Klasik Hodgkin Lenfomalı Reed-Sternberg Hücrelerinin Akış-Sıralama ve Ekstraksiyon Sıralaması

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Burada, klasik Hodgkin lenfoma (HRS) hücrelerinden Hodgkin Reed-Sternberg (HRS) hücrelerinden yüksek kaliteli, tamamen exome veri üretmek üzere tasarlanmış, kombine bir akış sitometrik hücre sıralama ve düşük girişli, yeni nesil kütüphane yapılandırma protokolünü açıklıyoruz.

Cite this Article

Copy Citation | Download Citations

Reichel, J. B., McCormick, J., Fromm, J. R., Elemento, O., Cesarman, E., Roshal, M. Flow-sorting and Exome Sequencing of the Reed-Sternberg Cells of Classical Hodgkin Lymphoma. J. Vis. Exp. (124), e54399, doi:10.3791/54399 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Klasik Hodgkin lenfomasının Hodgkin Reed-Sternberg hücreleri, inflamatuvar lenfositlerden oluşan bir arka plan içinde seyrek dağılır ve tipik olarak tümör kütlesinin% 1'inden daha azını oluştururlar. Toplu tümörden türetilen materyal, karakterizasyon için yetersiz konsantrasyonda tümör içeriği içerir. Bu nedenle, sekiz antikorun yanısıra yanal ve öne saçılan floresanla aktive edilmiş hücre ayırımı burada daha sonraki çalışmalarda tümörden yüksek saflıkta binlerce HRS hücresi ile hızlı bir şekilde ayrılma ve konsantrasyon yöntemi olarak tanımlanmaktadır. Aynı zamanda, ekspres sıralama için standart protokoller genellikle 100-1000 ng girdi DNA gerektirir, bu da genellikle akış sıralama ile çok yüksektir, ayrıca yüksek kaliteli üretilebilen optimize edilmiş, düşük girişli bir kütüphane yapım protokolü sağlarız En az 10 ng giriş DNA'sı verileri. Bu kombinasyon, yeni nesil kütüphaneler üretebilir; bu kütüphaneler, bütün eXome yemleri veya daha fazla odaklanmış hedef paneller. HRS hücrelerinin ekspres dizilimi, sağlıklı tümör içi T veya B hücreleriyle karşılaştırıldığında, mutasyonlar, eklemeler ve silmeler ve kopya sayısı değişiklikleri dahil olmak üzere somatik değişiklikleri tanımlayabilir. Bu bulgular, HRS hücrelerinin moleküler biyolojisini aydınlatmakta ve hedefli ilaç tedavilerinin yollarını gösterebilir.

Introduction

Yeni jenerasyon sekanslamanın bir sonucu olarak kanser genomolojisindeki ilerlemeler, birçok hematolojik ve non hematolojik neoplazm için terapötik hedeflerin tanımlanmasında ve prognostikasyonda önemli gelişmelere yol açtı. Spesifik genomik değişikliklere dayalı yeni bireyselleştirilmiş tedavi stratejileri, birçok tümör tipinde hızla ortaya çıkmaktadır (referanslar 1 , 2'de gözden geçirilmiştir). Lenfoma genomiklerinde önemli gelişmelere rağmen, klasik Hodgkin lenfoma (CHL) neoplastik HRS hücrelerinin genomu az açıklanmıştır. Soruşturmalar, reaktif mikro ortamda neoplastik HRS hücrelerinin azlığı nedeniyle engellendi ve saf HRS hücre popülasyonlarının izole edilmesi güçleşti.

Primer tümörlerden canlı HRS hücrelerinin izole edilmesi yöntemi Fromm ve ark. Tarafından geliştirilmiştir . 4 ,Ref "> 5 , 6. Bu yöntem, bir CHL tümör süspansiyonundan kesin olarak HRS hücrelerini tanımlamak için, CD30, CD15, CD40, CD95, CD45 CD20, CD5 ve CD64'den oluşan bir sekiz antikorlu kokteyl kullanmaktadır. En azından 107 hücre (yaklaşık 10 mg doku) içeren tümör biyopsilerinden taze veya dondurulmuş hücre süspansiyonlarından en az 1000 yaşayan HRS hücresini izole edebilmektedir Saflık, akış sitometrik analizle% 90'dan büyüktür ve tahmin edildiği üzere En az% 80, ardışık on vakanın ekzojen genomik analizi.

Birincil CHL tümörlerinden binlerce canlı HRS hücresinin hızla izole edilmesini sağlayan, işlemi büyük ölçüde hafifleten bir akış sitometrik hücre izolasyon tekniğini rafine ettik. Birincil Hodgkin lenfoma vakalarında tümör hücrelerinin ilk tüm eksende serisinin olduğuna inananların üretilmesi için bu tekniği kullandık. Çalışmalarımız,Tekli CHL vakaları için yüksek verimli, genom çapında çalışmaların fizibilitesi ve CHL patogenezinin özelliklerini açıklama potansiyeline sahip yeni genomik değişikliklerin belirlenmesine zaten yol açtı.

Yüksek verimli genomik çalışmalar için çıkarılan DNA'yı kullanmak için bir boru hattı daha geliştirdik. 1.000'e kadar sıralanmış HRS hücrelerinden (en azından ardışık vakalardan elde edilen) güvenilir sonuçlar elde etmek için, adaptör ligasyon verimliliğini arttırmamıza ve DNA fragmanı kütüphaneleri üretmemize izin veren modifiye yeni nesil DNA kütüphanesi oluşturma prosedürü8 daha da geliştirdik Aşırı amplifikasyon olmaksızın. Bu yöntem, rutin klinik örneklerin analizi ve tekrar eden mutasyonların ve kromozomal değişikliklerin saptanmasına imkan verir 7 .

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Doku İşleme ve Dondurma

  1. Lenf düğümü dokusunu fosfat tamponlu salin (PBS) veya Roswell Park Memorial Enstitüsü ortamı (RPMI) içinde toplayın ve toplama işleminin 24 saati içinde işleme tabi tutun. Çıkarılan lenf nodu dokusunu 9 ,% 2 fetal buzağı serumu (FCS) ile 10 mL RPMI içeren bir Petri kabına aktarın ve taze bir neşter bıçağı ile ince bir şekilde kıyplayın. Dokuyu öğütmek / parçalamak için 10 mL şırınga pistonunun arkasını kullanın.
  2. Sıvıyı, 100 μm'lik bir hücre süzgeci yoluyla 50 mL'lik bir konik tüpe aktarın. Petri kabını ve filtreyi ilave 10 mL RPMI% 2 FCS ile yıkayın.
  3. Otomatik bir hücre sayacı veya bir hemositometre kullanarak bir hücre sayısı elde edin.
    NOT: Genel olarak, yaklaşık 5 mm3 CHL lenf nodu dokusundan en az 2 x 107 hücre beklenir. % 80'in üzerinde bir canlılık bekleniyor, ancak örnek göre değişebilir.
  4. Hücreleri 400 xg'de 10 dakika döndürün ve aspirasyon yapınSüpernatanı test edin. Hücre pelletini içeren tüpü buz üzerine koyun.
  5. Buz üzerinde önceden soğutulmuş dondurucu madde. 2 x 10 7 / mL konsantrasyonda soğuk dondurma ortamında hücreleri tekrar süspansiyon ve pipetleme ile tekrar süspansiyon haline getirin. Vorteks etme. Süspansiyonu 10 dakika boyunca buz üzerinde inkübe edin.
  6. Örnek 1 mL / cryo flakon (önceden buz soğutmalı) alıntılayın. Şişeleri 1-2 gün boyunca -80 ° C derin dondurucuya aktarın ve tekrar sıvı nitrojene aktarın.

2. Hücre Ayırma için Hücre Süspansiyonlarının Hazırlanması

NOT: Her bir antikor lotu, 300 μΛ boyama hacminde 10 milyon hücre kullanılarak titre edilmelidir. Periferik kan CD30 dışındaki tüm antikorlar için kullanılabilir, bunun için titrasyon 10 için periferik kana eklenen KMH2 hücre hattı kullanılabilir. Genellikle üretici tarafından tavsiye edilen antikor hacmi ile başlar ve iki iki kat seyreltme ve iki kat artış (dört veri noktası) gerçekleştiririz.Her bir lot antikor titrasyonu için. Örneğin, üretici 10 μL hacim önerdiğinde, titrasyonu 2, 5, 10 ve 20 μL hacimlerde gerçekleştiririz.

  1. Bir su banyosu 37 ° C'ye ayarlayın. Titreşimli antikor miktarını karanlık bir cam şişe içerisinde önceden karıştırın ve toplam 100 μL'lik bir kokteyl hacmi için PBS +% 2 BSA ekleyin.
    NOT: Antikorların titrasyonlanmasını öneriyoruz, ancak aşağıdaki ciltler bir başlangıç ​​noktası olarak kullanılabilir: CD64, 20 uL; CD95, 5 uL; CD30, 20 uL; CD5, 10 uL; CD20, 10 uL; CD15, 20 uL; CD40, 5 uL; Ve CD45, 10 uL.
  2. Çözünmeyi önlemek için flakonu sıvı nitrojenden kuru buz içeren bir buz kovasına aktarın. 37 mL'lik bir su banyosunda 50 mL'lik konik bir tüpte RPMI /% 20 FCS / DNase (100 μg / mL) içeren 50 mL eritici maddenin önceden ısıtın.
  3. 45 mL eritme maddesini yeni bir tüpe aktarın ve 37 ° C'de tutun. Hücreleri, 37 ° C'lik su saksısında kriyojenik bir viyal tutarak hızla çözülürSaat kadar çok az donmuş kısım kalır.
  4. Şişe içeriğini, 45 mL eritici maddenin bulunduğu tüpe boşaltın. Boş kriyojenik flakonu 1 mL eritme maddesi ile 2 kez durulayın ve durulayıcıları birleştirin.
  5. DNaz sindirimi ve hücre yeniden dengeleme için izin vermek için hücreleri oda sıcaklığında 15 dakika inkübe edin. Hücreleri 500 xg'de 10 dakika döndürün ve süpernatantı aspire edin.
  6. Çözülen yaklaşık 200 mcL çözülme hücresini (5 mL) tekrar süspanse edin ve 2-3 dakika oda sıcaklığında dengeye getirmesine izin verin. Donmuş canlı hücrelerin>% 70'inin iyileştirilmesi beklenmektedir.
    NOT: İsteğe bağlı olarak, bağlı T hücreleri tarafından roze yapılabilen sıralanmış HRS hücrelerinin saflığı için bu aşamada etiketlenmemiş antikorlardan oluşan bir kokteyl eklenebilir (isteğe bağlı protokole bakınız).
  7. Bir antikor kokteyli 100 mcL ekleyin ve ışığa karşı korunan oda sıcaklığında (RT) 15 dakika inkübe edin. 3 mL ayırma aracı ekleyin, hücreleri 500 xg'de döndürün10 dakika boyunca karıştırın ve süpernatanı aspire edin.
  8. Hücreleri, ayırma ortamının 1 mL'sinde süspanse edin ve bunları bir 5 mL akış tüpü üst süzgeçine aktarın.
  9. 50 mL konik tüp ve hücre süzgecini, ilave bir 1 mL'lik ayırma aracı ile durulayın ve buz üzerine yerleştirin.

3. (Opsiyonel Protokol) T Hücre Roset Bloklama

NOT: HRS hücreleri, doku kesitleri ve hücre süspansiyonundaki T hücreleri tarafından rozetlenir ve bu T hücreleri, sıralanmış HRS fraksiyonunu potansiyel olarak kirletebilir. Bu etkileşimler, T hücreleri 4 , 11 üzerinde LFA-1 ve CD2'ye bağlanan HRS hücresi üzerindeki CD54 ve CD58 aracılıdır. Bu etkileşimler, bu adezyon moleküllerine yönelik işaretlenmemiş antikorlarla bloke edilebilir.

  1. RPMI 100 mcL'de 100.000 ila 500.000 hücreye bölün.
  2. CD2, CD54, CD58 ve LFA-1'e (her biri 10 mcL) etiketlenmemiş antikorlarla hücre süspansiyonunu 1 saat boyunca buz üzerinde buz koyun. THücre süspansiyonu floresan antikorlarla etiketlenebilir.

4. Hücre Ayırma Yöntemi Kullanılarak HRS-, B- ve T-hücresi İzolasyonu

NOT: 5 lazer kullanan özel bir araştırma düzenini kullanmış olsak da (bkz. Malzeme cetveli), antikor panelinde kullanılan florokromları tespit edebilen herhangi bir ayırıcı yeterli olmalıdır. Aşağıdaki adımların uygulanması, yazılım 12 işlevine aşinalık ve hücre sıralayıcı işlemleri hakkında temel bilgi gerektirir. Ayrıntılı talimatlar için lütfen çevrimiçi yazılım kılavuzuna bakın.

  1. Sitometre kurulumu:
    1. Bilgisayarı açın ve oturum açın. BSC'ye (ve BSC çıkışlarına) güç verin ve ardından sitometrenin gücünü açın. Başlamak için sitometrenin dahili CPU'su için en az 90 saniye bekleyin ve ardından lazer kontrol yazılımını açın ve tüm lazerlere güç verildiğini doğrulayın. Sitometre yazılımını 13 başlatın ve oturum açın..
    2. Sitometre yazılımında "Sitometre → Yapılandırmaları Görüntüle" yi tıklayın. Yapılandırma alt programının iletişim kutusu açıldığında, 130 μm özel yapılandırmayı vurgulayın ve "yapılandırmayı ayarla" ve "Tamam" ı tıklayın. Yapılandırma alt programından çıkın.
    3. Sitometre yazılımındaki diyalog kutusuna dikkat edin ve "CS & T ayarlarını kullan" ı tıklayın. Cihaza 130 μm'lik bir meme takın ve akış penceresindeki kırmızı "X" düğmesini tıklayarak akışı açın. Cihazın en az 30 dakika ısınmasına izin verin.
    4. İstenilen yöntemi kullanarak cihaz üzerinde bir performans kontrolü yapın (burada açıklanan sıralayıcıya bir performans izleme yazılım modülü dahildir, yazılım kılavuzuna bakın (sf. 117-122) ve referans standardı (bkz. Standartta kullanılan malzemeler) Bu kurulum).
      1. "Cytometer → CST" i tıklayın, "Characterize" alanının "Chec" olarak ayarlandığından emin olunK Performans "ı tıklayın ve" Çalıştır "ı tıklayın. Yazılım tarafından istendiğinde, örnek partisine bir referans partikülleri tüpü yükleyin ve" Tamam "ı tıklayın.
      2. İşlem tamamlandıktan sonra, "Son" düğmesine tıklayın ve yazılım modülünü kapatın. Sitometre yazılımı sitometrenin tekrar bağlantısını tamamladıktan sonra, beliren iletişim kutusunda "CS & T ayarlarını kullan" ı tıklayın.
    5. Sitometre yazılımının otomatik düşme geciktirme özelliğini kullanarak doğru bırakma gecikmesini belirleyin (yazılım kılavuzunun s. 154 - 161'e bakın).
      1. Sitometre yazılımının "Tarayıcı" penceresindeki "Bırakma Gecikmesi" deneyini açın, numune aşamasında bir kalibrasyon parçacıkları tüpü yerleştirin ve "Edinme Kontrol Paneli" penceresinde "Yükle" yi tıklayın. "Akış" penceresindeki "Tatlı Nokta" düğmesini tıklayarak otomatik akış izleme özelliğini açın. Bu özelliği, takip etmek için her zaman açık bırakmaG adımlar.
      2. Yan akış penceresindeki "Gerilim" düğmesini tıklayarak saptırma plakası voltajını açın ve ardından "Gerilim" düğmesine hemen bitişikteki "Test Sıralama" düğmesini tıklayarak test sıralama özelliğini açın.
      3. Sol taraf akışı hariç tüm yan akış ayarlarını sıfıra ayarlayın. Sol taraf akışı ayarını, yan akış penceresinde iki akış noktasının görülebileceği şekilde ayarlayın. "Optik Filtre" düğmesini tıklayın ve sol yan akış spotunun, yan akış penceresinin siyah alanında görünen sol kutunun içine düştüğünü doğrulayın.
      4. Gerekirse sol yan akım ayarını yapın. "Sıralama Testi" düğmesine tekrar basarak test sıralama özelliğini kapatın. "Tarayıcı" penceresinde, "Bırakma Gecikmesi" denemesinin "Genel Çalışma Yaprakları" öğesini "+." Tıklayarak genişletin.
      5. Sıralama düzenini açmak için "Düzen Düzeni _001" e çift tıklayın, görsel denetleme ile doğrulayınSol sıralama popülasyonunun "P1" e ait olduğunu ve "Sıralama Düzeni" penceresinde "Sıralama" yı tıkladığını belirtir. "Düzen Düzeni" penceresinde "Otomatik Gecikme" ve ardından "Çalıştır" ı tıklayın.
      6. İşlem tamamlandığında, "Çıkış" ı tıklayın. Örnek sahnesine steril deiyonize su tüpü takın ve "Edinme Gösterge Tablosu" penceresinde "Yükle" yi tıklayın. Devam etmeden önce aletten kalan test parçacıklarını temizlemek için su tüpünü en az 5 dakika çalıştırın.
    6. Sıralayıcı yazılımında dahili bir kompanzasyon ayarını kullanarak kompanzasyon kontrollerini (Malzeme elektronik tablosundan veya eşdeğerlerinden kompozisyon boncukları kullanarak) çalıştırın (ek ayrıntılar için yazılım kılavuzunun s. 131 - 137'ye bakınız).
      1. "Yeni Denemeyi Deney" i tıklayarak yeni bir deneme oluşturun. "Alet Durumu" penceresinin "Parametreler" sekmesinde varsa kullanılmayan parametreleri silin. "Deneme Karşıtlığı" nı tıklayınIyon Ayarı Kompanzasyon Kontrolleri Oluşturun. "
      2. "Tarayıcı" penceresinde "+" işaretini tıklayarak "Telafi Kontrolleri" örneğini genişletin. Telafi kontrol tüplerini verileri kaydetmeden çalıştırın ve gerekirse dedektör voltajlarını ("Enstrüman Durumu" penceresinin "Parametreler" sekmesinde ayarlayın), böylece her florokrom için pozitif boyanmış boncuk popülasyonları 10.000 ve 100.000 kanal arasında olacak şekilde ayarlayın ve Birincil algılama kanalında en parlak olanı.
      3. Her bir tüp için her parametre için gereken voltajları yazın. "Tazminat Kontrolleri" örneğinin altında bulunan "Unstained Control" tüpünü, tekli sol tıklama ile vurgulayın. Lekesiz kontrol tüpünü numune aşamasına yerleştirin ve "Satın Alma Kontrolü" penceresindeki "Yükle" yi tıklayın.
      4. Tüm parametreler için dedektör voltaj alanlarına tek tek kompanzasyon kontrolleri uygulayarak belirlenen voltajları manuel olarak girin veArdından "Edinme Kontrolü" penceresindeki "Kaydet" düğmesini tıklayın. Kalan telafi kontrollerini çalıştırın, dedektör ayarlarını değiştirmeden verileri kaydedin. Devam etmeden önce cihazdaki artık maddeleri temizlemek için 5 dk boyunca steril, deiyonize su tüpü takın.
  2. HRS hücresi kapısı:
    1. 3.000-4.000 olay / s edinmek için akış oranını ayarlarken başlangıç ​​kapısı açma işlemi için en az 100.000 olayı edinin ve kaydedin (bkz. Adım 4.1).
      NOT: Hücre konsantrasyonu çok yüksekse, hücreleri sulandırmak için ilave sınıflandırma aracı eklemek gerekebilir. Edinimi durdurun.
    2. Gate HRS hücrelerini, Şekil 1'de
      NOT: Çoğu CHL vakasında, hücrelerin% 0.01 ila% 0.1'i HRS hücreleri olacaktır.
  3. B ve T hücresi geçidi:
    1. CD20 ve CD5 kapısı ile somatik kontrolleri (B ve T hücreleri) tanımlayın, respe(Lenfositleri CD45 / SSH ile kapamaktadır), ardından CD20'ye karşı CD20 (bkz. Şekil 1 ).
    2. Hedef toplama, önceden soğutulmuş iki yönlü veya dört yönlü toplama rafında toplama tüplerine akar. Akış tüplerine veya 15 mL santrifüj tüplerine en az yarım toplama aracı ile doldurun.
    3. Satıcı talimatlarını takip ederek hRS'yi ve kontrol popülasyonlarını uygun toplama tüplerine atayın. Hücre edinimi yeniden başlatın ve sıralama başlatın.
    4. Tüm HRS hücrelerini ve 1 milyondan fazla B ve T hücresini toplayın. Toplama akışlarını önceden soğutulmuş dört yönlü (veya iki yönlü) toplama rafında toplama tüplerine hedefleyin.

5. DNA Ekstraksiyonu

  1. Pellet, 1.5 mL konik tüplerde 10 dakika süreyle 3.000 xg'de santrifüjle hücreleri toplar ve hücreleri yıkamak için 1 mL PBS ile tekrar süspanse edilir.
  2. 10 dakika 3,000 xg'de bir kez daha peletleyin ve süpernatanı çıkarın; Rahatsız etmemek için çok dikkatli olKüçücük pelet
  3. Yıkanan hücrelere 150 μL liziz tamponu (veya kit için uygun bir hacim) ilave edin ve pipetleme ile yukarı ve aşağı karıştırın.
    NOT: Gerekirse, hücre lizatı, bu noktada -70 ° C'de saklanabilir.
  4. Filtre sütununu tüpün içine yerleştirerek bir kolon düzeneği oluşturun ve adım 5.5'teki lisatı sütuna ekleyin. Montajı 13.000 xg'de 3 dk olarak çevirin.
  5. Mini sütun grubundan çıkarın ve toplama borusundaki sıvıyı atın. Toplama borusundaki minik sütunu değiştirin.
  6. Her bir düzene 650 uL kolon yıkama çözeltisi ekleyin. 13.000 x g'de 1 dakika boyunca santrifüjleyin. Toplama tüpündeki sıvıyı atın. Toplam 4 yıkama için bu adımı tekrarlayın.
  7. Sıvıyı toplama borusundan atın ve minik sütun grubunu tekrar monte edin. Bağlama matrisini kurutmak için 13.000 xg'de 2 dakika boyunca santrifüjleyin.
  8. Mini kolonu yeni bir 1.5 mL tüp içine aktarın ve 25 mcL 10 mM Tris-Cl ekleyin.Sonraki sonication basamağı için veya 65 ° C'ye ısıtılmış Nuclease-Free Water için tercih edilir. Oda sıcaklığında 2 dakika inkübe edin ve 1 dakika boyunca 13.000 xg'de santrifüjleyin. Toplam 50 mcL için bir kez daha 25 mcL ile tekrarlayın.
  9. DNA elüsyonunu yukarıya ve aşağıya doğru pipetleyerek karıştırın ve florimetri kullanarak nicelendirin 14 .

6. Kütüphane Yapısı

  1. Başlamadan önce hazırlama:
    1. Sonikatörü su seviyesi 12, Yoğunluk 5, Döngüler / patlama 200 ve Sıcaklık 7'de ayarlayın.
    2. Florimetre ile belirlenen mevcut DNA miktarına ve deneysel tasarıma dayanarak, kütüphane yapımı için kullanılacak DNA miktarını belirleyin.
      NOT: Çok az DNA kullanılıyorsa ve kütüphane kalitesi tehlikeye atılırsa, doğrulama amacıyla geride bırakılan materyal için çok az uygulama olabilir. Standart olmayan giriş miktarları için, giriş kütlesi ne kadar büyük olursa, compElde edilen sıralama kitaplığının sözlüğü. Bu protokol için bazı kurallar şunlardır: 10 ng iyi sonuçlar vermelidir ve 50 ng zorlu maksimum kabul edilebilir.
    3. Bağdaştırıcıya karar verin: Molar oranı, Tablo 1'deki değerlere göre gevşekçe yerleştirin.
    4. Kullanılacak bağdaştırıcı miktarını aşağıdaki biçimde hesaplayın:
      NOT: DNA girişi mol sayısı, n
      ben. N = 1.54e-12 -12 * giriş kütlesi (inç) / (ortalama parça boyutu)
      ii. Ortalama fragman boyutu 200 bp olduğunda, bu basitleştirir:
      N = 7.7e-15 * giriş kütlesi (inç)
      Dahil edilecek adaptörün mol sayısı, a
      ben. A = n * r
      Adaptör ligasyon adımında kullanılacak adaptör stok hacmi, v
      ben. V ( μL cinsinden ) = a / [ 10-12 * adaptör stoğuKonsantrasyon (μM cinsinden )]
      NOT: Adaptör konsantrasyonu düşükse, gerekli miktarda bağdaştırıcının bulunmasını sağlamak için, son tamir reaktiflerini su yerine sulandırmak için adaptör çözeltisi kullanılabilir.
      Örnek: Arzulanan bir molar adaptör: insert oranı 15: 1 ve adaptör stok konsantrasyonu 2 μM için ortalama fragman boyutu 200 bp olan 100 ng giriş DNA'sı için önerilen adaptör hacmi 5.8 μL'dir.
    5. Örneklere dizinli barkodlar atayın.
      NOT: Bir hibridizasyon reaksiyonuna veya bir sekansörün akış hücresindeki bir şeritte bir araya toplanacak olan kütüphaneler, gereksiz indisler içermemelidir.
  2. Kütüphane yapımı - DNA makaslama:
    1. Sonikasyon tüpüne kullanılacak DNA miktarını ekleyin. Yalnızca giriş DNA'sı içeren numune hacmi 50 μL'den düşükse, Tampon EB'yi toplam hacme 50 mcL'ye kadar ekleyin ve karıştırın.
    2. Sonic için 30 s.
    3. Tüpü çıkarın ve mini tüp süpürgesinde, mikro tüpün duvarlarının üst kısmından herhangi bir sprey toplayacak kadar çabuk sıkın.
    4. 6.2.2-6.2.3 arası adımları toplam yirmi saniyelik sonication için yedi 30 saniyelik sonication seansları için tekrarlayın.
      NOT : 210 s'lik oturum sayısını daha aza bölmekle çekinmeden deneyin.
  3. Kütüphane yapımı - Tamir, A-tailing ve adaptör ligasyonu:
    NOT: Kitaplık PCR çoğaltma adımından önce herhangi bir boyut seçimi yapmaktan kaçının.
    1. Örnek DNA sonikasyonundan sonra son onarım ve A-kuyruklama için üreticinin talimatlarını izleyin 19 .
    2. A-tailing'ten sonra, reaksiyonda uygun sayıda mol adaptör (adım 6.1.3'te hesaplanmıştır) kullanın. Adaptörü, A-kuyruklu DNA fragmanlarını, enzimi birleştirin ve yaklaşık 16 saat boyunca 20 ° C'de gece boyunca inkübe edin ve inkübe edin.
  4. libRary construction - Kütüphane büyütme:
    1. Adaptör ligasyonu reaksiyonunda boncuk temizleme yapın. PCR ürününe boncuk ekledikten sonra, oda sıcaklığında 5 dakika bekleyin. Manyetik bir stand karşı yerleştirin ve sıvıları çıkarın, 200 μL% 80 etanol 200 μL yıkayın, boncukları aşırı kurutma olmadan sıvının çoğunu çıkarmak için yeterince uzun süre kurutun ve 25 mcL pipetleme ile boncuklardan DNA'yı elute edin Önerilen şekilde nükleaz içermeyen su, tüp bir manyetik standa karşı kalırken boncuklara yapıştırın.
      NOT: Boncukların polietilen glikol içinde muhafaza edilmesiyle deney yapılabilir
      (PEG), amplifikasyon sonrasına kadar atmak yerine test edildi, ancak bu test edilmemiştir.
    2. PCR master karışımının 50 μL'si başına 0,6 uL, 1: 1000 oranında Green dye ile sulandırınız. Alternatif olarak, ekipman için uygun hacimde gerçek zamanlı PCR ile uyumlu bir ara renk boya kullanın.
    3. PCR reaksiyonunu 98 ° C'de programlayın.Denatürasyon, tavlama ve 15 saniye süreyle 98 ° C'de, 30 saniye süreyle 60 ° C'de ve 30 saniye boyunca 72 ° C'de uzatma işlemi izledi. Alternatif bir yöntem kullanılıyorsa uygun programı seçin Polimeraz enzim.
      1. Makineyi, her döngü için 72 ° C'de flüoresan verileri alacak şekilde ayarlayın. Son uzantıyı 72 ° C'de 1 dakika boyunca programlayın, ardından belirsiz bir süre 4 ° C'de tutun. Ek tablodaki reaktifleri kullanarak bağdaştırıcıya bağlanmış kütüphanenin amplifikasyonu için PCR primerleri şunlardır: Oligo 1, AATGATACGGCGACCACCGAGA ve Oligo 2, CAAGCAGAAGACGGCATACGAG
    4. QPCR yazılımı ile gerçek zamanlı olarak floresans yoğunluk değerlerini gözlemleyerek, üstel büyüme evresinin bitiminden hemen önce dururken yukarıda açıklanan PCR koşullarını kullanarak kütüphaneyi genişletin.
    5. Büyütmeden sonra, 0.8x amplifikasyon reaksiyonu hacmi hacmini kullanarak standart bir boncuk temizleme yapın (bakınız adım 6.4.1)Tipik olarak 0.8 x 50 = 40 μL boncuk. Boncukları PCR ürününe ekleyin ve oda sıcaklığında 5 dakika bekleyin.
    6. Manyetik bir standın üzerine yerleştirin ve sıvıları çalkalayın, 200 μL% 80 etanol ile yıkayın, fazla kuruyan olmadan sıvının çoğunu çıkaracak kadar boncukları kurutun ve kuru boncuklara nükleaz içermeyen su ilave ederek elute edin.
    7. Oluşan DNA'yı fluorimetri kullanarak ölçün. Boyut için kitaplık parçalarını görselleştirin; Daha fazla bilgi için Veri QC beklentileri bölümüne bakın.

7. Exodim Hibridizasyon

  1. Dört kitaplıkları farklı bağdaştırıcı çubuk kodlarıyla birleştirin.
    NOT: Molariteyi hesaplamak için florimetre ile kütle ve jel ile boyut kullanılır ve daha sonra toplamda 1.000 ng'lik bir kütle havuzu için kütüphaneler eşit mololar halinde birleştirilir. Bütün tümör-normal çiftleri ayrı havuzlara ayırmak yerine bir arada tutmak en iyisidir.
  2. Exome yakalama protokolünü uygula Up class = "xref"> 15 ve yakalama temizlendikten sonra 8 PCR döngüsü yapın. Yakalama hedeflerinden başka seçenekler olabilir.

8. Çoklama Sıralı

  1. Materyaller çizelgesinde atıf yapılan sıralama platformunda tek bir şeritte dört çoklu kütüphane içeren tek bir hibridizasyon yakalama dizisi 16 .
    NOT: Alternatif yapılandırmalar, hedef kitlenin kapsama derinliğini planlamak ve optimize etmek isteyen gelişmiş kullanıcılar için mümkündür.

9. Analiz (İstenirse Alternatif Boru Hattı (ları ile değiştirilebilir)

  1. Snps ve küçük silâhlar:
    1. Ham veriyi, insan referans genomuna, UCSC hg19'a, Burrows-Wheeler Aligner (BWA) 17'yi kullanarak veya alternatif bir algoritma ile eşleyin. Okumaları, 20'nin altında bir eşleme kalitesi skoruyla filtreleyin veya işaretleyin ve Samtools 18 veya Picard'ı kullanarak PCR çoğaltır.Ref "> 19.
    2. HRS örneklerinde somatik nükleotid varyantları ve küçük indeller, Strelka 20'yi veya seçilen bir varyant çağıranı kullanan T hücre somatik kontrolleriyle karşılaştırılır. Strelka çıktısına açıklama yapmak için snpEff 21'i uygulayın. İsterseniz, Entegre Genom Görüntüleyicisi (IGV) 22 , 23 kullanarak eserler için varyant loküsleri sistematik olarak inceleyin.
  2. Numara değişikliklerini kopyala:
    1. Tümördeki kitap içi normalize edilmiş okuma sayımlarının her "ex" hedef aralığı " i " için günlük dönüşümü " ltr " oranını aşağıdaki şekilde normalinkine karşı hesaplayın:
      Denklem
      NOT: c , belirli bir yakalama aralığına eşlenen okuma sayısıdır, l toplam kütüphane boyutudur, t tümörü belirtir ve n normal gösterir.
    2. Daha fazla analiz için yetersiz kapsama alanı ( C t + C n <100 okuma) aralıklarını filtreleyin. R. Bioconductor'tan DNA kopyası v.1.0 24 kullanarak pan-interval segmentasyon uygulayın.
      NOT: Kopyalama nötr olmak için ortalama ltr'nin mutlak değerinin 0.5'in altındaki kesimleri göz önünde bulundurun . Ortalama ltr'nin işareti pozitif ise (diğer bir deyişle, normalizasyon sonrası normal numunedeki numunelerden daha fazla okumalar varsa) veya kopya sayısı kayıpları varsa, kalan bölümler kopya sayısı kazançları olarak belirtilebilir Ortalama ltr negatiftir .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Kütüphane çoğaltma ve 0.8x boncuk temizlemesinden sonra bir biyoanalizör arsa alınmalıdır. İstenilen aralıktaki parçacık boyutlarının "normal benzeri" bir dağılımını görmelidir ( Şekil 2a ). Eğrilikte görünür bir "omuz" gibi bu şekilden sapmalar, yüksek veya düşük molekül ağırlıklı bir eser bulunduğunu gösterir. Örneğin, Şekil 2b- 2d , ideal olarak dizilenmemesi gereken görünür eserler içeren kütüphanelerin örneklerini göstermektedir. Bir kütüphane önemli ölçüde tehlikeye atılırsa, DNA bulunması halinde kütüphane yapımını tekrarlamak ve / veya taze başlatmak için hücre ayırma işlemi yapmak faydalı olabilir.

Bir adaptör dimer bazen ilk 0.8x boncuk temizleme boyunca taşır. Bu gerçekleşirse, 125-130 bp civarında ortalanmış keskin bir tepe olarak görülecektir (bkz. ŞekilE 2c). Bu durumda, ilave 0.8x boncuk temizleme işlemini tekrarlamanız ve dimerin başarılı bir şekilde çıkarılmasını sağlamak için biyolojik analizciyi tekrar etmeniz önerilir.

Bu protokolde açıklanan spesifikasyonları kullanarak ve Sıralamayı, Malzeme cetvelinde listelenen sıralamada şerit başına dört numunenin seviyesinde çoğaltarak hedef boyunca 50 - 100x'lik bir kapsama derinliği sağlayın (PCR çoğaltılmış okumalarının biyoinformatik kaldırılmasından sonra) Ulaşılabilir (bakınız Şekil 3a ). Buna ek olarak, aşırı derecede genişletilmemiş ve yeterli kapsama alanı olan kütüphanelere neden olan kütüphaneler temiz kopya sayı arsalarını üretmelidir. İlk çalışma süresince, bu kütüphane yapım protokolü, üç kütle yoğunluğunda girdi kütlesi üzerinde test edildi ve değişken sonuçlar keşfedildi (Tartışma bölümüne bakın). 1 ng'den üretilen bir kitaplık kullanılarak üretilen kopya numara arsa, optimal olmayan bir miktarda giriş DNA'sı, Sahte kopya sayısı kazanımları ve kayıplarıyla sonuçlandı ( Şekil 3b , alt).

CHL vakalarının yaklaşık% 70'inde B2M ve A20 mutasyonları ve / veya delesyonları bulunur 7 . B2M mutasyonları çoğunlukla bir translasyonel başlangıç ​​yeri, bir birinci ekson durdurma bölgesi ve bir birinci ekson durdurma yeri içerir. A20 mutasyonları, kopya sayısı kayıplarının ve indels'in karışımıdır. Mutasyonlar klonal olarak görülür ve bağıl tümör içeriğini tahmin etmek için kullanılabilir. T hücreleri somatik kontroller olarak kullanılıyorsa, HRS dizilemesi, T hücresi reseptör alfa / delta (14q11-12) ve beta pozisyonlarına (7q32 - 35) karşılık gelen pozisyonlarda önemli kopya sayısı kazanımlarının yanı sıra B hücresi reseptör ağır zinciri (14q32) ve kappa hafif zincir pozisyonları (2p11) (bakınız Şekil 4 ). Genel sekanslama, vaka başına 100 ila 400 somatik mutasyon aralığını göstermektedir. Kopya sayısı varyasyonu son derece vBazı vakalar çok sayıda bölümsel kazanç ve kayıplar ve sadece birkaç değişiklik gösteren diğer vakalarla birlikte ariable durumdadır.

Şekil 1
Şekil 1: Canlı HRS, B ve T hücrelerinin Akış Sıralaması için Çok Parametre Kapısı. Popülasyon isimleri parseller üzerinde gösterilir ve herhangi bir kapının ana nüfusunu belirtir. ( A ) tüm hücreleri gösterir: FSC-H'ye karşı FSC-A histogramında, oranlı FSC-H ve FSC-A artışlarına sahip popülasyonları içeren bir SINGLETS kapısı çizin. Yüksek FSC-A ve daha düşük FSC-H'ye sahip çiftleri hariç tutun. Hodgkin hücreleri çok geniştir; Yüksek FSC-H ve FSC-A olaylarını içerecek şekilde kapıyı genişletin. ( B ) Normal olarak daha düşük FSC-A'ya ve canlı popülasyonları (VIABLE kapısı) kesmeden SSC-H'de ufak artışlara sahip enkaz, ölü hücreler ve erimiş RBC'leri hariç tutun. ( C ) Kapı MONONUCLEAR hücreleri üzerindeYüksek SSC-H ile granülositleri dışlamak için FSC-A'ya karşı SSC-H; Kapının sadece T ve B hücrelerinin tanımlanması için kullanılması gerektiğini unutmayın. ( D ) Kapı T Hücreleri, CD5 olmadan yeşil CD20 ile ifade edilen CD20 ve B hücreleri (mavi) olmadan CD5 (yeşil) ile pozitif olarak tanımlandı. ( E ) CD45 / SSH arsa üzerinde, lenfoid hücrelerin ve tüm granülositik hücrelerin% 10-20'sini içeren daha büyük bir kapı çizin. ( F ) Negatif CD64 / FITC otofluorsanslı lümenli CD30-pozitif olaylar. ( G ) CD30 pozitif olaylar arasında, kapı CD40- ve CD95-pozitif olaylar (CD30 / 40/95 HRS kapısı, kırmızı). ( HL ) HRS hücrelerinde doğrulayıcı immünfenotipik özellikleri gözlemleyin; HRS hücreleri genellikle CD20'yi ifade etmez (arsa H ve L). CD5 ifadesi, T-hücresi rozetleme (I) nedeniyle CD45 ile ilişkilidir; Çoğu vakada CD15 ekspresyonu gösterilir ve CD71 için parlak olur ( J ). CD40 ve CD95 ekspresyonu genellikle B ve T hücrelerinin seviyesinin üstündedir, resp Etkili olarak ( K ). Bu araştırma aslında Blood 7'de yayınlandı. Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.

şekil 2
Şekil 2: Adaptör Ligasyonu ve Amplifikasyondan Sonra Numunelerin Boyut Dağılım Plotları. İdeal olarak, görünür eserler içeren kütüphaneler tekrarlanmalı ve sıralanmamalıdır. ( A ) İyi oluşturulmuş kütüphane; Görünür eserler yok. ( B ) Eğride asimetri bir sorun ortaya çıkarmaktadır. (C) Önemli bağdaştırıcı dimer (128 pik) ve yüksek bir moleküler ağırlık eseri (> 400 bp). Dimer, ilave bir 0.8x boncuk temizleme ile temizlenebilir. ( D ) Anlamlı yüksek molekül ağırlıklı eser.S / ftp_upload / 54399 / 54399fig2large.jpg "target =" _ blank "> Bu rakamın daha büyük sürümünü görmek için lütfen tıklayınız.

Şekil 3
Şekil 3: 1 ng Girdi DNA'dan yapılan düşük kaliteli Kütüphanelere kıyasla 10 ng Giriş DNA'sından yapılan Daha Yüksek Kaliteli Kütüphaneler için Biyoinformatik Kalite Kontrol Ölçümleri. Kapsam beklentilerinin benzersiz okuma derinliğinin büyüklüğü ve dağılımı. (A) 10-100 ng giriş DNA'sını kullanırken, en azından 50'lik bir kapsama derinliği beklenir. ( B ) 2 panelin her biri, sıralı kütüphaneler arasındaki verileri karşılaştıran kopya sayısı değişim analizi sonuçlarını tasvir etmektedir. Tek bir temsili kromozom için (chr 6), log 2 ölçeğinde (y ekseni) kopya sayısı değişimine karşı ekzonik prob segmentleri (x ekseni) çizilmiştir. 10 ng'lik düşük girişli bir kütüphaneden alınan verilerin toplardamar yoluyla karşılaştırılmasıT-hücresi DNA'sı, aynı davadan alınan intratümöral T-hücresi DNA'sından alınan 100 ng'lik bir normal girişli kütüphaneye anlamlı yanlış-pozitif sonuçlar vermedi; Yani düşük girdi ve normal girdi kitaplıkları kopya-nötrdür (üstte). Aynı miktarda (tabanda), intratümöral T hücre DNA'sından alınan 1 ng düşük giriş kütüphanesinden alınan veriler, 100 ng normal girdi kütüphanesi ile karşılaştırıldığında, sayısız sahte pozitif bölümlü kopya sayısı değişiklikleri çağrıldı. Bu araştırma aslında Blood 7'de yayınlandı. Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.

Şekil 4
Şekil 4: Tümör Hücrelerinin (Birincil HRS ve Hücre Hatları) Birincil Cas'dan Sağlıklı İnspratumör T Hücreler Üzerine Karşılaştırmalı Nükseden Kopya Numarası Kazançları ve Zararlarıes. T hücreleri, B hücresinden türetilmiş HRS ve hücre hattı popülasyonlarına karşı somatik kontrol olarak kullanılırsa, T hücresi reseptörlerinin alfa / delta ve beta'sında tekrarlayan kazançlar görülebilir. Aynı şekilde, tekrarlayan kayıplar, immünoglobülin ağır ve kappa zincirlerinde saptanabilir. Bu araştırma aslında Blood 7'de yayınlandı. Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.

DNA girdi kütlesi (n) 1-10 ng 25 ng 100 ng
Adaptör: molar oranı ekle (r) 65: 1 25: 1 15: 1

Tablo 1: DNA InKütle ve Uygun Adaptörü Takın: Molar Oranı Ekle. Bu tablodaki değerler, kütüphane yapımının bağdaştırıcıyı ligasyon adımı sırasında eklemek üzere bağdaştırıcı oligo miktarını hesaplamak için kılavuz olarak kullanılabilir.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Bu tekniğe hakim olduktan sonra gelecekteki uygulamalar veya yönler

Bu çalışma, en az 10 ng DNA ihtiva eden örneklerden ekspres sıralama yapılmasına olanak tanır. Klinik bağlamda, bu sınır, yetersiz materyal nedeniyle en ince iğne aspirasyon numunelerini dışlar, ancak yeterli çekirdek biyopsi ve eksizyonel biyopsi örnekleri içerir. Bu, daha geniş bir olası örnek kümesinden veri edinmesini sağlayacaktır.

Protokol dahilinde kritik adımlar

Doğru donma ve ayrışma teknikleri deneyin başarısı için kritik önem taşır. Mümkün olduğunca fibrotik bölümler de dahil olmak üzere tüm numune ayrıştırılmalıdır. Hücre çeşitleri için 130 μm'lik bir memenin kullanılması, büyük HRS hücrelerinin ve DNA'nın verimini en üst düzeye çıkarmak açısından kritik görünmektedir. Birden çok meme boyutuna sahip titiz kontrollü deneyler gerçekleştirilmemesine rağmen, önemli artışlarHücrelerin verimlerinde 100 um'ye kıyasla daha büyük meme kullanılarak gözlendi ve 85-μm'luk meme sıralamasındaki kayma sonrası (yayınlanmamış gözlem) neredeyse hiç hücre tespit edilmedi.

Değişiklikler ve sorun giderme

Kütüphane inşası için 100 ng'dan az girdi DNA kütlesi ile çalışırken, gereksiz işleme ve temizleme adımlarını, özellikle de PCR amplifikasyonundan önce azaltmaya özen gösterilmelidir, çünkü kaybedilen her benzersiz molekül nihai kütüphanenin karmaşıklığını azaltmaktadır . Protokol, kasıtlı olarak, 50 μL'de özütlenen özler önerir çünkü bu değer hem sonikasyon hem de tavsiye edilen ekipmanı kullanarak son-onarım ile uyumludur. Bu şekilde, santrifüj buharlaştırıcı veya sonikasyon adımında bir kolon kullanarak elüsyon hacmini azaltmak veya son onarım basamağı için sonikasyon hacmini azaltmak gerekli değildir. Bu protokol için ek değişiklikler mümkündür; Örneğin yeni kütüphane yapım setleri adaptör ligasyon verimliliğini artırabilir. Adaptör aracılı kütüphane amplifikasyon eğrilerini, aynı miktarda ve girdi DNA'sının kalitesinde farklı kitlerle yapılan kütüphanelerde gerçek zamanlı amplifikasyon kullanarak karşılaştırarak, gidermek / optimize edebilmek.

Tekniğin sınırlamaları

En az 10 ng saflaştırılmış HRS DNA'sı (sıralama ve ekstraksiyon adımlarındaki kayıplardan sonra yaklaşık 1.000 sıralı hücre), yüksek kaliteli sonuçlar için asgari miktarda olduğu görülmektedir. Pilot deneylerde, saflaştırılmış T hücrelerinin tek bir örneğinden alınan DNA, ilk olarak bir dizi girdi kitlesi kapsayan kütüphaneler oluşturmak için kullanıldı. 100 ng (standart önerilen miktar) giriş DNA'sı, 10 ng ve 1 ng giriş DNA'sı için bu düşük girişli protokol kullanılarak üretilen kütüphanelerle karşılaştırıldı. 10 ng giriş DNA'sından üretilen kütüphane, 100 ng'lik girdi kitaplığı ile büyüklük ve dağılım açısından anlamlı bir fark göstermediHedefin tamamında kapsama alanı veya PCR duplikasyon fraksiyonu. Bununla birlikte, 1 ng giriş DNA kullanılarak üretilen kütüphane, PCR duplikat fraksiyonunun önemli bir kısmıyla sonuçlanmış ve hedef boyunca ortalama kapsama alanında karşılık gelen bir azalma (yaklaşık 3 kat) meydana gelmiştir. Dahası, 1 ng'lik kütüphane, aynı değerlendirmede fotokopi ile nötr olan 10 ng'lik girdi kitaplığının aksine, 100 ng'lık kütüphaneye göre sahte-pozitif kopya sayısı değişiklikleri yaratan kapsamda tekdüzelikten sapma sergiledi. Bu nedenle, bu yöntemi kullanarak 10 ng'dan az girdi DNA kullanarak dikkat edin.

Tekniğin mevcut / alternatif yöntemlere göre önemi

Protokolün ardından primer Hodgkin lenfoma örneklerinden HRS hücrelerinin tam eksprese edilmesine izin verilir. En az 2 x 107 hücre içeren CHL lenf nodu örnekleri bu prosedür için uygundur. Bu daha önce araştırma için mevcut değildiErs, lazerle yakalama mikrodiseksiyonu ve bütün genom amplifikasyonu gibi teknikler üzerinde çalışıyordu. Birincil CHL vakalarına genomik yaklaşımların CHL patogenezini daha iyi anlamak için değerli olmaya devam edeceği öngörülmektedir. Veriler, aynı zamanda, nodüler skleroz ile karışık hücresel CHL arasındaki morfolojik tabakalaşmayı gevşek biçimde takip eden potansiyel olarak en azından iki tanımlanmış altkümeyle, bu hastalık varlığı içerisinde önemli genom düzeyinde heterojeniteye işaret etmektedir. Son olarak, genom düzeyindeki verilerin, tedavisi zor tedaviye dirençli / refrakter CHL vakaları için hedefli tedavinin geliştirilmesine yol açacağı düşünülmektedir.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarların açıklayacak bir şeyi yok.

Acknowledgments

Bu proje yönteminin geliştirilmesi, Weill Cornell Tıp Fakültesi, Patoloji ve Laboratuvar Tıp Anabilim Dalı tarafından finanse edildi. Kısmi finansman için Hesaplamalı Biyoloji ve Tıp Alanında Üçlü Kurumsal Eğitim Programını kabul ediyoruz. Zaman ve bilgilerini bizimle paylaşan bilim adamlarına, özellikle Maryke Appel'e teşekkür ediyoruz; Dan Burgess; Iwanka Kozarewa; Chad Locklear; Jenny Zhang, Xiaobo (Shawn) Liang, Dong Xu, Wei Zhang, Huimin Shang, Tatiana Batson ve Tuo Zhang gibi Weill Cornell Tıp Fakültesi Genomik Çekirdek Tesisi'nden herkes.

Materials

Name Company Catalog Number Comments
Petri or Cell Culture Dish (sterile)
RPMI-1640 Media Roswell Park Memorial Institute
Fetal Calf Serum (FCS), (heat inactivated)
Freezing Media (RPMI, 20% FCS, 10% dimethylsulfoxide (DMSO))-make fresh and keep sterile
RPMI with 2% FCS (make fresh or store for up to 1 month)
scalpel with fresh blade
10 mL syringe (no needle)
Cryogenic vials
50 mL conical centrifuge tubes, force
Centrifuge capable of handling 50 mL conical centrifuge tubes and providing 400g
Hepes buffer(1 M, cell culture grade)
phosphate buffered saline (PBS)
Pluoronic-F68 Thermo-Fisher 24040-032
DNAase-I Sigma-Aldrich, St. Louis, MO D4527-10KU store as 5 mg/mL in RPMI in -200 °C
Bovine Serum Albumin (BSA)
Sort Media (PBS + 2% BSA + 25 mM HEPES + Pluoronic –F68 (1x))
CD64-FITC (22) Beckman Coulter, Miami, FL 20 μL suggested starting volume; Titering is suggested
CD30-PE (BerH83) BD Biosciences, San Jose, CA 20 μL suggested starting volume; Titering is suggested
CD5-ECD (BL1a) Beckman Coulter, Miami, FL 10 μL suggested starting volume; Titering is suggested
CD40-PerCP-eFluor 710 (1C10) Ebiosciences, San Diego, CA 5 μL suggested starting volume; Titering is suggested
CD20-PC7 (B9E9) Beckman Coulter, Miami, FL 10 μL suggested starting volume; Titering is suggested
CD15-APC (HI98) BD Biosciences, San Jose, CA 20 μL suggested starting volume; Titering is suggested
CD45 APC-H7 (2D1) BD Biosciences, San Jose, CA Can be substituted with 10 μL suggested volume of CD45-Krome Orange (J.33, Beckman Coulter); Titering is suggested
CD95-Pacific Blue (DX2) Life Technologies, Grand Island, NY 5 μL suggested starting volume; Titering is suggested
CD2 (5 μg; clone RPA-2.10) Biolegend, San Diego, CA For optional protocol; Titering is suggested
CD54 (10 μg; clone 84H10) Serotec, Oxford, United Kingdom For optional protocol; Titering is suggested
CD58 (10 μg; clone TS2/9) eBioscience, San Diego, CA For optional protocol; Titering is suggested
LFA-1 (12 μg; clone MHM23) Novus Biologicals, Littleton, CO For optional protocol; Titering is suggested
BD CS&T Beads BD Biosciences, San Jose, CA
BD Accudrop Beads BD Biosciences, San Jose, CA
BC Versa Comp antibody capture beads Beckman Coulter, Miami, FL Compensation Beads
BD-FACS ARIA special research order instrument using 5 lasers BD Biosciences, San Jose, CA any BD-FACS aria with capabilities to detect the fluorochromes in the antibody panel should be sufficient
Wizard Promega A2360
10 mM Tris-Cl buffer NA
Qubit dsDNA HS Assay kit Life Technologies, Carlsbad, CA
S2 Sonicator Covaris, Woburn, MA Alternatives may be substituted
microTUBE Covaris, Woburn, MA
Low-Throughput Library Preparation Kit Kapa Biosystems, Wilmington, MA KK8221
Sybr Green Sigma-Aldrich, St. Louis, MO S9430
Agencourt AMPure XP Beads Beckman Coulter, Miami, FL
Bioanalyzer Agilent Technologies, Santa Clara, CA
SeqCap EZ Exome v.3.0 Roche Nimblegen 6465684001
HiSeq Illumina
TruSeq-style Universal adapter Integrated DNA Technologies (IDT), Coralville, Iowa HPLC purification; AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGAT*C*T
TruSeq-style index adapter Integrated DNA Technologies (IDT), Coralville, Iowa HPLC purification; /5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG
TruSeq-style PCR primer 1 Integrated DNA Technologies (IDT), Coralville, Iowa AATGATACGGCGACCACCGAGA
TruSeq-style PCR primer 2 Integrated DNA Technologies (IDT), Coralville, Iowa CAAGCAGAAGACGGCATACGAG
Nuclease Free Duplex Buffer Integrated DNA Technologies (IDT), Coralville, Iowa
BD FACSDIVA software BD Biosciences, San Jose, CA
BD Falcon Tubes BD Biosciences, San Jose, CA
BD Flow Tubes BD Biosciences, San Jose, CA

DOWNLOAD MATERIALS LIST

References

  1. Abrams, J. National Cancer Institute's Precision Medicine Initiatives for the new National Clinical Trials Network. American Society of Clinical Oncology educational book / ASCO. American Society of Clinical Oncology. Meeting. 71-76 (2014).
  2. Gagan, J., Van Allen, E. M. Next-generation sequencing to guide cancer therapy. Genome medicine. 7, 80 (2015).
  3. Matsuki, E., Younes, A. Lymphomagenesis in Hodgkin lymphoma. Seminars in cancer biology. 34, 14-21 (2015).
  4. Fromm, J. R., Kussick, S. J., Wood, B. L. Identification and purification of classical Hodgkin cells from lymph nodes by flow cytometry and flow cytometric cell sorting. Am J Clin Pathol. 126, (5), 764-780 (2006).
  5. Fromm, J. R., Thomas, A., Wood, B. L. Flow cytometry can diagnose classical hodgkin lymphoma in lymph nodes with high sensitivity and specificity. Am J Clin Pathol. 131, (3), 322-332 (2009).
  6. Roshal, M., Wood, B. L., Fromm, J. R. Flow cytometric detection of the classical hodgkin lymphoma: clinical and research applications. Advances in hematology. 2011, 387034 (2011).
  7. Reichel, J., et al. Flow sorting and exome sequencing reveal the oncogenome of primary Hodgkin and Reed-Sternberg cells. Blood. 125, (7), 1061-1072 (2015).
  8. Kozarewa, I. A Modified Method for Whole Exome Resequencing from Minimal Amounts of Starting DNA. PLoS ONE. 7, (3), e32617 (2012).
  9. Brunicardi, F. C. Schwartz's Principles of Surgery. 10th ed, McGraw-Hill Education / Medical. (2014).
  10. Kantor, A. B., Roederer, M. FACS analysis of leukocytes. Handbook of Experimental Immunology. 2, Blackwell Scientific. (1996).
  11. Sanders, M. E. Molecular pathways of adhesion in spontaneous rosetting of T-lymphocytes to the Hodgkin's cell line L428. Cancer Res. 48, (1), 37-40 (1988).
  12. Biosciences. FACSDiva Software v6.0. Available from: http://www.bdbiosciences.com/in/instruments/software/facsdiva/resources/overview.jsp (2007).
  13. Biosciences. FACSAria II User's Guide. Part No. 644832, Revision A. (2009).
  14. Life Technologies. Qubit 3.0 Fluorometer, Catalog Number Q33216. Available from: https://www.thermofisher.com/order/catalog/product/Q33216 (2017).
  15. Roche Nimblegen. SeqCap EZ Library SR User's Guide ver. 4.1. (2013).
  16. Illumina. HiSeq High-Throughput Sequencing System. Available from: http://www.illumina.com/systems/hiseq_2500_1500.html (2016).
  17. Li, H., Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics. 25, (14), 1754-1760 (2009).
  18. Li, H. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 25, (16), 2078-2079 (2009).
  19. The Broad Institute. Picard Tools. Available from: http://broadinstitute.github.io/picard/ (2016).
  20. Saunders, C. T. Strelka: accurate somatic small-variant calling from sequenced tumor-normal sample pairs. Bioinformatics. 28, (14), 1811-1817 (2012).
  21. Cingolani, P., et al. A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3. Fly (Austin). 6, (2), 80-92 (2012).
  22. Dobin, A. STAR: ultrafast universal RNA-seq aligner. Bioinformatics. 29, (1), 15-21 (2013).
  23. Thorvaldsdottir, H., Robinson, J. T., Mesirov, J. P. Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration. Briefings in bioinformatics. 14, (2), 178-192 (2013).
  24. DNA copy number data analysis. v.R package version 1.34.0. Available from: https://omictools.com/dnacopy-tool (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics