Synthese und Charakterisierung eines Aspirin-Fumarat Prodrug, die NFkB-Aktivität hemmt und Brustkrebs-Stammzellen

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Kastrati, I., Delgado-Rivera, L., Georgieva, G., Thatcher, G. R., Frasor, J. Synthesis and Characterization of an Aspirin-fumarate Prodrug that Inhibits NFκB Activity and Breast Cancer Stem Cells. J. Vis. Exp. (119), e54798, doi:10.3791/54798 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Die Entzündung ist ein Krebs Markenzeichen, die Inzidenz von Krebserkrankungen und Förderung, und schließlich Progression zur Metastasierung zugrunde liegt. Daher ist ein entzündungshemmendes Medikament Zugabe zu Standard-Krebs Regimenter kann der Behandlungserfolg verbessern. Ein solches Medikament, Aspirin (Acetylsalicylsäure, ASA), wurde für die Krebschemoprävention und Antitumoraktivität untersucht. Neben Hemmung haben die Cyclooxygenase 2-Prostaglandin-Achse, ASA Anti-Krebs-Aktivitäten auch auf den Kernfaktor ĸB (NFĸB) Hemmung zugeschrieben worden. Da längere ASA Verwendung kann Magen-Darm-Toxizität verursachen, ein Prodrug Strategie wurde erfolgreich umgesetzt. In diesem Prodrug entwerfen die Carbonsäure von ASA maskiert und zusätzliche Pharmacophore eingebaut werden.

Dieses Protokoll beschreibt, wie man ein Aspirin-Fumarat Prodrug synthetisiert, GTCpFE und charakterisiert seine Hemmung der NFĸB Stoffwechselweg in Brustkrebszellen und Abschwächung des Krebsstielartigen richtigenKrawatten, ein wichtiger NFĸB abhängigen Phänotyp. GTCpFE hemmt wirksam die NFĸB Stoffwechselweg in Brustkrebszelllinien, während ASA irgendeine inhibitorische Aktivität fehlt, was darauf hinweist, dass das Hinzufügen Fumarat wesentlich zu ASA Struktur seiner Aktivität beiträgt. Zusätzlich zeigt GTCpFE signifikante Aktivität Stammzellen anti-Krebs durch mammosphere Bildung blockiert und die Krebsstammzellen CD44 + CD24 assoziiert Abschwächen - Immunphänotyp. Diese Ergebnisse schaffen eine tragfähige Strategie verbesserte entzündungshemmende Medikamente zu entwickeln, für die Chemoprävention und Krebstherapie.

Introduction

Die Entzündung ist ein Markenzeichen , die mehrere Aspekte der Tumorentstehung, wie Häufigkeit und Förderung, und schließlich Progression zur Metastasierung 1 zugrunde liegt. Bei Brustkrebs wird diese weiter durch epidemiologische Beobachtungen gestützt, dass die regelmäßige Anwendung des klassischen nicht-steroidale entzündungshemmende Medikament Aspirin (Acetylsalicylsäure, ASS) zeigt, die mit einer Senkung sowohl der Brustkrebs-Inzidenz und Risiko von Metastasen und Rezidiv assoziiert ist 2,3. ASA wirkt primär durch Cyclooxygenase-2 - inhibierende Aktivität, die oft in Brustkrebs 4,5 aufreguliert wird. Die Anti-Krebs - Wirkungen von ASA auch durch Unterdrückung aberrant nuclear factor & kgr; B (NFKB) Signalisierungs 6-8 jedoch vermittelt werden kann. Dies ist wichtig , weil eine deregulierte NFKB Stoffwechselweg Überleben von Tumorzellen fördert, Proliferation, Migration, Invasion, Angiogenese und Therapieresistenz 9-11. NFKB Signalweg-Aktivierung ist auch entscheidend für die Montageeiner Immunantwort. Daher ist für Anti-Krebs-Therapie, wo verlängerte NFKB Hemmung erforderlich ist, muß man die nachteiligen Nebenwirkungen beteiligt lang anhaltende Immunsuppression berücksichtigen. Daher kann ASA für therapeutische Optimierung als ein guter Ausgangspunkt dienen.

Eine Einschränkung für ASA - Anwendung in der Krebstherapie ist die erhöhte Dosen für Cyclooxygenase 2 erforderlich und NFKB - Hemmung, die mit Magen - Darm - Toxizität assoziiert sind, wie Magengeschwüre und Magen 12,13 Blutungen. Allerdings ASA in als Ester-Prodrug Umwandlung kann ASA Magen-Darm-Toxizität verringern. Zur weiteren Verbesserung der Wirksamkeit und / oder fügen Sie Funktionalität, zusätzliche strukturelle Elemente oder Neben Pharmacophore können auch in Ester-Prodrug-Design integriert werden. Eine solche Pharmakophormodell hinzugefügt ASA Potenz zu verbessern gegen die NFkB Weg Fumarat ist, die wir zuvor für NFkB Signalweg Hemmung 14,15 wichtig zu sein gezeigt.

15, GTCpFE, und die Hypothese aufgestellt , dass eine solche Hybridmolekül noch potent sicher sein würde gegen den NFkB Weg. Wir testeten ihre anti-NFKB - Aktivität in Brustkrebszellen und ihre Fähigkeit , Brustkrebs Stammzellen (KSZ) 15, die auf NFKB Signalgebung für das Überleben und das Wachstum 16-21 verlassen zu blockieren. Wir finden , dass die Wirksamkeit von GTCpFE gegen den NFkB Weg deutlich über ASA 15 verbessert. Darüber hinaus GTCpFE Blöcke mammosphere Bildung und dämpft die Oberflächenmarker CD44 CSC + CD24 - Immunophänotyp, was darauf hinweist , dass GTCpFE fähig ist CSCs auszurotten 15. Diese Ergebnisse stellen die Aspirin-Fumarat Prodrug als ein wirksames entzündungshemmendes Mittel, das auch Brust CSCs ausrichten können. In Bezug auf die Brustkrebstherapie kann GTCpFE das Potenzial haben, aggressive und tödliche Krankheit zu behandeln.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Synthese von Aspirin-Fumarat Prodrug GTCpFE

  1. Unter Verwendung eines Kunststoff-Kolbenspritze, messen 0,81 ml (20 mmol) Methanol und mischen Sie es in Wasser (10 ml) in einem Rundkolben. Kühlen der erhaltenen Mischung auf 0 ° C, indem der Kolben in einem Eis-Wasserbad platzieren. In 4-Hydroxybenzylalkohol (2,48 mg, 20 mmol) und rührt das Reaktionsgemisch, bis die Lösung klar ist.
  2. Eine Lösung aus O -acetylsalicyloyl Chlorid (3,77 mg, 19 mmol) in wasserfreiem Toluol (10 ml) , indem die gewünschte Menge an O -acetylsalicyloyl Chlorid Wiege- und es in dem Lösungsmittel in einem getrennten Kolben gelöst wird . Unter Verwendung eines Kunststoff-Kolbenspritze, fügen Sie diese Lösung zu der Mischung, hergestellt in Schritt 1.1, und lassen Sie die Reaktion bei 0 ° C gerührt.
  3. Überwachen Sie die Reaktion unter Verwendung von Dünnschichtchromatographie (TLC). Die TLC-Platten sollten Silica als stationäre Phase aufweisen.
    1. Bereiten Sie eine mobile Phase, bestehend aus 20:80 Ethylacetat (AcOEt) / Hexan. In einer DC-Kammer(Oder kleine Behälter) werden 5 ml der mobilen Phase den Boden der Kammer zu bedecken.
      HINWEIS: Die Menge der mobilen Phase hängt von der gewählten Kammer. Fügen Sie immer genug, um den Boden zu bedecken, aber sobald die TLC nach innen gesetzt ist, wird die Lösungsmittelleitung sollte nicht die Höhe übertreffen, wo die Verbindungen entdeckt werden.
    2. Nehmen Sie eine Probe der Reaktion mit einer Spritze (0,2 ml), legen Sie sie in einem kleinen Fläschchen, und verdünnen Sie es mit Ethylacetat (2-3 Tropfen). Mit einem Spotter TLC, nehmen Sie vorsichtig eine Probe des verdünnten Reaktionsmischung und vor Ort in der TLC.
      HINWEIS: Die Punkte 1-2 mm sein sollte, und dies sollte am unteren 1/4 Zoll von der DC-Platte durchgeführt werden.
    3. Auf der gleichen TLC, legen einen Punkt einer Lösung von O-acetylsalicyloyl Chlorid (0,2 mg in 0,5 ml Ethylacetat) als Vergleich. Sobald die Flecken trocken sind, legen Sie sie in der Kammer und laufen lassen, bis die Lösungsmittelfront hat fast die Spitze des TLC erreicht.
    4. Nehmen Sie die TLC aus, trocknen lassen und zu visualisieren, es unter einer UV-Lampe. Die Reaktion ist abgeschlossen , wenn die O -acetylsalicyloyl Chlorid Stelle aus dem Reaktionsgemisch verschwindet.
    5. Wenn die Reaktion abgeschlossen ist, entfernen Sie das Eis-Wasser-Bad, und lassen Sie die Reaktion für 20 Stunden bei Raumtemperatur rühren.
  4. Filtriere den Niederschlag eines Büchner-Trichters mit einem Frittenscheibe von mittlerer Porosität verwendet wird. Setzen Sie den Feststoff in einer Szintillationsphiole, und lassen Sie die Verbindung im Vakuum über Nacht in einem Exsikkator bei Raumtemperatur. Verwenden Phosphorpentoxid (P 2 O 5) als Trocknungsmittel.
  5. Trocknen Sie einen Rundkolben, indem sie sie in einem Ofen bei 80 ° C für mindestens zwei Tage platzieren, bevor diese Reaktion einrichten. Alternativ Der Kolben wird mit einem Septum und durchdringen es mit einer Nadel, die an eine Vakuumpumpe angeschlossen ist. Schalten Sie die Vakuumpumpe auf und trocknen Sie den Kolben unter Verwendung einer Heizpistole. Abkühlen lassen, und wiederholen Sie diesen Schritt 2 weitere Male.
  6. Dieser Ballon wird Argongas verwendet, und schließen Sie es an eine Plastikspritze (dessen Kolben hwie wurde mit einer Nadel entfernt). Schalten Sie die Vakuumpumpe aus und entfernen Sie die Nadel, um es angebracht, die in dem nun getrockneten Rundkolben eingeführt wurde. Führen Sie die Nadel in die Argonballon durch das Septum verbunden, um den Rundkolben abgedichtet wird.
    1. Hinzufügen 4-hydroxymethylphenol Ester von 2-Acetyloxybenzoesäure (100 mg, 0,349 mmol), 4-Dimethylaminopyridin (4 mg, 0,033 mmol) und Triethylamin (53 mg, 0,523 mmol) in einen separaten Kolben, gelöst sie dann in wasserfreiem Tetrahydrofuran (5 ml). Mit einer Plastikspritze mit einer Nadel befestigt, fügen Sie diese Lösung auf den Rundkolben abgedichtet. Man kühlt die Mischung auf 0 ° C, indem der Kolben in einem Eiswasserbad platzieren.
  7. Zur vorhergehenden Mischung wurde eine Lösung von Ethyl Fumarsäuredichlorid Chlorid hinzu (68 mg, 0,419 mmol) in wasserfreiem Tetrahydrofuran (5 ml), tropfenweise über einen Zeitraum von 10 min. Rühre das erhaltene Lösung bei 0-5 ° C für 2-4 Std.
  8. Extrahieren der Reaktionsmischung mit Ethylacetat (100 ml) und Salzlösung (50 ml). <br /> Anmerkung: Brine eine gesättigte Lösung von Natriumchlorid (NaCl). Um es vorzubereiten, legen Sie 200 ml Wasser in einem sauberen Glasbehälter dann NaCl beginnen Zugabe (unter Rühren), bis es nicht mehr auflöst.
    1. Nach der Extraktion, entfernen Sie die wässrige Phase und wiederholen Sie den letzteren Schritt zwei weitere Male.
    2. Trocknen der Mischung durch Natriumsulfat zu der organischen Phase Zugabe, bis der Feststoff nicht auf nicht verklumpen, wenn die Glaswaren gerührt. Unter Verwendung eines anderen Buchner-Trichter mit einem Frittenscheibe, filtriert man die Mischung in einen Kolben mit rundem Boden um das Natriumsulfat zu entfernen, dann zur Trockne eingedampft unter Verwendung eines Rotationsverdampfers bei einer Temperatur von 40 ° C eingestellt.
  9. Mit Hilfe eines TLC, bestimmen eine richtige mobile Phase in der Säulenchromatographie verwendet werden.
    HINWEIS: Für dieses Experiment wurde ein Gradient von 20:80 AcOEt / Hexan verwendet wurde.
  10. Bereiten Sie eine Säule mit Kieselgel und dem entsprechenden Lösungsmittelphase. Sobald die Verbindung hinzugefügt wurde, fügen Sie eine Schicht aus Natriumsulfat (oder Sand) zu protect die Säule als Lösungsmittel zugegeben.
    1. Da die Säule läuft, überwacht das Eluat durch TLC. Beschmutzen jede andere Teströhrchen, wie sie aus der Säule gesammelt werden. Wenn das Produkt von Interesse eluierte, mischen Sie alle Proben reines Produkt in einem großen Rundkolben, und trocknen Sie sie mit der Badtemperatur am Rotationsverdampfer bei 40 ° C eingestellt.
      HINWEIS: Das Produkt als weißer Feststoff erscheinen soll.
  11. Um die Struktur GTCpFE bestätigen, sammeln Protonen- und Kohlenstoff (1 H und 13 C, respectively) Kernspinresonanz (NMR) -Spektren gemäß den Anweisungen des Herstellers.
    HINWEIS: In dieser Studie wurde ein 400 MHz FT - NMR - Spektrometer verwendet wurde , die 1 H- und 13 C - Spektren zu sammeln. Führen Sie mindestens 25 Scans bei Raumtemperatur genügend Daten Auflösung zu erhalten. Die NMR - Peaks beobachtet wurden die folgenden, 1 H NMR (CDCl 3): δ 1,29 (t, 3 H, 3 J = 7,0 Hz, CH 3); 2,31 (s, 3 H, CH 3); 4,26 (q, 2 H, 3J = 7,0 Hz, COOCH 2); 5,25 (s, 2 H, OCH 2); 6,89 (s, 2 H, HC = CH); 7,19 (m, 3 H, Ar); 7,42 (m, 3 H, Ar); 7,65 (m, 1 H, Ar); 8,22 (dd, 1H, 3J = 7,8, 4 J = 1,2 Hz, Ar). 13 C - NMR (CDCl 3): 169,70, 164,86, 164,75, 162,89, 151,28, 150,69, 134,76, 134,32, 133,26, 133,16, 132,25, 129,81, 126,26, 124,11, 122,47, 122,04, 66,40, 61,43, 21,05, 14,15.
  12. Darüber hinaus sammeln Anweisungen, um ein Massenspektrum hoher Auflösung unter Verwendung von Flüssigchromatographie-Massenspektrometrie in Kombination mit Ionenfalle und Flugzeittechnik (LCMS-IT-TOF) für eine genaue Massenmessungen gemäß Hersteller.
    HINWEIS: In dieser Studie (M + NH 4 +) berechnet: 430,1496; beobachtet: 430,1477.

2. GTCPFE Hemmt die NFĸB Aktivität in Brustkrebszellen

  1. Zellkulturbedingungen
    1. Pflegen Sie die menschliche Brustkrebs-Zelllinien, MCF-7 und MDA-MB-231 gemäß dem Standardzelle culture Techniken und 2 mit 5% CO bei 37 ° C in einem befeuchteten Inkubator fortzupflanzen.
      1. Bereiten MCF-7-Zellmedium aus Roswell Park Memorial Institute (RPMI) 1640-Medium mit Phenolrot mit 10% fötalem Rinderserum (FBS) ergänzt, 1% nicht-essentiellen Aminosäuren, 2 mM L-Glutamin, 1% Antibiotika Penicillin-Streptomycin und 6 ng / ml Insulin. Bereiten Sie MDA-MB-231 Zellmedium von einer verbesserten Minimum Essential Medium (IMEM), ergänzt mit 5% FBS, 1% nicht-essentielle Aminosäuren, 2 mM L-Glutamin und 1% Antibiotika Penicillin-Streptomycin.
  2. NFkB-RE Luciferase Reporter Assay
    1. Trypsinize Brustkrebs MCF 7-Zellen 0,25% Trypsin für 5 min bei 37 ° C unter Verwendung zählen manuell ein Hämozytometer und Samen in 24-Well-Platten bei 90.000 Zellen pro Well Dichte verwendet wird.
    2. Am folgenden Tag, Co-transfizieren Zellen mit Plasmid-DNA eines NFkB-Response-Element (NFkB-RE) Luciferase-Konstrukt, 1 ug / Vertiefung, alOng mit dem promotor Renilla-Luciferase-Konstrukt, 0,2 ug / Vertiefung. Führen Sie Transfektionen für jede Behandlungsgruppe in dreifacher Ausfertigung.
      1. Wasche die Zellen zweimal mit PBS und Inkubieren mit Mischungen von Plasmid - DNA und 1 & mgr; l pro Vertiefung von Transfektionsreagenz (zB Lipofectamin) in serumfreien Medien. Nach 6 Stunden, ändern Sie das Medium zu 1 ml regelmäßigen Medium (ohne Antibiotika Penicillin und Streptomycin).
    3. Nach 16 Stunden, fügen 1 ul Fahrzeug oder verschiedene Stammlösungen der GTCpFE oder ASA Medikamente zu jeder Vertiefung. Löse Droge Stammlösungen (100, 50, 20, 10 und 1 mM) in Dimethylsulfoxid bei 1,000x Konzentration. Nachdem die Medikamente Zugabe inkubieren Zellen für 2 h bei 37 ° C.
    4. Um den NFkB Signalweg aktivieren, fügen Sie die pro-inflammatorischen Zytokins TNF (10 ug / ml Stammlösung) in jede Vertiefung für eine endgültige Konzentration von 10 ng / ml und Inkubation für 4 Stunden. Fügen Sie eine TNFa allein Kontrolle. Saugen Sie das Medium und speichern Sie die Zelles bei -80 ° C.
    5. Messung der Luciferase eine Luciferase-Reporter-Assay-System nach den Anweisungen des Herstellers.
      HINWEIS: Wenn die Luciferase Assay System (zB Dual - Luciferase - Assaysystem) zum ersten Mal, um eine Lösung der Luciferase - Assay - Reagens herzustellen , indem man es in 10 ml Puffer erneut suspendiert und bei -80 ° C in 1 ml Aliquoten lagern.
      1. Bereiten Sie Puffer 1x Lyse durch 5x Stammpuffer mit Wasser verdünnt wird. Lysieren Zellen in jeder Vertiefung unter Verwendung von 100 & mgr; l 1x Lysepuffer. Inkubiere die Platten auf einem Orbitalschüttler für 15 min, bei mittlerer Geschwindigkeit.
      2. Beschriften Sie ein 1,5-ml-Röhrchen pro Probe. Thaw Luciferase-Assay-Reagenz auf Raumtemperatur (50 & mgr; l pro Probe werden benötigt) und halten Sie in der Folie. Bereiten 1x Quenching-Reagenz in einem Glasfläschchen, 01.49 Verdünnung in Puffer und vortex es (50 ul pro Probe benötigt werden).
      3. Zugabe von 10 & mgr; l Zelllysat mit einem markierten Mikrozentrifugenröhrchen. Dann fügen Sie 50 ul Luciferase-Nachweisreagens undsanft Wirbel. Unmittelbar danach wird das Reagenzglas in einem Halter und messen die Lumineszenz über das Dual-Luciferase-Programm im Luminometer. Wählen Sie und drücken Sie die folgenden Schritte aus: Run Promega Protokolle → Dual-Glo → OK.
      4. Je 50 ul der Quenching-Reagenz in das Teströhrchen und vorsichtig vortexen. Messen Sie die Lumineszenz. Wiederholen Sie diese Schritte für jede Probe.
      5. Analysieren von Daten unter Verwendung von Tabellenkalkulations durch Normalisierung NFkB-RE an die Renilla interne Kontrolle (NFkB-RE / Renilla). Vergleichen Inhibitor Daten zu TNFa nur Steuerung (TNFa wird nur auf 100% gesetzt).
  3. NFkB-Ziel Gentranskription
    1. Seed MCF-7-Zellen in 6-Well-Platten bei 250.000 Zellen pro Vertiefung in 2 ml Medium Volumen hergestellt, wie in Abschnitt 2.1 beschrieben.
    2. Am folgenden Tag, fügen 2 ul verschiedener GTCpFE 1,000x Bestände (100, 50, 20, 10 und 1 mM) für 2 Stunden vor der Zugabe von TNF & agr; 10 ng / ml für weitere 2 Std. Führen Sie jede Behandlungin dreifacher Ausführung. Fügen Sie Fahrzeug und allein Kontrollen TNFa.
    3. Isolieren RNA das Guanidiniumthiocyanat-Phenol-Chloroform - Extraktionsverfahren unter Verwendung von nach den Anweisungen des Herstellers 22. Bestimmen Sie RNA-Konzentration (in Diethylpyrocarbonat (DEPC) behandeltem Wasser) und RNA-Reinheit mit einem Spektralphotometer. Halten Sie RNA-Proben auf Eis oder bei -80 ° C. Verwenden Sie nur RNase-freie Spitzen Barriere, wenn RNA-Handling.
    4. Revers transkribieren 0,5 & mgr; g Gesamt-RNA eines kommerziell erhältlichen Kits von Moloney Murine Leukemia Virus (M-MLV) Reverse Transkriptase verwendet wird.
      HINWEIS: Der Kit enthält 5x Puffer und Dithiothreitol (DTT), zusammen mit dNTP-Mischung und zufälligen Hexameren Mischung.
      1. Mit 0,5 & mgr; g RNA auf 200 Einheiten M-MLV, 0,5 mM dNTPs, 100 ng zufälligen Hexameren, 10 mM DTT, 1x Puffer und DEPC-Wasser auf ein endgültiges 10 ul Reaktionsvolumen. Durchführung der reversen Transkriptase-Reaktion eine PCR-Cycler für 50 min bei 37 ° C und dann 15 min bei 70 unter Verwendung von &# 176; C, um das Enzym zu inaktivieren wärme.
    5. Verdünne die resultierende cDNA Produkt auf 100 ul mit doppelt destilliertem Wasser und mit 2 & mgr; l für jede nachfolgende quantitative Polymerase-Kettenreaktion (PCR) -Reaktion.
      1. Mix Vorwärts- und Rückwärts-Primer, die für das Gen von Interesse bei 1,25 & mgr; M Konzentration jeder. Vorbereiten eines Master-Mix mit 2 & mgr; l doppelt destilliertem Wasser, 1 & mgr; l 1,25 & mgr; M Primer-Mix und 5 ul 2x des Farbstoffes Erkennung der doppelsträngigen DNA zu ermöglichen. Legen Sie die 2 ul cDNA und 8 ul Master-Mix in 96-Well-PCR-Platten.
    6. Führen Sie die quantitative PCR eine Echtzeit-PCR-System (40 Zyklen, 95-60 ° C) entsprechend den Anweisungen des Herstellers und die Daten manuell analysieren.
      HINWEIS: Alle verwendeten PCR - Primer wurden validiert und zuvor 23 berichtet.
    7. Berechnen Genexpression fache Veränderung über die ΔΔCt Methode unter Verwendung von Tabellenkalkulationsprogramm, mit ribosomale Protein 36B4 mRNA als interne Kontrolle dienen 23.

3. GTCpFE Hemmt Brustkrebs-Stammzellen in vitro

  1. Mammosphere Formation Assay
    1. Bereiten mammosphere (MS) -Medium von Dulbeccos modifiziertem Eagle Medium ergänzt: Nutrient Mixture F-12 (DMEM / F12) Phenolrot-freiem Medium mit 1% Methylcellulose. Nach dem Auflösen von sanft über Nacht bei 4 ° C schütteln. Filter sterilisieren, das Medium und Ergänzung mit B27 1x, 1% Penicillin und Streptomycin, 5 ug / ml Insulin, 1 & mgr; g / ml Hydrocortison und 20 ng / ml rekombinantem humanen epidermalen Wachstumsfaktor.
    2. Bereiten Sie einzelne Zellen von MDA-MB-231 Zelllinie durch Verdauung Trypsin (Trypsin 0,25% für 5 min bei 37 ° C) von Monolayer-Kulturen und filtriert durch die Siebe. zählen manuell einzelne dissoziierten Zellen und die Platte in 96-Well-Ultra-Low-Befestigungsplatten bei einer Dichte von 400 Zellen / Vertiefung. Am nächsten Tag, fügen verschiedene Konzentrationen von AEBFE (beispielsweise endgültige GTCpFE Konzentrationen: 1, 10, 20, 50 & mgr; M) bis zu einem Endvolumen von 100 & mgr; l. jede Behandlung in dreifacher Ausführung durchführen.
    3. Nach 7 Tagen Kultur im Inkubator, erwerben Bilder über eine Imaging-Software ein umgekehrtes Mikroskop. zählen manuell die Anzahl MS> 75 & mgr; m im Durchmesser. Vergleichen Sie die medikamentöse Behandlung zur Fahrzeugsteuerung.
      HINWEIS: Der Durchmesser der MS> 75 & mgr; m bestimmt wird, um die Imaging-Software.
  2. CD44 + CD24 - CSC Immunophänotyp
    1. Trypsinize MDA-MB-231-Zellen mit 0,25% Trypsin für 5 min bei 37 ° C. Graf mit einem Hämozytometer und Samen in 10 cm-Schalen auf 3 Millionen Zellen pro Schale in 10 ml Medium, wie in Abschnitt 2.1 beschrieben. In Fahrzeug (10 & mgr; l Dimethylsulfoxid) oder GTCpFE (10 & mgr; l von 50 mM Lager) zu den Zellen für 72 Stunden.
    2. Für Fahrzeug oder GTCpFE Behandlungsgruppen, trypsinize Zellen (wie in Schritt 3.2.1) und zu verteilen 1 Million Zellen in "Test & #39; oder 'Control' 5 ml Polystyrolröhrchen, das 2 ml 1x Hanks Balanced Salt Solution (HBSS) Puffer mit 2% FBS supplementiert.
    3. Zum Anfärben für den Oberflächenmarker CD44 und CD24, Spin Zellen nach unten und füge 20 ul jeder konjugierten Antikörper und HBSS + 2% FBS Röhrchen für eine endgültige 100 & mgr; l Gesamtvolumen in Test (1: 5-Verdünnung). 100 l HBSS + 2% FBS Rohre zu steuern. Fügen Sie CD44-APC konjugierte Antikörper und CD24-PE Antikörper einzigen Fleck Kontrollen oder die IgG immunoisotype Kontrollen.
    4. Inkubiere Zellen im Dunkeln bei 4 ° C für 30 min. Spin-down Zellen 5 min bei 400 xg und Rekonstitution in 200 & mgr; l HBSS-Puffer mit 2% FBS. Halten Zellen auf Eis in der Dunkelheit.
    5. Führen fluoreszenzaktivierte Zellsortierung (FACS) von lebenden Zellen eines FACS-Analysator Instrument gemäß den Anweisungen des Herstellers. Sammeln Sie mindestens 50.000 Veranstaltungen für jedes Röhrchen. Führen Sie Behandlungen in dreifacher Ausfertigung.
      HINWEIS: Gating basiert auf Kontrollen von keiner Färbung (Control Rohr), IgG immunoisotypes und die CD44-APC und CD24-PE einzelne Flecken.
    6. Analysieren Sie Daten ein verfügbares Durchflusszytometrie-Software.
      HINWEIS: Der prozentuale Anteil der GTCpFE behandelten Zelle mit dem CD44 + CD24 - Immunophänotyp wird geschätzt , und im Vergleich zu Fahrzeugsteuerung.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

In Figur 1 ist die chemische Struktur der Aspirin-Fumarat Prodrug, GTCpFE und ihre Hemmwirkung auf die Zytokinproduktion NFĸB Stoffwechselweg in Brustkrebszellen induziert sind angegeben. GTCpFE hemmt sowohl NFĸB Endpunkte NFĸB-RE - Luciferase - Aktivität (1B) und die Expression von NFĸB Zielgene, wie beispielsweise intercellular adhesion molecule 1 (ICAM1), Chemokine CC Motif Ligand 2 (CCL2) und Tumornekrosefaktor (TNF) (Abbildung 1C) in MCF-7 - Brustkrebszellen. Berechnete hemmende Konzentration bei 50% (IC 50) Wert auf beiden Endpunkten ist ~ 20 & mgr; M. IC 50 -Wert berechnet , um eine grafische Darstellung Software. Im Vergleich ASA selbst sogar bei 200 & mgr; M (10x IC 50 von GTCpFE) zeigt keine hemmende Aktivität (Abbildung 1B, blaue Linie) in Brustkrebszellen. Dies zeigt, dass die Prodrug-Strategie der Zugabe von Fumarat Pharmakophor zu ASA significantly verbessert seine anti-NFĸB Aktivität.

Um die anti-CSC - Aktivität zu messen, verwendeten wir zwei Tests: die mammosphere (MS) Bildungstest und die Population von Zellen , die CD44 exprimieren + CD24 - Immunophänotyp, eine bona fide CSC Oberflächenmarker bei Brustkrebs 24. GTCpFE hemmt MS Bildung von MDA-MB-231 - Brustkrebszellen in einer dosisabhängigen Weise in 2A gezeigt. Ähnlich wie bei NFĸB Weg Hemmung in adhärenten Kulturen, ist der IC 50 -Wert für mammosphere Bildung ~ 20 & mgr; M. Diese Konsistenz wird erwartet, da CSCs verlassen sich auf NFĸB Signalisierung für das Überleben und die Vermehrung von 16-21. Darüber hinaus führte GTCpFE Vorbehandlung in einem signifikanten Abbau der CD44 + CD24 - Population (2B) in MDA-MB-231 - Zellen. Gemeinsam schaffen diese Ergebnisse GTCpFE die Fähigkeit, effektiv Brust CSCs Ziel.

Abbildung 1
Abbildung 1: GTCpFE hemmt die NFĸB Stoffwechselweg in Brustkrebszellen. (A) Die chemische Struktur des Aspirin-Fumarat Prodrug, GTCpFE. (B - C) MCF-7 - Zellen wurden vorbehandelt während 2 Stunden mit verschiedenen Konzentrationen von GTCpFE, ASA, oder das Fahrzeug , gefolgt von einer Behandlung mit TNF & agr; (10 ng / ml) für 2-4 Std. (B) NFkB-RE - Aktivität wurde durch Dual - Luciferase - Reporterassay gemessen. (C) Expression des NFKB - Zielgene, ICAM1, CCL2 und TNF wurde durch RT-qPCR gemessen. Drug inhibitorische Aktivität wird als% der TNF & alpha; allein aufgetragen. Daten sind als Mittelwert ± SEM dargestellt. Diese Zahl wurde von Referenz 15 modifiziert. Bitte klicken Sie hier , um eine größere Version dieses figu anzuzeigenRe.

Figur 2
Abbildung 2: GTCpFE hemmt die mammosphere Bildung und die CD44 + CD24 - Immunophänotyp in Brustkrebs - Zellen. (A) Mammosphere (MS) Bildung von MDA-MB-231 - Zellen wurde nach der Behandlung gemessen mit unterschiedlichen Konzentrationen von GTCpFE. Die Quantifizierung der MS Wachstum (links) und repräsentative Bilder MS bei 20facher (rechts) gezeigt. Die Wirkung von GTCpFE als% Fahrzeugkontrolle aufgetragen. (B) Die CD44 + CD24 - Population wurde durch FACS - Analyse von MDA-MB-231 - Zellen mit 50 uM GTCpFE für 72 Stunden behandelt wurde. Die Quantifizierung der einzelnen Bevölkerungs Prozentsatz (links) und repräsentative Streudiagramme von FACS (rechts) gezeigt. Daten sind als Mittelwert ± SEM und statistische Analyse der 2-Wege-ANOVA folg präsentiertvon Tukey Nachtest geschuldet. *** P <0,001. Diese Zahl wurde von Referenz 15 modifiziert.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
RPMI 1640 Red Medium Life Technologies  11875-093 Warm up to 37 °C before use
IMEM Corning 10-024-CV Warm up to 37 °C before use
DMEM / F12 Medium ThermoFisher 21041-025 Warm up to 37 °C before use
MEM NEAA 10 mM 100x Life Technologies  11140
Penicillin Streptomycin Life Technologies  15140-122
L-Glutamine 100x Life Technologies  25030-081
Insulin Sigma-Aldrich I-1882
Fetal Bovine Serum  Atlanta Biologicals S11150
Trypsin 2.5% 10x Invitrogen 15090046
Methyl Cellulose Sigma  M0262
B27 Supplement 50x Gibco 17504-044
EGF Gibco PHG0311L
NFκB-RE Luciferase Construct  Clontech  pGL4.32
Renilla Luciferase Construct  Promega pGL4.70
Lipofectamine 2000 ThermoFisher 11668-019
Dual-Luciferase Reporter Assay  Promega 120000032
NanoDrop Spectrophotometer ThermoFisher
Eppendorf Mastercycler  Eppendorf
StepOne Real Time PCR System Thermo Scientific
Eclipse Microscope Nikon
CyAn ADP Analyzer  Beckman Coulter
QCapture Software QImaging
Summit Software Beckman Coulter
GraphPad Software Prism
TRIzol ThermoFisher 15596-018
M-MLV Reverse Transcriptase Invitrogen 28025-013
100 mM dNTP Set Invitrogen 10297-018
Random Hexamers  Invitrogen 48190-011
Fast SYBR Green Master Mix ThermoFisher 4385612
Costar 96W, ultra low attachment  Corning 3474
HBSS, 1x ThermoFisher 14025134
CD44-APC conjugated antibody  BD Pharmingen 560990 Store at 4 °C, protect from light
CD24-PE antibody BD Pharmingen 560991 Store at 4 °C, protect from light
Recombinant Human TNFα Fisher 210TA100 
CCL2 Primer Forward Sequence AGAATCACCAGCAGCAAGTGTCC
CCL2 Primer Reverse Sequence TCCTGAACCCACTTCTGCTTGG
ICAM1 Primer Reverse Sequence TGACGAAGCCAGAGGTCTCAG
ICAM1 Primer Forward Sequence AGCGTCACCTTGGCTCTAGG
TNF Primer Forward Sequence AAGGGTGACCGACTCAGCG
TNF Primer Reverse Sequence ATCCCAAAGTAGACCTGCCCA
36B4 Primer Forward Sequence GTGTTCGACAATGGCAGCAT
36B4 Primer Reverse Sequence GACACCCTCCAGGAAGCGA
Sodium Hydroxide Sigma-Aldrich S5881-500G
4-Hydroxybenzyl Alcohol Sigma-Aldrich 20806-10G
O-Acetylsalicyloyl Chloride Sigma-Aldrich 165190-5G
Phosphorous Pentoxide Sigma-Aldrich 79610-100G
Ethyl Fumaroyl Chloride Sigma-Aldrich 669695-1G
Sodium Sulfate Sigma-Aldrich 246980-500G
4-Dimethylaminopyridine Sigma-Aldrich 714844-100ML 0.5 M in tetrahydrofuran
Triethylamine Sigma-Aldrich T0886-100ML
Toluene Sigma-Aldrich 244511-100ML
Ethyl Acetate Sigma-Aldrich 270989-100ML
Tetrahydrofuran Sigma-Aldrich 401757-2L
400 MHz FT NMR spectrometer  See Bruker’s Avance User’s Manual, version 000822 for details

DOWNLOAD MATERIALS LIST

References

  1. Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, 646-674 (2011).
  2. Cuzick, J., et al. Aspirin and non-steroidal anti-inflammatory drugs for cancer prevention: an international consensus statement. Lancet Oncol. 10, 501-507 (2009).
  3. Terry, M. B., et al. Association of frequency and duration of aspirin use and hormone receptor status with breast cancer risk. JAMA. 291, 2433-2440 (2004).
  4. Wang, D., Dubois, R. N. Cyclooxygenase-2: a potential target in breast cancer. Semin Oncol. 31, 64-73 (2004).
  5. Howe, L. R. Inflammation and breast cancer. Cyclooxygenase/prostaglandin signaling and breast cancer. Breast Cancer Res. 9. 9, 210 (2007).
  6. Kopp, E., Ghosh, S. Inhibition of NF-kappa B by sodium salicylate and aspirin. Science. 265, 956-959 (1994).
  7. Yin, M. J., Yamamoto, Y., Gaynor, R. B. The anti-inflammatory agents aspirin and salicylate inhibit the activity of I(kappa)B kinase-beta. Nature. 396, 77-80 (1998).
  8. Pierce, J. W., Read, M. A., Ding, H., Luscinskas, F. W., Collins, T. Salicylates inhibit I kappa B-alpha phosphorylation, endothelial-leukocyte adhesion molecule expression, and neutrophil transmigration. J Immunol. 156, 3961-3969 (1996).
  9. Frasor, J., El-Shennawy, L., Stender, J. D., Kastrati, I. NFkappaB affects estrogen receptor expression and activity in breast cancer through multiple mechanisms. Mol Cell Endocrinol. 418, 235-239 (2014).
  10. Perkins, N. D. The diverse and complex roles of NF-kappaB subunits in cancer. Nat Rev Cancer. 12, 121-132 (2012).
  11. DiDonato, J. A., Mercurio, F., Karin, M. NF-kappaB and the link between inflammation and cancer. Immunol Rev. 246, 379-400 (2012).
  12. Scarpignato, C., Hunt, R. H. Nonsteroidal antiinflammatory drug-related injury to the gastrointestinal tract: clinical picture, pathogenesis, and prevention. Gastroenterol Clin North Am. 39, 433-464 (2010).
  13. Sostres, C., Gargallo, C. J. Gastrointestinal lesions and complications of low-dose aspirin in the gastrointestinal tract. Best Pract Res Clin Gastroenterol. 26, 141-151 (2012).
  14. Kastrati, I., et al. Dimethyl Fumarate Inhibits the Nuclear Factor kappaB Pathway in Breast Cancer Cells by Covalent Modification of p65 Protein. J Biol Chem. 291, 3639-3647 (2016).
  15. Kastrati, I., et al. A novel aspirin prodrug inhibits NFkappaB activity and breast cancer stem cell properties. BMC Cancer. 15, 845 (2015).
  16. Cao, Y., Luo, J. L., Karin, M. IkappaB kinase alpha kinase activity is required for self-renewal of ErbB2/Her2-transformed mammary tumor-initiating cells. Proc Natl Acad Sci U S A. 104, 15852-15857 (2007).
  17. Liu, M., et al. The canonical NF-kappaB pathway governs mammary tumorigenesis in transgenic mice and tumor stem cell expansion. Cancer Res. 70, 10464-10473 (2010).
  18. Korkaya, H., Liu, S., Wicha, M. S. Regulation of cancer stem cells by cytokine networks: attacking cancer's inflammatory roots. Clin Cancer Res. 17, 6125-6129 (2011).
  19. Hinohara, K., et al. ErbB receptor tyrosine kinase/NF-kappaB signaling controls mammosphere formation in human breast cancer. Proc Natl Acad Sci U S A. 109, 6584-6589 (2012).
  20. Kendellen, M. F., Bradford, J. W., Lawrence, C. L., Clark, K. S., Baldwin, A. S. Canonical and non-canonical NF-kappaB signaling promotes breast cancer tumor-initiating cells. Oncogene. 33, 1297-1305 (2014).
  21. Yamamoto, M., et al. NF-kappaB non-cell-autonomously regulates cancer stem cell populations in the basal-like breast cancer subtype. Nat Commun. 4, 2299 (2013).
  22. Rio, D. C., Ares, M., Hannon, G. J., Nilsen, T. W. Purification of RNA using TRIzol (TRI reagent). Cold Spring Harb Protoc. (2010).
  23. Frasor, J., et al. Positive cross-talk between estrogen receptor and NF-kappaB in breast cancer. Cancer Res. 69, 8918-8925 (2009).
  24. Al-Hajj, M., Wicha, M. S., Benito-Hernandez, A., Morrison, S. J., Clarke, M. F. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A. 100, 3983-3988 (2003).
  25. Vandermeeren, M., et al. Dimethylfumarate is an inhibitor of cytokine-induced nuclear translocation of NF-kappa B1, but not RelA in normal human dermal fibroblast cells. J Invest Dermatol. 116, 124-130 (2001).
  26. Loewe, R., et al. Dimethylfumarate inhibits TNF-induced nuclear entry of NF-kappa B/p65 in human endothelial cells. J Immunol. 168, 4781-4787 (2002).
  27. Seidel, P., et al. Dimethylfumarate inhibits NF-{kappa}B function at multiple levels to limit airway smooth muscle cell cytokine secretion. Am J Physiol Lung Cell Mol Physiol. 297, L326-L339 (2009).
  28. Wilms, H., et al. Dimethylfumarate inhibits microglial and astrocytic inflammation by suppressing the synthesis of nitric oxide, IL-1beta, TNF-alpha and IL-6 in an in-vitro model of brain inflammation. J Neuroinflammation. 7, 30 (2010).
  29. Peng, H., et al. Dimethyl fumarate inhibits dendritic cell maturation via nuclear factor kappaB (NF-kappaB) and extracellular signal-regulated kinase 1 and 2 (ERK1/2) and mitogen stress-activated kinase 1 (MSK1) signaling. J Biol Chem. 287, 28017-28026 (2012).
  30. Li, H. J., Reinhardt, F., Herschman, H. R., Weinberg, R. A. Cancer-stimulated mesenchymal stem cells create a carcinoma stem cell niche via prostaglandin E2 signaling. Cancer Discov. 2, 840-855 (2012).
  31. Li, X., et al. Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy. J Natl Cancer Inst. 100, 672-679 (2008).
  32. Diehn, M., et al. Association of reactive oxygen species levels and radioresistance in cancer stem cells. Nature. 458, 780-783 (2009).
  33. Hollier, B. G., Evans, K., Mani, S. A. The epithelial-to-mesenchymal transition and cancer stem cells: a coalition against cancer therapies. J Mammary Gland Biol Neoplasia. 14, 29-43 (2009).
  34. Velasco-Velazquez, M. A., Popov, V. M., Lisanti, M. P., Pestell, R. G. The role of breast cancer stem cells in metastasis and therapeutic implications. Am J Pathol. 179, 2-11 (2011).
  35. Dontu, G., et al. In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells. Genes Dev. 17, 1253-1270 (2003).
  36. Charafe-Jauffret, E., et al. Cancer stem cells in breast: current opinion and future challenges. Pathobiology. 75, 75-84 (2008).
  37. Clayton, H., Titley, I., Vivanco, M. Growth and differentiation of progenitor/stem cells derived from the human mammary gland. Exp Cell Res. 297, 444-460 (2004).
  38. Ginestier, C., et al. ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome. Cell Stem Cell. 1, 555-567 (2007).
  39. Rosen, J. M., Jordan, C. T. The increasing complexity of the cancer stem cell paradigm. Science. 324, 1670-1673 (2009).
  40. Visvader, J. E., Lindeman, G. J. Cancer stem cells in solid tumours: accumulating evidence and unresolved questions. Nat Rev Cancer. 8, 755-768 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics