Empirisk, Metagenomic og beregningsorientert teknikker belyse mekanismer av hvilke soppmidler kompromiss Bee helse

Environment

Your institution must subscribe to JoVE's Environment section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Mikrobiell konsortier innen bumble bee elveblest berike og bevare pollen for bee larver. Med neste generasjons sekvensering, laboratorium og feltbaserte eksperimenter, beskriver dette manuskriptet protokoller brukes til å teste hypotesen at soppdreper rester endre pollen microbiome, og kolonien demografi, slutt fører til koloni tap.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Steffan, S. A., Dharampal, P. S., Diaz-Garcia, L., Currie, C. R., Zalapa, J., Hittinger, C. T. Empirical, Metagenomic, and Computational Techniques Illuminate the Mechanisms by which Fungicides Compromise Bee Health. J. Vis. Exp. (128), e54631, doi:10.3791/54631 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Bøndene bruker ofte soppdreper spray under blomst for å beskytte avlinger mot sykdom, som eksponerer bier til soppdreper rester. Selv om betraktet som "bee-sikker", er det montering bevis at soppdreper rester i pollen er forbundet med bee synker (for både honning og bumble bee arter). Mens de fortsatt relativt ukjent, spekulert forskere at bee-mikrobe symbioses er involvert. Mikrober spille en sentral rolle i bevaring og/eller behandling av pollen, som fungerer som næring for larver bier. Ved å endre mikrobiell samfunnet, er det sannsynlig at soppmidler forstyrre mikrobe-mediert tjenester, og dermed kompromittere bee helse. Dette manuskriptet beskriver protokollene som brukes å undersøke den indirekte mechanism(s) som soppmidler kan forårsake kolonien nedgang. Buret eksperimenter utsette bier til soppdreper-behandlet blomster har allerede gitt det første beviset at soppmidler forårsake dyp kolonien tap i en innfødt humlen (liten impatiens). Bruker feltet relevante doser av soppmidler, en serie eksperimenter er utviklet for å gi en bedre beskrivelse av mikrobielle samfunn dynamikken i soppdreper-eksponerte pollen. Endringer i strukturelle sammensetningen av sopp og bakteriell samlinger i pollen microbiome blir etterforsket av neste generasjons sekvensering og metagenomic analyse. Eksperimenter utviklet her er utformet for å gi en mekanistisk forståelse av hvordan soppmidler påvirker microbiome pollen-bestemmelser. Til slutt, disse funnene bør kaste lys over indirekte veien som soppmidler kan forårsake kolonien avtar.

Introduction

Klart og vill bee arter opplever utbredt nedgang, med store konsekvenser for både naturlig og landbruket1. Til tross for felles innsats for å forstå årsakene til problemet, er faktorene som driver honey bee nedgangen fortsatt ikke godt forstått2,3,4. For enkelte arter av vill, innfødt bier, har situasjonen blitt dire5,6. Hvis bee befolkninger ikke kan opprettholdes når de snitter industrielle landbruket sine befolkninger vil fortsette å falle og avlinger som krever pollinators (35% av verdensomspennende produksjon7) vil tåle redusert avlinger.

Mens mange potensielle faktorer som plantevernmidler eksponering, har sykdom og habitat tap1,4,8,9,10 vært innblandet i honey bee nedgang, relativt er lite kjent om interaktive effekten av disse stressorer på innfødt bier helse, i eller i nærheten av jordbruks-systemer. Mange nåværende forskningsinnsats fortsette å fokusere på insektmidler, (f.eks, neonicotinoids11,12), selv om tidligere forskning indikerer at soppmidler kan også spille en rolle i bee nedgang ved å svekke minne formasjon, olfactory resepsjonen13, reir anerkjennelse14, enzym aktivitet og metabolske funksjoner15,16,17. Globalt, fortsatt soppmidler brukes til blomstrende avlinger under blomst. Nyere studier har dokumentert at bier vanligvis bringe soppdreper rester tilbake til strukturen18, faktisk, studier har vist en stor andel av testet elveblest inneholdt soppdreper rester19,20. Videre arbeid har avslørt at soppdreper rester er knyttet til høy forekomst av honey bee larver dødelighet21,22,23 og tilstedeværelsen av "innkapslede pollen" i kolonier, som selv om ikke-giftig, er blottet for mikrobiell aktivitet og ernæringsmessig kompromittert24. Til tross for at soppmidler har lenge vært ansett "bee-sikker", det er nå bevis for at eksponering for soppdreper alene kan forårsake alvorlige kolonien tap i innfødt bumble bee Art, Bombus impatiens25.

For å etablere årsakssammenheng mellom soppdreper eksponering og kolonien dødelighet, den modus operandi av disse kjemikaliene skal bestemmes. Som dokumentert i jord26, sedimenter27og akvatiske miljøer28, av målretting sopp, soppmidler mest sannsynlig endre fungal overflod og mangfold i pollen-bestemmelser, og dermed starter et større fellesskap Skift som kan sterkt favorisere bakterier. Uten fungal konkurrenter eller antagonister, kan visse patogene bakterier spre relativt ukontrollert, tilrettelegge kvalitetsforringende pollen-bestemmelser. Tidligere forskning har vist at mikroorganismer, spesielt gjær og trådformede sopp, tjene som ernæringsmessige symbionter for bier29,30,31, beskytte mot parasitter og patogener32 ,33, og gi langtidsoppbevaring av pollen butikker. Fungicides, derfor kan indirekte skade umodne bier ved å forstyrre det mikrobielle samfunnet som er nødvendig for å yte tjenester og/eller økt mottakelighet for opportunistiske patogener og parasitter12. Med økende krav til matproduksjon, er avlinger verden er sprøytet hvert år med soppmidler under bloom, understreker behovet for å forstå omfanget av slike soppdreper-indusert effekter.

Til dags dato, primære kunnskapshull knyttet til innfødte bee mikrobiell økologi kan representeres av følgende spørsmål: i hvilken grad soppdreper endrer det mikrobielle samfunnet i bee pollen-bestemmelser? Hva er nedstrøms konsekvensene av å konsumere pollen med et dypt endret mikrobielle samfunn? I tråd med spørsmålene økologisk germane, eksperimenter ble utviklet med de primære mål å avsløre 1) at soppdreper rester alene kan forårsake alvorlige kolonien nedgang i en innfødt bee Art; 2) graden som mikrobielle samfunn i pollen-bestemmelser er endret av soppmidler og 3) hvordan bee helse påvirkes av et sterkt endret mikrobielle samfunn. Eksperimentell målene ble definert for å løse de ovennevnte spørsmålene en kombinasjon av laboratorie - og feltbaserte eksperimenter. Ved hjelp av state-of-the-art metagenomic og molekylære teknikker sammen med tradisjonelle metoder for feltet observasjon, skal denne forskningen sette sammen de potensielle effektene av soppmidler på bee helse.

Det første målet av denne studien er å vise at soppdreper eksponering alene kan forårsake betydelig kolonien tap blant innfødt bee arter. En studie som involverer store feltet burene ble brukt til å undersøke virkningene av soppdreper eksponering på kolonien veksten av liten impatiens, en allestedsnærværende, rikelig innfødt bie i USA (figur 1, figur 2, Figur 3). Var hypotesen at soppdreper-behandlet elveblest ville presentere lavere fitness og atypisk demografi sammenlignet med ikke-utsatt elveblest. Data fra dette eksperimentet støtter denne hypotesen, demonstrere at soppdreper rester i pollen kan være den eneste årsaken til dyp kolonien tap i en innfødt bumble bee arter25. Det andre målet av denne studien er å undersøke respons på pollen microbiome soppdreper eksponering. Det er en teori om at samfunnet sammensetningen av mikrober innen pollen klargjør utsatt for soppmidler vil være forskjellig fra ubehandlet pollen. Mens fungal overflod og mangfold ventes å avta betydelig, vokse bakterier og/eller en enkelt dominerende fungal arten sannsynligvis ukontrollert i fravær av andre konkurrerende sopp. Gjennom en rekke i vivo prøvelser, vil disse skift i mikrobielle samfunn komposisjon analyseres ved hjelp av metagenomics.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. undersøke effekten av soppdreper eksponering på Bumble Bee kolonien suksess ved hjelp av feltet bur eksperimenter

  1. Sett opp ti mesh bur i et beplantet med havre. Grave en grøft rundt hver bur, og grave alle fire kanter på mesh buret i bakken for å sikre at biene ikke kan unnslippe. Lager av merdene med, blomstrende potteplanter som er kjent for å være attraktive for bier (f.eks bokhvete, borage, alyssum, Kosmos og solsikker) ( figur 2).
  2. Supplement merdene med et enkelt brett (36 cm x 42 cm) av-bloom kløver. Floral klyngeressurser i ett hjørne av byrået, opptar en plass ca 2,5 m x 1 m. Vegetate gjenværende bur området av havre.
  3. Tilfeldig tilordne humlen kolonier, hver med arbeidere og en enkelt dronning behandling (soppdreper stede/fraværende, N = 5 kolonier per behandling, 10 kolonier totalt), plasser dem innenfor feltet bur (N = 1/bur) for 29 dager (23 juni -21 juli 2014).
  4. Orientere boksene kolonien slik at kolonien ' s åpninger peker i sør til gi bier optimale navigasjons forhold. Subsidiere koloniene med sukker vann blæren, plassert inne i boksene strukturen å supplere nektar tilgjengelighet.
  5. Bruk chlorothalonil-baserte soppdreper på feltet relevante nivå (20 g/L) til blomstrende planter i fem soppdreper behandling merdene, med en hånd holdt plantevernmidler sprøyta, to ganger i løpet av studiet (dag 0 og 13). Pels blomster jevnt slik at ingen ytterligere væske overholder floral overflater ( Figur 3).
  6. Ved avslutningen av feltet bur studien, fjerne B. impatiens koloniene fra merdene for hånd, kule elveblest ved å plassere i 20 ° C fryser i 20 min.
  7. Fjerne bier bruker sterilt tang og registrere antall larver, pupae, voksne kvinner (jeg. e. sankere), og voksne hanner. Bruke en analytical balanse spille tørr-vekten av mor dronning, larver, pupae, voksne kvinner (i.e. sankere) og voksne hanner.

2. Undersøke effektene av soppdreper eksponering på mikrobielle samfunn i Pollen-bestemmelsene Bumble Bee reir bruker Laboratory basert I Vivo forsøk

  1. Pulverize kommersielt kjøpt pollen til et fint pulver bruker et standard laboratoriet ball-mill. Sterilisere pulverisert pollen av soaking i 70% etanol, slik at det å fordampe natten under UV-lys. Kontrollere sterilitet av pollen ved plating ~0.5 mg på generell agar medier.
    1. Tørre sterilisert pollen, bruke steriliserte Pipetter, legger til feltet relevante dosering av soppdreper: propiconazole 14,3%; azoxystrobin på 22,9% for behandlinger (0.74 µL og 0,65 µL henholdsvis / dag / struktur). Bland godt med sterilisert tre pinner.
  2. Sted 6 eksperimentelle elveblest (n = 3 for kontroll og behandling) i en ren og hygienisk laboratorium Borstemmaskin vedlikeholdes ved romtemperatur. Hver dag veie 4.27 g pollen 34 , 35 blandet med soppmidler (for behandlinger) eller sterilt vann (for kontrollen) inne en hette ved hjelp av standard steril teknikk.
    1. Bruker felle dører gitt ved siden av pappeske omsluttende elveblest, introdusere pollen innenfor elveblest. Supplere elveblest med sterilisert sukkeroppløsning hver uke. Fortsette mate regimet i fire uker.
  3. Ved avslutningen av lab-basert studien, kjøle elveblest ved å plassere i 20 ° C fryseren i 20 min. skrape ut pollen-bestemmelsene i Foreldreomsorg og yngelens chambers bruke steriliserte tang og spatler og plass i sterilt lagring rør. Butikken på-80 ° C. antall og post vekten av arbeidere og dronningmoren på starten og slutten av eksperimentet (trinn 1.7).
  4. Isolere DNA fra pollen klargjøring utvalget med kommersielt tilgjengelig DNA isolasjon kits (se materialer tabell for detaljer).
    1. Legge til 0,25 g pollen klargjøring til ekstraksjon rør kort vortex å blande.
    2. Gjør en 200 mg/mL lysozyme løsning i deionisert destillert vann, nok for 50 µL/prøve. Rist kraftig helt skjema løsning.
    3. Legg 50 µL av lysozyme løsningen til utvinning rør med prøve i det, og bland godt snu flere ganger. Inkuber røret i 10 min på 37 ° C i et vannbad. Hvis bunnfall har dannet, varme løsning til 60 ° C til oppløst før bruk.
    4. Legge til 70 µL av vandig lysis løsning utvinning rør, sikre horisontalt på en planskanner vortex pute med tape, og vortex for 10 min. sentrifuge rør på 10.000 x g for 30 s ved romtemperatur.
    5. Overføre nedbryting til en ren 2 mL samling rør. Legge til 250 µL av protein nedbør løsning og vortex for 5 s. Incubate ved 4 ° C i 5 minutter i en isbadet.
      Merk: Forvent mellom 400 µL til 500 µL av nedbryting. Nedbryting inneholder kanskje fortsatt noen partikler.
    6. Sentrifuge rør ved romtemperatur for 1 min 10 000 x g, og Overfør til 600 µL av nedbryting til en ren 2 mL samling rør. Legge til 200 µL av vandig hemmer fjerning løsning, vortex kort, og ruge ved 4 ° C i 5 min. sentrifuge rør ved romtemperatur for 1 min på 10 000 x g. overføre opptil 750 µL av nedbryting til en ren 2 mL samling rør.
    7. Legge til 1200 µL av vandig bind løsning til nedbryting og vortex 5 s. laste ca 675 µL av nedbryting på et spinn filter og sentrifuge 10.000 x g for 1 min ved romtemperatur. Forkaste flyten gjennom.
    8. Gjenta 2.4.7. to ganger.
      Merk: Totalt tre belastning for hver prøve behandlet kreves.
    9. Legge til 500 µL etanol og sentrifuger ved romtemperatur for 30 s på 10.000 x g. forkaste flyten gjennom, og sentrifuge igjen ved romtemperatur for 1 min på 10.000 x g. sted spinn filteret i en ren 2 mL samling rør.
    10. Legge til 100 µL av elueringsrør buffer til midten av filteret membranen. Sentrifuger ved romtemperatur for 30 s på 10.000 x g. forkaste spinn filteret. Store samlet DNA mellom 20 ° C og-80 ° C
  5. Bruk isolert DNA for sekvensering.
    1. Kvantifisere, og normalisere isolert DNA til 2 ng/µL av fluorometric analyse.
      1. Forberede reaksjoner i tre eksemplarer for hver utdraget prøve å sammenligne den relative mengden 28S (planter), analysere sin (sopp), og 16S (bakteriell) komponenter i hver pollen klargjøring eksempel 36. Kontroller at hver reaksjon inneholder 10 ng totale DNA, 2 x asymmetrisk cyanine fargestoff basert master mix og 2,5 µL hver forover og bakover grunning par 28KJ/28B 37 for anlegget og ITS1/ITS5.8R for sopp DNA 38 .
    2. Forsterke DNA ved hjelp av følgende parametere: 2 min pre rødsprit ved 50 ° C, 2 min første rødsprit ved 95 ° C, 40 sykluser (15 s på 98 ° C, 15 s på 58 ° C, 60 s ved 72 ° C), etterfulgt av en smelte kurve.
    3. Forberede en 2-trinns, nestede PCR protokoll med neste generasjons sekvensering biblioteker målretting 16S rRNA V3/V4 variable regionen og dens / 5.8s rRNA spacer regionen.
      1. Legge 12,5 µL av DNA til 5 pmol av hver primer og 2 x master mix. Lage egne reaksjoner for hver region (16S eller ITS, se tabell 1). Endre regionen bestemte primere som beskrevet tidligere 39 , 40 legge sequencer-spesifikke adapter overheng nukleotid sekvenser til gen-spesifikke sekvensene.
      2. Utføre innledende forsterkning med følgende parametere: 3 min første rødsprit 95 ° c, 25 sykluser (30 s på 95 ° C, 30 s ved 55 ° C, 30 s ved 72 ° C), 5 min endelig utvidelse ved 72 ° C.
      3. Følgende innledende forsterkning, kontrollere biblioteket størrelse og antall av electrophoretic mobilitet og rengjøre med en 1 x volum solid fase reversibel immobilization perler fjerne gjenværende primere og reaksjon reagenser. Basseng 16S og dens amplicons kvantitativt å lage et enkelt amplicon basseng for hvert utvalg.
      4. Legg sequencer bestemte adaptere og prøve bestemte doble indekser ved hjelp av følgende primerne (se tabell 1). Legge til 2,5 µL av forsterket DNA 5 pmol av hver primer og 2 x master mix. Utføre biblioteket forsterkning med følgende parametere: 3 min første rødsprit 95 ° c, 8 sykluser (30 s på 95 ° C, 30 s ved 55 ° C, 30 s ved 72 ° C), 5 min endelig utvidelse ved 72 ° C.
    4. Følgende PCR, rydde ferdig biblioteker med et 1 x volum av solid fase reversibel immobilisering perler. Vurdere kvaliteten og kvantiteten av ferdig biblioteker med electrophoretic mobilitet og fluorometry, henholdsvis. Standardisere biblioteker 2 µM og bassenget før sekvensering.
    5. Utfører neste generasjons sekvensering på en plattform som er analogt med kortene som er lagt til i den sekundære PCR, med en passende lengde til å dekke hele amplicon 41.
  6. Sekvens merknader og mikrobiell komposisjon analyse.
    1. Kombinerer par-end sekvensering data (R1 og R2) til enkelt contigs for alle sekvensert biblioteker. Etter fletting både R1 og R2, produseres en enkelt fasta fil for hver av bibliotekene.
      Merk: Dette trinnet og prosessene som er beskrevet nedenfor (med mindre annet er angitt) utføres i Mothur versjon 1.38.0 38.
    2. Skjermen hver fasta fil for å fjerne tvetydig baser, uventet lang sekvenser og lang homopolymer.
      NOTE Parametrene for screening og sekvens fjerning er maxambig = 0, maxlength = 600 og maxhomop = 8 for både gener. Fjerne identiske sekvenser, men holde en contingence tabell separat for alle biblioteker (aka antall tabell i Mothur).
    3. Juster unike sekvenser av genet 16S biblioteket mot SILVA databaseversjonen 123 og gene ITS biblioteket mot FORENE dens databasen 42.
      Merk: Sekvenser må være merket fra Storbritannia nivå til slekten nivå.
      1. Deretter klynge justert sekvenser med funksjonen pre.cluster bruker diff = 5, og fjerne chimeras.
    4. Klassifisere sekvenser med metoden Wang 43 basert på SILVA (for genet 16S) og FORENE dens (for gen ITS) taksonomi filer (cutoff verdi av 80%).
    5. Laste inn R 44 contingence tabellene (én per genet) generert under klassifisering prosessen i Mothur. På hvert taksonomisk nivå, få relative overflod per bibliotek for videre analyse av mikrobielle samfunn endringer.
      Merk: På hvert taksonomisk nivå, flette sammen taksonomisk grupper når relative overflod er mindre enn 2% for alle eksperimentelle gjentakelser.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Feltet bur studien:

Data fra buret eksperimenter viste at bumble bee kolonier hadde en betydelig respons til soppdreper eksponering. Den soppdreper-behandlet elveblest produsert betydelig færre arbeidere (12.2 ± 3.8, gjennomsnittlig ± SE) enn kontroll strukturer (43,2 ± 11.2, F1,9= 6.8, p = 0,03) (Figur 4). I tillegg var bee biomasse soppdreper-behandlet hives (0.91 g ± 0,15) betydelig lavere enn kontroll strukturer (2,36 g ± 0,55; F 1,9 = 8.3, p = 0,02). Dette mønsteret av senket biomasse i soppdreper-behandlet elveblest ble også observert blant mor dronninger. Dronninger soppdreper-behandlet hives presentert med en betydelig lavere biomasse (0,14 g ± 0,04) enn dronningene av kontroll strukturer (0,27 g ± 0.01; Z = 2.5, p = 0,01). Imidlertid påvirke soppdreper eksponering ikke antall larver og pupae menn over behandlingene. Biomasse av diskrete livsstadier (larver, pupae, arbeidere og voksne hanner) og personlige vekter for larver, pupae og arbeidere viser ikke noen forskjell over soppdreper behandlet og kontroll hives.

Lab-basert studie:

Data fra laboratorie-baserte eksperimenter indikerte at før soppdreper eksponering, kontroll og soppdreper-behandlet elveblest hadde statistisk sammenlignbare mener arbeidstaker teller (kontrollere elveblest = 28.0 ± 3.1; soppdreper-behandlet elveblest = 31.67 ± 2.0, n = 3 hver) og dronning vekt (kontrollere elveblest = 0.77 g ± 0,04; soppdreper-behandlet elveblest = 0.74 g ± 0,01). Men på slutten av studien, arbeidstaker teller var betydelig høyere i kontroll strukturer (67.67 ± 4.3), sammenlignet med soppdreper-behandlet elveblest (45.33 ± 3.8) (t4 = 3.89, p = 0,01). Arbeidstaker befolkning økte med ~ 150% i kontroll elveblest sammenlignet ~ 45% i soppdreper-behandlet elveblest. Tilsvarende endelige vekten av dronningmoren holdt seg relativt uendret i kontroll strukturer (0,76 g ± 0,02) sammenlignet med en ~ 35% nedgang i soppdreper-behandlet elveblest (0.49 g ± 0,16). Sammen disse resultatene er i tråd med tidligere publiserte resultatene25 og angir soppdreper påvirket kolonien fitness som gjenspeiles av færre arbeider tall og redusert dronningmoren vekter (figur 5).

Metagenomic analyse av pollen-bestemmelsene angitt tydelige forskjeller mellom de mikrobielle samfunnene fra soppdreper behandlet og kontrollere elveblest (figur 6). Det var en nedgang (> 95%) i relative overflod av vanligvis isolerte Streptomycetales, Enterobacteriales i den soppdreper-behandlet elveblest. Interessant, er begge disse gruppene kjent for sine soppdrepende aktivitet og rolle i pollen-bevaring30,45 innen humle strukturen miljøer. Bakteriell medlemmer av Rickettsiales, som inkluderer vanlige patogener i leddyr46, viste mye større overflod i soppdreper behandlet elveblest. Soppdreper-behandlet elveblest hadde en lavere overflod av sopp tilhører ordre Eurotiales og Sordariales, og en høyere overflod av Capnodiales og Ascosphaerales forhold til kontroll strukturer (figur 7). Som forventet, både bakterier og sopp, Shannon mangfoldet indeksen (H) og jevnhet (E) var lavere i soppdreper-behandlet elveblest sammenlignet med kontroller, selv om disse forskjellene ikke var statistisk signifikant (bakterier: H kontrollere elveblest =1,25 ± 0.3, Hsoppdreper-behandlet elveblest = 0,82 ± 0,2, Ekontroll elveblest = 0,46 ± 0.1; Esoppdreper-behandlet elveblest = 0.31 ± 0.1; sopp: Hkontroll elveblest =0,99 ± 0.3, Hsoppdreper-behandlet elveblest = 0,72 ± 0,4, Ekontroll elveblest = 0.57 ± 0,2; Esoppdreper-behandlet elveblest = 0.42 ± 0,2). Selv om detaljering metabolske og funksjonelle implikasjonene av slike samfunnet skifter var utenfor omfanget av denne studien, kombinert med kolonien teller og vekt data, disse resultatene tyder på at soppdreper eksponering kan påvirke nedgang i kolonien helsefare ved forstyrre symbiose mellom bier og pollen microbiome. Videre undersøkelser i rollen av bestemte mikrobiell grupper påvirker larver survivorship bør vurdere rollen til pollen microbiome i opprettholde sunne bee populasjoner.

Figure 1
Figur 1: inne en liten impatiens reir. Høyoppløselig bilde av arbeiderne tending å Foreldreomsorg og yngelens celler. Foreldreomsorg og yngelens celler kan inneholde flere egg og larver til enhver tid. Utvikle larver lever på pollen-bestemmelsene med jevne mellomrom introdusert inn i kammeret. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: stort felt burene reist til huset bee kolonier. Hver mesh bur (N = 10) var fylt med en kommersielt kjøpt Bombus impatiens strukturen, samt i bloom plantearter kjent å tiltrekke bier. Blomster var lager i et hjørne i buret og gjenværende området var vegetasjon med havre gress. Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: soppdreper rester på en nylig sprayet solsikke. Feltet relevante doser av soppdreper ble sprayet på dag 0 og 13 av eksperimentet. Bruker en plantevernmidler sprøyta, ble blomstene jevnt belagt med en soppdreper løsning på skumring/kveld for å unngå direkte kontakt med foraging bier. Klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4: virkninger av soppdreper rester på bumble bees i buret eksperimentet. Bumble bee kolonier som var utsatt for soppdreper rester på pollen vist betydelige reduksjoner i kolonien størrelse (reductioner i voksne kvinnelige overflod) i løpet av én måned. Feilfelt representerer ± 1SE; p < 0,05. Dette tallet ble endret fra Bernauer et al. 25. Klikk her for å se en større versjon av dette tallet.

Figure 5
Figur 5: virkninger av soppdreper rester på bumble bees i et laboratorie-baserte eksperiment. Bumble bee kolonier som var utsatt for soppdreper-behandlet pollen vist betydelige reduksjoner i kolonien størrelse (reduksjoner i voksen arbeidstaker overflod) og nedgang i dronningmoren vekt i løpet av én måned. Feilfelt representerer ± 1SE; p = 0,03. Klikk her for å se en større versjon av dette tallet.

Figure 6
Figur 6: sektordiagram av metagenomic klassifisering av sopp og bakteriell mangfold på rekkefølgen rang. Analyser basert på (en) 16S og (b) ITS basert klassifisering av pollen klargjøring prøver innhentet fra kontroll og soppdreper-behandlet elveblest. Kontroll elveblest viste høyere mangfold og jevnhet i mikrobiell distribusjon. Klikk her for å se en større versjon av dette tallet.

Figure 7
Figur 7: endring i rekkefølgen rang relative overflod av bakterier og sopp svar soppdreper eksponering. Metagenomic klassifisering av mikrobielle samfunn bruker (en) 16S og (b) ITS basert primere Klikk her for å se en større versjon av dette tallet.

Primer par Primer type Primer sekvens
28KJ/28B Anlegget GGC GGT AAA TTC CGT CC /
CGT CCG TGT TTC AAG ACG
ITS1 / ITS5.8 Sopp TCC GTA GGT GAA CCT GCG G /
KNEBLE ATC CGT TGT TGA AAG TT
16S forover / bakover Nestede bakteriell 5-ACACTCTTTCCCTACACGACGCTCTTCCGATCTCCTACGGGNGGCWGCAG-3 "/
5-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGACTACHVGGGTATCTAATCC-3 "
ITS1F primer / ITS4 Nestet sopp 5-ACACTCTTTCCCTACACGACGCTCTTCCGATCTTTCGTAGGTGAACCTGCGG - 3
5-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCCTCCGCTTATTGATATGC - 3
Kortet primere 5-AATGATACGGCGACCACCGAGATCTACAC [55555555]
ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3 "
5-CAAGCAGAAGACGGCATACGAGAT [77777777]
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -3 "

Tabell 1: liste over primer par og primer sekvenser i DNA amplifikasjon. Se tekst for referanser.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Undersøkelser på virkningene av soppmidler på bee helse har forblitt et lite studert aspekt av pest management strategier. Vår studie som mål å bygge bro kunnskap ved hjelp av en rekke supplerende teknikker som eksplisitt isolerer potensielle faktorene kjøre bee avtar. Planlegging, begrunnelsen, og gjengivelse av disse eksperimentene er beskrevet nedenfor.

Det er viktig å sikre at ingen bier er tillatt å unnslippe mesh bur eksperimenter, siden dette ville kompromiss demografi analyse. Det er også viktig at kunstig reir har nok isolasjon å beskytte mot regn og sollys. Omsorg bør tas slik at soppmidler ikke er sprayet på reir. Koloniene gis sukker vann blæren å supplere nektar samlet og forhindre dehydrering.

For laboratoriet basert fôring prøvelser, skal strenge aseptiske vilkår vedlikeholdes for å hindre forurensning når forbereder pollen måltider. Kjøpt kommersielt pollen må bli pulverisert og UV sterilisert før bruk. Strukturen hygiene må opprettholdes for å hindre infisering fra overflødig parasitter som pantry møll og kakerlakker. Flytende blærer bør suppleres med sterilisert sukkeroppløsning for å hindre dehydrering. For forbehandling folketellingen utvises ikke å stress bier ved overdreven håndtering og holde dem utenfor den hived for lengre perioder.

DNA avkastning er avhengig av alder og type starter materiale, må bare friske eller godt frosne prøvene brukes i DNA utvinning og forsterkning. Eksempel vekt for DNA utvinning bør ikke overstige 0,25 gm, som dette vil redusere DNA avkastning. DNA gir bør kvantifiseres bruker gel geleelektroforese. Forhånd electrophoretic kvantifisering av isolerte DNA er kritisk før du fortsetter til qPCR reaksjoner å sikre effektiv forsterkning47.

For metagenomic analyse, kan en mer omfattende analyse av mikrobiell dynamisk fås ved å begrense mengden kommenterte sekvenser (av avslappende brøkdel av tålelig forskjellene mellom sekvenser) og redusere antall taksonomisk grupper, som samt flette de som relative overflod er betydelig lav (< 2%).

Konservative utvalgsstørrelsen (N = 5 for både soppdreper behandlet og ubehandlet cage studie elveblest) kan øke variansen i data som vil reduseres i fremtidige studier ved større replikering. For å legge større oppløsning og statistisk styrke resultatene, blir bee kolonier censused og veie før og etter soppdreper eksponering. Kjører bur eksperimentet for lengre perioder vil tillate produksjon av nye queens, som kan tjene som en ekstra svar variabel. Med disse endringene i gjeldende protokollen, vil fremtidige studier gi større detaljer om strukturen populasjonsdynamikk.

Den hydrofobe naturen pollen avskrekker sin effektiv blanding med vann. Pulverisere og granske pollen granulater til et fint pulver, hjelpemidler i miksing. Mengden pollen pulver kan justeres for å oppnå ønsket konsistens. Forsiktighet bør utvises grundig blande væske (vann eller soppdreper) for å oppnå en homogen fordeling av aktive ingredienser og selv levering til sankere.

Som overflødig DNA kan hemme PCR reaksjoner, anbefales det at prøven ikke bør veie mer enn 0,25 g. overdreven vortexing bør unngås så dette hagesaks DNA, senke avkastning. Lav DNA avkastning kan også være et resultat av langvarig eksponering for lyseringsbuffer. Bakteriell primere bør velges V7-V9 regionen 16S rRNA fortrinnsvis å minimere uspesifisert forsterkning av chloroplast DNA48. I tillegg kan sekvensering av andre gener som 18S ribosomal RNA genet gi en bedre forståelse av mikrobielle mangfoldet i pollen, samt endres befolkningen på soppdreper utnyttelse.

Gitt mengden av biblioteker for å behandle med Mothur, kan tiden være stor. Fjerne singletons når man sammenligner sekvenser mot hverandre (hvis computing ressurser er begrenset, fjerne dem før chimera filtrering) kan betydelig redusere tiden som kreves i databehandling taksonomisk driftsenheter.

Buret eksperimenter begrense naturlig flight rekke bier (i motsetning til tillater dem å forage mye over landskapet), og det er uklart graden som slike restriksjoner kan påvirke svar variablene. Selv om kontroll og behandling merdene opplever det samme celleområdet biotiske og abiotiske, er det logistisk umulig å kontrollere for microenvironment innenfor hver buret.

Sanne omfanget av innenfor-samfunnet mikrobiell interaksjoner er altfor komplekse og intrikate replikere gjennom eksperimentell prøvelser. Mens våre data sannsynlig dokumentere et delsett av totale mikrobiell mangfold i pollen-bestemmelser, er det første innblikk i de interaktive effektene som kan råde mellom bakterier og sopp i tilstedeværelse/fravær av soppmidler.

Bruke alternative databaser for å justere sekvenser49 eller forutsi funksjonelle metabolske USA basert på pollen bakterieflora50 kan gi et bredere syn på pollen microbiome. Til slutt, bedre betegner det metabolic og funksjonelle dynamiske av mikrobielle samfunn etter soppdreper søknad, er hele genomet sekvensering av pollen microbiome nødvendig.

Buret eksperimenter ved hjelp av kjøpt kommersielt elveblest gi en av de beste rammene å måle responsen variabler i halv-kontrollerte omgivelser. Forårsaker minimal endring til bier naturlige økologien (foraging effektivitet, sosiale struktur, avkom omsorg), minimere bur eksperimenter påfunn og stress, introdusert av kunstig miljø og Manuell håndtering under laboratorie-baserte eksperimenter.

Til best av vår kunnskap, har ingen studie ennå blitt gjennomført for å vurdere effekten av soppmidler på mikrobiell samfunnet dynamikken i pollen-levering av bumble bees. Eksponering for soppmidler kan eliminere ett eller flere følsomme arter, forstyrre den økologiske våpenhvilen mellom sopp og bakterier. Bruke feltet og lab-baserte studier som en smeltedigel for å spille ut disse interaksjoner, mål denne studien å demonstrere at utryddelsen av mikrobielle artene kan forvrenge den økologiske balansen i pollen microbiome, som kan i sin tur kompromisser bee helse.

Kultur-avhengige teknikker som fortynning og plating målestokk media fangebare en brøkdel av mikroflora fra et gitt miljø. Dette kan føre til en grov underrepresentation mikrobiell mangfold, og unculturable mikrober kan gå uoppdaget51. For å studere bredden av mikroorganismer, må forskere stole på kultur-uavhengig teknikker, som er mer inkluderende og omfattende, for eksempel metagenomic analyse og neste generasjons sekvensering. Trekker sterkt fra disse kraftige molekylær teknikker, denne studien har som mål å få høyere oppløsning i pollen microbiome enn levert av tradisjonell kultur-baserte teknikker alene.

Resultater fra denne studien har avdekket dyp tap av arbeidere i bumble bee kolonier utsatt for soppdreper. For en bumble bee koloni skal lykkes, må arbeiderne gi tilstrekkelige ressurser og omsorg for mor-dronningen og spesielt utvikle larver. Siste instans er målet i kolonien å maksimere ressurs fange (pollen og nektar) slik at så mange datter-queens som mulig kan produseres innen utgangen av sommeren. Sunn datter-queens er mål på egnethet for en koloni. Store reduksjoner i arbeidere, deretter effektivt undercuts koloniens evne til å produsere queens for året. I denne studien ikke bare var arbeider tall betydelig redusert, men mor-dronninger fra soppdreper behandlet elveblest presentert med lavere biomasse, antagelig som følge av utilstrekkelig matforsyning ved sankere. Gitt kompleksiteten av mikrobielle interaksjoner i pollen-bestemmelser, er det vanskelig å skjelne de eksakte interaktive effektene mellom sopp og bakterier som bidrar til disse mønstrene. Men resultatene fra replisert og gjentatte eksperimenter som beskrevet her, vil gi viktig innsikt i skiftende symbioses mellom disse to mikrobiell gruppene (enten konkurransedyktig, mutualistic eller commensal) som svar på xenobiotic oval stress, og dens nedstrøms virkning på pollen microbiome.

Ved hjelp av kraftige molekylære verktøy, kan økologiske kompleksiteten av pollen microbiome bedre løses. Foreløpig forståelsen avslører en overflod av naturlig forekommende bakterier og sopp, bidrar samlet for å opprettholde kolonien fitness. Spesielt er de gjær som ble isolert fra pollen-bestemmelser kjent for å bære bakteriedrepende og fermentative egenskaper, begge er avgjørende for utviklingen av larver bier. Slike økologisk foreninger er ladet av en høy grad av samfunn mellom bier og deres pollen microbiome. Pollen-bestemmelser, representerer derfor en emergent mangfold effekt, forårsaket av dyrking av mikrobielle fellesskapet består av funksjonelle nøkkelroller. I fravær av disse viktige symbionter vises pollen-tilbudet usikkert til ukjent grader. Videre arbeid i denne retningen, vil trolig forklarer funksjonelle mangfoldet av disse mikrobene og avsløre sin rolle som bee symbionter.

Nyere forskning har tilbakevist begrepet soppmidler som ufarlig for bier19,24,52,53,54. Målet med denne forskningen er å isolere mekanismer kjøring soppdreper virkninger på bier, dermed belyse årsak-virkning forholdet mellom soppdreper bruk og bee avtar. Hypoteser sentrum rundt konseptet at bee-mikrobe symbioses er endres betydelig ved soppdreper rester i pollen. Til slutt, dette arbeidet vil re-ramme hvor soppmidler vises og brukes i landbruk og urbane miljøer. I lys av den nåværende globale pollinator krisen genererer den foreslåtte forskningen ny kunnskap på innfødt bee økologi, som gjelder landbruksproduksjon praksis. Soppmidler fortsatt den siste agrichemical gruppen som effektivt skal unntas fra forskrifter begrense programmer avlinger i blomst. Som et resultat, utsatt både administrerte og wild bier konsekvent for soppmidler. En økende mengde litteratur antyder at selv om soppmidler ikke er dødelig for bier på kontakt, ved forhøyet doser, eksponering er ganske ugunstig, fører til høyere larver dødelighet21 og endret forager atferd. Det forventes at dette arbeidet vil lyse mechanism(s) som soppmidler er å skade pollinators. Videre vil denne forskningen danne grunnlaget for policy for informasjonsbehandling klokere pest og informere dyrkere av beste ledelsen praksis. Dette arbeidet vil også være instrumental i å levere retningslinjer for forbedret plantevernmidler sprøyting, som kan påvirke plantevernmidler lover og forskrifter. Videre, disse funnene vil være relevant for alle administrerte økosystem der planter er besøkt av pollen samle insekter. Med globale anslag av bee-spesifikke pollinering tjenester er usedvanlig høy55,56, hvis dette arbeidet kan redusere nedgangen av bee befolkninger, potensielle konsekvenser vil bli betydelige.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne ikke avsløre.

Acknowledgments

Forfatteren/forfatterne takke University of Wisconsin bioteknologi Center DNA sekvensering anlegget for å gi forsterkning og sekvensering fasiliteter og tjenester, Caitlin Carlson, Jennifer Knack, Jake Otto og Max Haase for å tilby kundestøtte for molekylær analyse. Dette arbeidet ble støttet av USDA-Agricultural Research Service bevilget midler (nåværende forskning Information System #3655-21220-001). Ytterligere støtte ble levert av National Science Foundation (under Grant nr. DEB-1442148), DOE Great Lakes bioenergi Research Center (DOE Office av vitenskap BER DE-FC02-07ER64494), og USDA National Institute of Food og landbruk (Luke prosjekt 1003258). C.T.H. er en Pew forsker i biomedisinsk vitenskapene og en Alfred Toepfer fakultet kar, støttet av Pew veldedige stiftelser og Alexander von Humboldt Foundation, henholdsvis.

Materials

Name Company Catalog Number Comments
Natupol Beehive Koppert USRESM1 16 hives
Propiconazole 14.3 Quali-Ppro 60207-90-1 Propiconazole 14.3%
Abound Syngenta 4033540 Azoxystrobin 22.9%
Chlorothalonil Syngenta 3452 Fungicide used for trials
Pollen granules Bee rescued B004D5650C 3X 16oz bottles, pollen for trials
Bacterial strains for inoculation Currie Lab
Yeast strains for inoculation Hittinger lab
Primer pairs UW Biotech Center
DNA Isolation Kit Mo Bio 12830-50 Commercial DNA isolation kit
Qubit dsDNA HS Assay Kit Thermo Fisher Q32851 DNA quantification tool
Select Master Mix for CFX Thermo Fisher 4472952 Used to perform real-time PCR using SYBR GreenER dye.
Real-Time PCR Detection System Bio Rad 1855196 Instrument used for PCR amplification
PCR Clean-Up Kit, Axygen 10159-696 Used for efficient removal of unincorporated dNTPs, salts and enzymes
DNA 1000 Kit Agilent 5067-1504 Used for sizing and analysis of DNA fragments
MiSeq Sequencer Illumina Used for next-generation sequencing
Assorted glassware (beaker, flasks, pipettes, test tubes, repietters) VWR

DOWNLOAD MATERIALS LIST

References

  1. Potts, S. G., Biesmeijer, J. C., Kremen, C., Neumann, P., Schweiger, O., Kunin, W. E. Global pollinator declines: Trends, impacts and drivers. Trends Ecol Evolut. 25, (6), 345-353 (2010).
  2. Vanengelsdorp, D., Meixner, M. D. A historical review of managed honey bee populations in Europe and the United States and the factors that may affect them. J Invertebr Pathol. 103, Suppl 1. S80-S95 (2010).
  3. Ellis, J. D., Evans, J. D., Pettis, J. Colony losses, managed colony population decline, and Colony Collapse Disorder in the United States. J. Apic. Res. 49, (1), 134-136 (2010).
  4. Vanbergen, A. J. Insect Pollinators Initiative. Threats to an ecosystem service: pressures on pollinators. Front Ecol Environ. 11, (5), 251-259 (2013).
  5. Cameron, S. A., et al. Patterns of widespread decline in North American bumble bees. Proc. Natl. Acad. Sci. U.S.A. 108, (2), 662-667 (2011).
  6. Szabo, N. D., Colla, S. R., Wagner, D. L., Gall, L. F., Kerr, J. T. Do pathogen spillover, pesticide use, or habitat loss explain recent North American bumblebee declines? Conser Lett. 5, (3), 232-239 (2012).
  7. Klein, A. -M., et al. Importance of pollinators in changing landscapes for world crops. Proc R Soc Lond [Biol]. 274, (1608), 303-313 (2007).
  8. Sánchez-Bayo, F., Goulson, D., Pennacchio, F., Nazzi, F., Goka, K., Desneux, N. Are bee diseases linked to pesticides? - A brief review. Environ Int. 89, 7-11 (2016).
  9. Kwong, W. K., Moran, N. A. Gut microbial communities of social bees. Nature Rev. Microbiol. 14, (6), 374-384 (2016).
  10. Engel, P., et al. The Bee Microbiome: Impact on Bee Health and Model for Evolution and Ecology of Host-Microbe Interactions. mBio. 7, (2), e02164-e02115 (2016).
  11. Henry, M., et al. A common pesticide decreases foraging success and survival in honey bees. Science. 336, (6079), New York, N.Y. 348-350 (2012).
  12. Pettis, J. S., vanEngelsdorp, D., Johnson, J., Dively, G. Pesticide exposure in honey bees results in increased levels of the gut pathogen Nosema. Die Naturwissenschaften. 99, (2), 153-158 (2012).
  13. Williamson, S. M., Wright, G. A. Exposure to multiple cholinergic pesticides impairs olfactory learning and memory in honeybees. J. Exp. Biol. 216, (10), 1799-1807 (2013).
  14. Artz, D. R., Pitts-Singer, T. L. Effects of fungicide and adjuvant sprays on nesting behavior in two managed solitary bees, Osmia lignaria and Megachile rotundata. PLoS ONE. 10, (8), (2015).
  15. Johnson, R. M., Wen, Z., Schuler, M. A., Berenbaum, M. R. Mediation of Pyrethroid Insecticide Toxicity to Honey Bees (Hymenoptera: Apidae) by Cytochrome P450 Monooxygenases. J. Econ. Entomol. 99, (994), 1046-1050 (2006).
  16. Pilling, E. D., Bromleychallenor, K. A. C., Walker, C. H., Jepson, P. C. Mechanism of synergism between the pyrethroid insecticide lambda-cyhalothrin and the imidazole fungicide prochloraz, in the honeybee (Apis mellifera L). Pest Biochem Physiol. 51, (1), 1-11 (1995).
  17. Iwasa, T., Motoyama, N., Ambrose, J. T., Roe, R. M. Mechanism for the Differential Toxicity of Neonicotinoid Insecticides in the Honey Bee Mechanism for the differential toxicity of neonicotinoid insecticides in the honey bee, Apis mellifera. Crop Protection. (2016).
  18. Mullin, C. A., et al. High levels of miticides and agrochemicals in North American apiaries: implications for honey bee health. PLoS One. 5, (3), e9754 (2010).
  19. Pettis, J. S., Lichtenberg, E. M., Andree, M., Stitzinger, J., Rose, R., Vanengelsdorp, D. Crop pollination exposes honey bees to pesticides which alters their susceptibility to the gut pathogen Nosema ceranae. PLoS One. 8, (7), e70182 (2013).
  20. David, A., et al. Widespread contamination of wildflower and bee-collected pollen with complex mixtures of neonicotinoids and fungicides commonly applied to crops. Environ Int. 88, 169-178 (2016).
  21. Zhu, W., Schmehl, D. R., Mullin, C. A., Frazier, J. L. Four common pesticides, their mixtures and a formulation solvent in the hive environment have high oral toxicity to honey bee larvae. PLoS One. 9, (1), e77547 (2014).
  22. Simon-Delso, N., Martin, G. S., Bruneau, E., Minsart, L. A., Mouret, C., Hautier, L. Honeybee colony disorder in crop areas: The role of pesticides and viruses. PLoS ONE. 9, (7), (2014).
  23. Park, M. G., Blitzer, E. J., Gibbs, J., Losey, J. E., Danforth, B. N. Negative effects of pesticides on wild bee communities can be buffered by landscape context. Proc R Soc Lond [Biol]. 282, (1809), (2015).
  24. van Engelsdorp, D., et al. "Entombed Pollen": A new condition in honey bee colonies associated with increased risk of colony mortality. J Invertebr Pathol. 101, (2), 147-149 (2009).
  25. Bernauer, O. M., Gaines-Day, H. R., Steffan, S. A. Colonies of bumble bees (Bombus impatiens) produce fewer workers, less bee biomass, and have smaller mother queens following fungicide exposure. Insects. 6, (2), 478-488 (2015).
  26. Tu, C. M. Effect of fungicides, captafol and chlorothalonil, on microbial and enzymatic activities in mineral soil. J Environ Sci Health B. 28, (B28), 67-80 (1993).
  27. Huang, C. -Y., Ho, C. -H., Lin, C. -J., Lo, C. -C. Exposure effect of fungicide kasugamycin on bacterial community in natural river sediment. J Environ Sci Health B. 45, (5), 485-491 (2010).
  28. Artigas, J., et al. Effects of the fungicide tebuconazole on microbial capacities for litter breakdown in streams. Aquat. Toxicol. 122, 197-205 (2012).
  29. Goerzen, D. W. Microflora associated with the alfalfa leafcutting bee, Megachile rotundata (Fab) (Hymenoptera: Megachilidae) in Saskatchewan, Canada. Apidologie. 22, (5), 553-561 (1991).
  30. Anderson, K. E., Sheehan, T. H., Eckholm, B. J., Mott, B. M., DeGrandi-Hoffman, G. An emerging paradigm of colony health: Microbial balance of the honey bee and hive (Apis mellifera). Insectes Sociaux. 58, (4), 431-444 (2011).
  31. Crotti, E., et al. Microbial symbionts of honeybees: a promising tool to improve honeybee health. N. Biotechnol. 30, (6), 716-722 (2013).
  32. Koch, H., Schmid-Hempel, P. Socially transmitted gut microbiota protect bumble bees against an intestinal parasite. Proc. Natl. Acad. Sci. U.S.A. 108, (48), 19288-19292 (2011).
  33. Anderson, K. E., et al. Microbial ecology of the hive and pollination landscape: bacterial associates from floral nectar, the alimentary tract and stored food of honey bees (Apis mellifera). PloS One. 8, (12), e83125 (2013).
  34. Evans, E. C., Spivak, M. Effects of Honey Bee (Hymenoptera: Apidae) and Bumble Bee (Hymenoptera: Apidae) Presence on Cranberry (Ericales: Ericaceae) Pollination. J Econ Entomol. 99, (3), 614-620 (2006).
  35. Goulson, D., et al. Can alloethism in workers of the bumblebee, Bombus terrestris, be explained in terms of foraging efficiency? Anim. Behav. 64, (1), 123-130 (2002).
  36. ThermoFisher Scientific. User Guide: Qubit dsDNA HS Assay Kits. Available from: https://tools.thermofisher.com/content/sfs/manuals/Qubit_dsDNA_HS_Assay_UG.pdf 3-6 (2010).
  37. Khadempour, L., LeMay, V., Jack, D., Bohlmann, J., Breuil, C. The Relative Abundance of Mountain Pine Beetle Fungal Associates Through the Beetle Life Cycle in Pine Trees. Microbial Ecol. 64, (4), 909-917 (2012).
  38. Dorn-In, S., Hölzel, C. S., Janke, T., Schwaiger, K., Balsliemke, J., Bauer, J. PCR-SSCP-based reconstruction of the original fungal flora of heat-processed meat products. Int J Food Microbiol. 162, (1), 71-81 (2013).
  39. Klindworth, A., et al. Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies. Nucleic Acids Res. 41, (1), (2013).
  40. White, T., Bruns, T., Lee, S., Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications. 18, (1), 315-322 (1990).
  41. Illumina. 16S Metagenomic Sequencing Library Preparation: Preparing 16S Ribosomal RNA Gene Amplicons for the Illumina MiSeq System. Available from: http://ngs.biodiv.tw/NGSCore/wp-content/uploads/Documents/16s-metagenomic-library-prep-guide-15044223-b.pdf (2017).
  42. Kõljalg, U., et al. Towards a unified paradigm for sequence-based identification of fungi. Mol Ecol. 22, (21), 5271-5277 (2013).
  43. Wang, Q., Garrity, G. M., Tiedje, J. M., Cole, J. R. Naïve Bayesian Classifier for Rapid Assignment of rRNA Sequences into the New Bacterial Taxonomy. Appl. Environ. Microbiol. 73, (16), 5261-5267 (2007).
  44. Team, R. C. R: A language and environment for statistical computing [Computer software]. R Foundation for Statistical Computing. Vienna, Austria. (2015).
  45. Kaltenpoth, M., Engl, T. Defensive microbial symbionts in Hymenoptera. Funct Ecol. 28, (2), 315-327 (2014).
  46. Gerth, M., Saeed, A., White, J. A., Bleidorn, C. Extensive screen for bacterial endosymbionts reveals taxon-specific distribution patterns among bees (Hymenoptera, Anthophila). FEMS Microbiol Ecol. 91, (6), (2015).
  47. Smith, C. J., Osborn, A. M. Advantages and limitations of quantitative PCR (Q-PCR)-based approaches in microbial ecology. FEMS Microbiol Ecol. 67, (1), 6-20 (2009).
  48. Kim, M., Morrison, M., Yu, Z. Evaluation of different partial 16S rRNA gene sequence regions for phylogenetic analysis of microbiomes. J Microbiol Methods. 84, (1), 81-87 (2011).
  49. DeSantis, T. Z., et al. Greengenes, a Chimera-Checked 16S rRNA Gene Database and Workbench Compatible with ARB. Appl. Environ. Microbiol. 72, (7), 5069-5072 (2006).
  50. Langille, M. G. I., et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nature Biotechnol. 31, (9), 814-821 (2013).
  51. Malik, S., Beer, M., Megharaj, M., Naidu, R. The use of molecular techniques to characterize the microbial communities in contaminated soil and water. Environ Int. 34, (2), 265-276 (2008).
  52. Ladurner, E., Bosch, J., Kemp, W. P., Maini, S. Assessing delayed and acute toxicity of five formulated fungicides to Osmia lignaria and Apis mellifera. Apidologie. 36, (3), 449-460 (2005).
  53. Huntzinger, C. I., James, R. R., Bosch, J., Kemp, W. P. Fungicide Tests on Adult Alfalfa Leafcutting Bees (Hymenoptera: Megachilidae). J Econ Entomol. 101, (4), 1088-1094 (2008).
  54. Gradish, A. E., Scott-Dupree, C. D., Shipp, L., Harris, C. R., Ferguson, G. Effect of reduced risk pesticides for use in greenhouse vegetable production on Bombus impatiens (Hymenoptera: Apidae). Pest Manag. Sci. 66, (2), 142-146 (2010).
  55. Calderone, N. W. Insect pollinated crops, insect pollinators and US agriculture: trend analysis of aggregate data for the period 1992-2009. PloS One. 7, (5), e37235 (2012).
  56. Ollerton, J., Winfree, R., Tarrant, S. How many flowering plants are pollinated by animals? Oikos. 120, (3), 321-326 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics