Cirkulerande MicroRNA Kvantifiering Använda DNA-bindande Dye kemi och Droplet Digital PCR

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Ferracin, M., Salamon, I., Lupini, L., Miotto, E., Sabbioni, S., Negrini, M. Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR. J. Vis. Exp. (112), e54102, doi:10.3791/54102 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Cirkulerande (i cellfria) mikroRNA (miRNA) frigörs från celler in i blodströmmen. Mängden specifika mikroRNA i cirkulationen har kopplats till ett sjukdomstillstånd och har potential att användas som sjukdoms biomarkör. En känslig och noggrann metod för att cirkulera mikroRNA kvantifiering med hjälp av en färgbaserad kemi och dropp digital PCR-teknik har nyligen utvecklats. Specifikt, med användning av Låst Nucleic Acid (LNA) -baserade miRNA specifika primrar med ett grönt fluorescerande DNA-bindande färgämne i en kompatibel dropp digital PCR-system är det möjligt att erhålla den absolut kvantifiering av specifika miRNA. Här beskriver vi hur utförande av denna teknik för att bedöma miRNA mängd i biologiska vätskor, såsom plasma och serum, är både möjligt och effektivt.

Protocol

MicroRNA Isolering från plasma eller serum

Obs: Plasma och förberedelse serum är ett viktigt steg i cirkulerande miRNA kvantifiering. Det inte finns någon föredragen procedur för plasma och serum beredning. Det enda viktiga sak att tänka på är att alla prover från samma experiment måste bearbetas med exakt samma arbetsflöde. Utgå från 200 ul serum eller plasma. Total RNA kan isoleras från serum eller plasma med användning av kommersiellt tillgängliga kit.

1. Protokoll för Total RNA (inklusive miRNA) Isolering

  1. Tina serum / plasmaprover på is.
  2. Tillsätt 1 ml Lysis Reagent (eg., QIAzol) till 200 ^ il serum / plasma.
  3. Blanda genom att vortexa och placera röret innehållande homogenatet på bänken vid RT under 5 min.
  4. Tillsätt 3 l av en 4,16 nM lösning av den syntetiska miRNA cel-MIR-39-3p från C. elegans.
  5. Tillsätt 200 | il kloroform. Skaka röret kraftigt i 15 sek. place the röret på bänken vid RT under 2 min.
  6. Centrifugera i 15 minuter vid 12.000 xg vid 4 ° C för att erhålla faser separation: den övre vattenfasen innehåller RNA.
  7. Överför vattenfasen till ett nytt rör, ca 700 pl, undvika överföring av någon vit interfas material.
  8. Tillsätt 1 ml 100% etanol och blanda genom inversion.
  9. Pipettera upp 700 ul av provet i en minispinnkolonn placerades på en 2 ml uppsamlingsrör. Stäng locket och centrifugera vid 12.000 xg under 15 sek. Kassera genomströmning.
  10. Upprepa detta steg med hjälp av återstående provet.
  11. Lägg 700 l Buffer RWT till minispinnkolonn, stäng locket och centrifugera i 15 sek vid 12.000 xg att tvätta kolonnen. Kassera genomströmning.
  12. Pipett 500 l Buffer RPE i minispinnkolonn. Stäng locket och centrifugera i 15 sekunder vid 12.000 varv per minut. Kassera genomströmning. Upprepa detta steg igen.
  13. Centrifugera minispinnkolonn vid full hastighet under 2 min för att torka spinnkolonnmembran från kvarvarande etanol.
  14. Överföra mini spinnkolonn i ett annat 1,5 ml uppsamlingsrör och pipett 35 ul RNas-fritt vatten på membranet av kolonnen.
  15. Centrifugera under 1 min vid 12000 xg för eluering av RNA.
  16. Förvara RNA vid -80 ° C.
    Obs: Eftersom RNA-koncentrationen inte kan bestämmas exakt, använda fasta volymer som ett mått för inmatning belopp.

2. MicroRNA omvänd transkription

  1. Tina omvänd transkription (RT) reagensblandningskomponenter: 5x reaktionsbuffert, nukleasfritt vatten. Blanda försiktigt vända rören och lägg på is. Omedelbart före användning, avlägsna enzymet mix från frysen och placera på is. Spinn ner alla reagenser.
  2. Förbered RT reagensblandning på is som beskrivs i tabell 1. Bered minst 10% överstiger mix.
  3. Blanda reaktionen genom pipettering och sedan spinn ner.
  4. Inkubera i 60 minuter vid 42 C.
  5. Värmeinaktivering av reverse transkriptas under 5 minuter vid 95 ° C.
  6. Omedelbart kyl till 4 ° C.
  7. Förvara cDNA vid -20 ° C.

3. cDNA Utspädning

  1. Späd den mängd cDNA-mall som krävs för de planerade ddPCR reaktioner i nukleasfritt vatten. Späd cDNA reaktionen mellan 1:50 och 1: 500 i vatten, beroende på mål miRNA överflöd. Lagra den utspädda cDNA vid -20 ° C. Den utspädda cDNA visade sig vara stabil i minst 3 månader vid -20 ° C.

4. Droppe Generation och PCR

Obs: Dropp generation bör utföras på 8 prover på en gång. Tekniska replikat behövs inte, på grund av den höga reproducerbarhet av denna teknik 12,15 .En kontroll utan templat (NTC) prov ska köras i varje platta och för varje enskild ddPCR tillstånd.

  1. Tina och jämvikt Master Mix (eg., EvaGreen Master Mix), mikroRNA primer set och cDNA vid RT.
  2. Blanda Master Mix thoroughly genom att vända röret flera gånger. Spinn ner alla reagenser.
  3. Förbered ddPCR mix som beskrivs i tabell 2. När flera ddPCR reaktioner utförs, förbereda en ddPCR blanda arbetslösning. Förbereda minst 10% överstiger mix.
  4. När monterad, blanda och spinn ner ddPCR mix.
  5. Dispensera 12 pl av ddPCR blanda i en 96-brunnars PCR-platta eller PCR-rör.
  6. Tillsätt 8 | il av utspätt cDNA-templatet till varje rör / brunn.
  7. Sätt i droppgeneratorn patronen i hållaren.
  8. Överföring 20 | il av varje beredda provet till provbrunnarna (mellersta raden) i droppgeneratorn patronen noga samtidigt som man undviker luftbubblor i botten av brunnen.
  9. Fyll varje oljekälla (nedersta raden) med 70 pl droppgenerator olja.
  10. Haka packningen över patronhållaren och sätt in i droppgeneratorn.
  11. Stäng locket för att starta dropp generation enligt tillverkarens protocol. När dropp generation är klar, öppna locket, ta bort engångs packningen. De övre brunnarna i patronen innehåller dropparna.
  12. Pipettera långsamt och jämnt 40 | il av innehållet i de åtta topp brunnar (dropparna) till en enda kolonn av en 96-brunnars PCR-platta.
  13. Täta PCR-plattan med folie omedelbart efter överföring droppar för att undvika avdunstning. Använda genomstickbara folieplatta tätningar som är kompatibla med nålarna i droppen läsaren.
  14. Börja termisk cykling (PCR) inom 30 minuter tätnings plattan.
  15. Utföra cykelprotokoll enligt tabell 3.

5. Droplet Läsning

  1. Slå på dropp läsaren.
  2. Flytta plattan från termocykler till dropp läsaren.
  3. Placera 96-brunnars PCR-platta som innehåller de post-PCR-droppar in i botten av plåthållaren.
  4. Placera toppen av plåthållaren på PCR-plattan. Tryck fast båda frigöringsflikarnanedåt för att säkra PCR-plattan i hållaren.
  5. Starta programmet från system PC.
    1. Klicka på Inställningar för att definiera experimentet (absolut kvantifiering) och klicka sedan på Kör för att starta dropp läsning.
    2. När dropp läsning är klar, klicka på "Analysera" -knappen för att öppna och analysera data.
    3. Använd 2D amplitud tomt i analysprogram för att välja positiva droppar (lassoverktyget) (Figur 1B).
    4. Använd fliken Händelser att kontrollera antalet positiva och totala droppar. Totalt antal 18.000 - 21.000 droppar uppnås vanligen med probeless ddPCR.
    5. När positiva dropparna väljs exportera koncentrationsvärdena miRNA med hjälp av export CSV alternativet på fliken Koncentration.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Den absoluta mängden av specifika miRNA per ml plasma eller serum kan bestämmas med användning av en grönfluorescerande DNA-bindande färgämne och dropp digital PCR-teknologi. Figur 1 presenterar processen med positiv droppar urval, som bestämmer den slutliga miRNA koncentration (kopior / | il ) i amplifieringsreaktionen beräknas av analysprogram. Mängden av varje miRNA i blodet är mycket annorlunda, eftersom vissa miRNA arter rikligare än andra. Med hjälp av en 1:50 utspätt cDNA i ddPCR reaktion är det möjligt att erhålla ett tillräckligt antal positiva och negativa droppar. Vid positivt dropp mättnad (eg., Inga kvarvarande negativa droppar), kan en ytterligare utspädning av cDNA prover vara nödvändigt.

Varje LNA primer set bör optimeras för att fungera på dropp digitala PCR-system. Optimeringsprocessen för MIR-181a-5p ärrepresenterat i figur 2 Specifikt ändring av mängden primer (vanligen i intervallet från 0,25 till 1 | j, l per ddPCR reaktion). och glödgningstemperaturen (vanligen i intervallet 56 - 60 ° C), är det möjligt att välja den kombination som bestämmer en bättre separation mellan positiva och negativa droppar. När det gäller MIR-181a-5p, 60 ° C glödgningstemperatur och båda 0,5 och 1 pl primer mängder ger bättre resultat i form av dropp amplitud.

Det kan hända att en primeruppsättning ger vissa icke-specifik amplifiering, troligen på grund av primerdimerer bildning. När man arbetar med cirkulerande miRNA, kunde den positiva signalen från prover vara mycket låg och därför liknar den icke-specifik signal. Om "molnet" av icke-specifikt mål förstärkning inte överlappar med den sanna signalen (Figur 1C), kan miRNA fortfarande kvantifieras välja endast den sanna positiva droppar. I det här fallet, är NTC provet viktigt för dropp val. Samtliga prover som skall ingå i samma analys måste bearbetas med samma metod och identiska ddPCR skick.

Figur 1
Figur 1. Positiva Droppar Selection. Positiva droppar manuellt valda under analysen med hjälp av en tröskel över de negativa dropparna i 1D plot (A) eller utföra en cirkel runt den positiva dropp moln i 2D plot (B). Om några primerset ger en icke-specifik amplifiering, detta framgår av en andra moln av positiva droppar som visas i den negativa kontrollen (kontroll utan templat, NTC) prov (C). Den "sanna" positiva kan fortfarande väljas exklusive den ospecifika signalen i 2D tomt.e.jpg "target =" _ blank "> Klicka här för att se en större version av denna siffra.

figur 2
Figur 2. Primer Optimering för Cell-free miRNA Kvantifiering med Probeless ddPCR Övre panel. Kvantifiering av MIR-181a-5p i två plasmaprover (S1 och S2) med 4 olika ddPCR villkor. MIR-181a-5p LNA primer koncentration (0,5 och 1 pl) och glödgningstemperaturen (58 och 60 ° C) påverkar amplituden av positiv (blå) och negativa (svarta) droppar i DNA-interkalerande färgämne ddPCR. En bättre separation för denna miRNA kan erhållas utföra PCR vid 60 ° C och med användning av antingen 0,5 eller 1 | j, l primer. Kontrollprovet (NTC, kontroll utan templat) inte har några positiva droppar, som förväntat. Centrala panelen: Slutlig koncentration av MIR-181-5p i ovan nämnda betingelser. Resultaten presenteras som kopior per mikroliter i förstärkarefiering reaktion. Felstaplar representerar Poissons 95% konfidensintervall. Nedre panel. Antal positiva droppar (blå) på det totala antalet droppar (grön) Klicka här för att se en större version av denna siffra.

Reagens Volym (il)
5x reaktionsbuffert 4
Nukleasfritt vatten 11
enzymblandning 2
Mall totalt RNA 3
Total volym 20

Tabell 1 - omvänd transkription reagensblandning Components

Reagens Volym (il)
2x DNA-bindande färgämne Supermix 10
LNA primer set variabel (0,5 - 1) *
Nukleasfritt vatten variabel
Utspädd cDNA mall 8
Total volym 20
* En första ddPCR reaktion bör uppträda med några prover för att fastställa det bästa arbetande mängd primer

Tabell 2 - ddPCR reagensblandning Components

cykling Steg Temperatur Tid ramp~~POS=TRUNC Rate cykler
enzymaktivering 95 ° C 5 min ~ 2 ° C / sek 1
denaturering 95 ° C 30 sek 40
Annealing / förlängning 60 ° C 1 min
signalstabilisering 4 ° C 5 min 1
90 ° C 5 min 1
Hold (tillval) 4 ° C oändlig 1
Använda ett uppvärmt lock inställd på 105 ° C och ställ in provvolymen till 40 | j, l.

Tabell 3 - termisk cykling Villkor för Droplet Digital PCR

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Cirkulerande miRNAs är närvarande i blod vid extremt låga koncentrationer och mängden RNA som kan extraheras från plasma- och serumprover är låg. Av denna anledning, är de svåra att kvantifiera med andra tekniker såsom mikromatris och RNA-sekvensering. Dessutom finns det en generaliserad brist på avtal om data normalisering och närvaron av endogena "referens" miRNA i blodet. I detta sammanhang är en känslig teknik som dropp digital PCR, med förmåga att räkna antalet miRNA kopior per ml serum eller plasma, även om mycket låg, är mycket attraktiv. Vi parat denna teknik med en universell cDNA system som omvänd transkriberar alla cirkulerande miRNA i en reaktion därför sparar tid och, viktigast av allt, RNA material. I vår strategi är specificiteten inneboende i användningen av LNA primers, som utförs mycket väl i miRNA kvantifiering jämfört med andra lösningar 16.

Liten droppedigital PCR är en slutpunkt analys som möjliggör beräkning av målgener absolut koncentration. Till skillnad från kvantitativ PCR, gör otillräckliga förstärkningseffektivitet inte påverka den slutliga ddPCR kvantifiering. Därför beaktar mängden PCR-inhibitorer är närvarande exempelvis i blodprover, ger ddPCR ett kraftfullt verktyg för att cirkulera nukleinsyror bedömning.

På grund av dess höga känslighet, tillhandahåller teknik en adekvat kvantifiering också av de mindre rikligt förekommande miRNA, även med begränsad mängd utgångsmaterial. Dessutom, om man antar att varje miRNA molekylen transkriberas omvänt i en cDNA-molekyl, kan vi beräkna de absoluta kopior i ett xl plasma / serum multiplicera den erhållna koncentrationen i ddPCR reaktions värde för en spädningsfaktor (145,83).

De presenterade arbetsflöde kan lätt utföras på 8-96 prover på en gång, vilket ger en tillförlitlig och tid effektivt verktyg för mikroRNA kvantifiering Clinical prover. Droppe digital PCR har potential att bli ett viktigt verktyg för nukleinsyror Biomarkers bedömning i en diagnostisk miljö och därigenom föra flytande biopsi från bänken till säng.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

Med stöd av medel från den italienska föreningen för cancerforskning (AIRC) till MF (MFAG 11676) och MN (Special Program Molecular Clinical Oncology -. 5 promille n 9980, 2010/15) och från det italienska ministeriet Undervisnings, universitet och forskning FIRB 2011 till MN (Project RBAPIIBYNP).

Materials

Name Company Catalog Number Comments
miRNeasy Mini Kit Qiagen 217004 Columns for total RNA, including miRNA, extraction from serum/plasma
100 nmole RNA oligo Cel-miR-39-3p Integrated DNA Technologies Custom Sequence: UCACCGGGUGUAAAUCAGCUUG
Universal cDNA synthesis kit II, 8-64 rxns Exiqon 203301 Kit for microRNA reverse transcription
MicroRNA LNA PCR primer set  Exiqon 204000-206xxx and 2100000-21xxxxx Primers for miRNA amplification inside droplets
QX200 droplet generator BioRad 186-4002 Instrument used for droplet reading
QX200 droplet reader BioRad 186-4003 Instrument used for droplet generation
QuantaSoft software BioRad 186-3007 Software for data collection and analysis
PX1 PCR plate sealer BioRad 181-4000 Plate sealer
DG8 droplet generator cartridges and gaskets BioRad 186-4008 Cartridges used to mix sample and oil to generate droplets
QX200 ddPCR EvaGreen supermix BioRad 186-4033/36 PCR supermix
QX200 droplet generator oil for EvaGreen dye BioRad 186-4005 Oil for droplet generation

DOWNLOAD MATERIALS LIST

References

  1. Arroyo, J. D., et al. Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma. Proc Natl Acad Sci U S A. 108, 5003-5008 (2011).
  2. Skog, J., et al. Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers. Nat Cell Biol. 10, 1470-1476 (2008).
  3. Vickers, K. C., Palmisano, B. T., Shoucri, B. M., Shamburek, R. D., Remaley, A. T. MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins. Nat Cell Biol. 13, 423-433 (2011).
  4. Braicu, C., et al. Exosomes as divine messengers: are they the Hermes of modern molecular oncology. Cell Death Differ. 22, 34-45 (2015).
  5. Creemers, E. E., Tijsen, A. J., Pinto, Y. M. Circulating microRNAs: novel biomarkers and extracellular communicators in cardiovascular disease. Circ Res. 110, 483-495 (2012).
  6. Guay, C., Regazzi, R. Circulating microRNAs as novel biomarkers for diabetes mellitus. Nat Rev Endocrinol. 9, 513-521 (2013).
  7. Schwarzenbach, H., Nishida, N., Calin, G. A., Pantel, K. Clinical relevance of circulating cell-free microRNAs in cancer. Nat Rev Clin Oncol. 11, 145-156 (2014).
  8. Moldovan, L., et al. Methodological challenges in utilizing miRNAs as circulating biomarkers. J Cell Mol Med. 18, 371-390 (2014).
  9. Tiberio, P., Callari, M., Angeloni, V., Daidone, M. G., Appierto, V. Challenges in Using Circulating miRNAs as Cancer Biomarkers. Biomed Res Int. 2015, 731479 (2015).
  10. Jarry, J., Schadendorf, D., Greenwood, C., Spatz, A., van Kempen, L. C. The validity of circulating microRNAs in oncology: five years of challenges and contradictions. Mol Oncol. 8, 819-829 (2014).
  11. Witwer, K. W. Circulating MicroRNA Biomarker Studies: Pitfalls and Potential Solutions. Clin Chem. 61, 56-63 (2015).
  12. Miotto, E., et al. Quantification of Circulating miRNAs by Droplet Digital PCR: Comparison of EvaGreen- and TaqMan-Based Chemistries. Cancer Epidemiol Biomarkers Prev. 23, 2638-2642 (2014).
  13. Ferracin, M., et al. Absolute quantification of cell-free microRNAs in cancer patients. Oncotarget. (2015).
  14. Mangolini, A., et al. Diagnostic and prognostic microRNAs in the serum of breast cancer patients measured by droplet digital PCR. Biomarker Research. (2015).
  15. Hindson, C. M., et al. Absolute quantification by droplet digital PCR versus analog real-time PCR. Nat Methods. 10, 1003-1005 (2013).
  16. Mestdagh, P., et al. Evaluation of quantitative miRNA expression platforms in the microRNA quality control (miRQC) study. Nat Methods. 11, 809-815 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics