Enrichment of osteosarcoma stem cells by chemotherapy. Chin. J. Cancer. 30, (6), 426-432 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics