Il

Published 2/13/2017
0 Comments
  CITE THIS  SHARE 
Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

Cite this Article

Copy Citation

Udden, S. M., Waliullah, S., Harris, M., Zaki, H. The Ex Vivo Colon Organ Culture and Its Use in Antimicrobial Host Defense Studies. J. Vis. Exp. (120), e55347, doi:10.3791/55347 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

L'intestino mostra un'architettura di strutture cripta ripetitive costituite da diversi tipi di cellule epiteliali, propia lamina contenente cellule immunitarie, e stroma. Tutte queste cellule eterogenei contribuiscono a omeostasi intestinale e partecipare a difesa ospite antimicrobica. Pertanto, l'identificazione di un modello di surrogato per studiare la risposta immunitaria e attività antimicrobica dell'intestino in un ambiente in vitro è estremamente impegnativo. Gli studi in vitro utilizzando linee cellulari epiteliali intestinali immortalato o cripta addirittura primario organoide cultura non rappresentano l'esatta fisiologia intestinale normale e del suo microambiente. Qui, si discute un metodo di tessuto del colon coltura del mouse in un piatto di cultura e di come questo organo ex vivo sistema di coltura può essere implementato in studi relativi a risposte di difesa antimicrobici ospitanti. In esperimenti di rappresentanza, abbiamo dimostrato che i due punti nella cultura d'organo esprimono peptidi antimicrobici in response per esogena IL-1β e IL-18. Inoltre, le molecole effettrici antimicrobiche prodotte dai tessuti del colon nella cultura organo uccidono efficacemente Escherichia coli in vitro. Questo approccio, pertanto, può essere utilizzato per analizzare il ruolo dei modelli molecolari di patogeni e pericolo associati ed i loro recettori cellulari nella regolazione intestinale risposte immunitarie innate e risposte di difesa antimicrobiche dell'ospite.

Introduction

L'intestino rappresenta un sistema dinamico che agisce come una barriera per i microrganismi commensali, combatte contro patogeni, e regola la composizione microbica 1. Le cellule epiteliali intestinali, composto da enterociti, cellule caliciformi, le cellule e le cellule Paneth enteroendocrine, sono le principali popolazioni di cellule che forniscono accoglienza risposte di difesa contro microbiota intestinale. Le cellule caliciformi producono mucine che creano una zona smilitarizzata sulla parte superiore dello strato epiteliale 2. Le cellule Paneth e enterociti producono peptidi antimicrobici, citochine, e specie di ossigeno e di azoto reattivo che costituiscono antimicrobici risposte di difesa dell'ospite e contribuiscano a dare forma alla composizione microbica intestinale 3, 4. In aggiunta alle cellule epiteliali, le cellule immunitarie compresi macrofagi, cellule dendritiche, neutrofili, cellule natural killer, linfociti e inna cellule linfoidi te nella lamina propria e sottomucosa giocano un ruolo critico nella intestinali risposte di difesa ospite antimicrobici da citochine, chemochine, che producono e altri mediatori 5 - 7. Per comprendere come il sistema immunitario mucosale regola microflora e fornisce protezione contro l'infezione microbica, è importante considerare la complessa interazione delle popolazioni cellulari eterogenee dell'intestino. Tuttavia, un modello in vitro che comprende tutte le caratteristiche dell'intestino non è disponibile. Pertanto, gli studi molecolari sulla interazione ospite-patogeno a livello intestinale sono altamente impegnativo.

Nel corso degli ultimi anni, diversi sistemi modello che imitano gli aspetti della mucosa intestinale sono stati sviluppati per indagare i processi fisiopatologici coinvolti nelle malattie infiammatorie croniche intestinali (IBD) e altri disturbi gastrointestinali 8 -= "xref"> 14. linee di cellule epiteliali intestinali immortalati sono spesso usati per studiare le risposte specifiche delle cellule epiteliali. Tuttavia, a causa di espressione genica differenziale e funzione in cellule immortalizzate, i dati ottenuti dal usando tali cellule non coincidono spesso con quelli osservati negli studi in vivo. Cripta intestinale organoide cultura è emerso recentemente come un potenziale strumento per valutare la risposta del epitelio intestinale a stimoli diversi 13. In questo sistema, le cellule staminali cripta sono autorizzati a crescere e sviluppare una struttura organoide 3D. Mentre il sistema di coltura organoide è molto utile per studiare molti aspetti dell'epitelio intestinale, che non imita la complessa interazione di cellule immuni, cellule epiteliali e prodotti microbici. La cultura ex vivo del tessuto intestinale offre una migliore rappresentazione in vivo ospitanti risposte di difesa. In questo metodo, una parte dell'intestino è coltivato in un piatto bianco coltura cellulareh mezzi appropriati che offrano i diversi tipi di popolazioni cellulari nell'intestino di essere metabolicamente attivi per almeno 48 ore. Così, un ex vivo coltura dell'organo può essere usato per misurare l'espressione di geni antimicrobici e l'host risposte di difesa dell'intestino ad uno stimolo particolare.

Gli investigatori hanno utilizzato il sistema d'organo ex vivo della cultura per studiare ospitanti risposte di difesa contro l'infezione microbica nell'intestino 15-21. Recentemente abbiamo adottato il sistema di coltura di organi per studiare il ruolo del inflammasome nelle risposte di difesa antimicrobici ospitanti in due punti di topo 22. Il inflammasome è una piattaforma molecolare per l'attivazione della caspasi-1, che è richiesto per la produzione di IL-1β maturato e IL-18. Abbiamo dimostrato che IL-1β e IL-18 inducono peptidi antimicrobici che uccidono efficacemente pathobionts commensali come E. coli coli onere E. in due punti del mouse inflammasome-difettoso 22. Questo sistema può quindi essere utilizzato per studiare il ruolo dei recettori pattern recognition (PRR) e di altre molecole immunitarie innate in intestinali risposte di difesa ospite antimicrobici nonché patogenesi dei disturbi intestinali come la malattia infiammatoria intestinale (IBD) e il cancro del colon-retto (CRC). Ci sono più di 200 geni di suscettibilità IBD, e mutazioni in molti di questi geni sono associati con alterata composizione microbica nell'intestino. E 'di grande importanza clinica per determinare il meccanismo preciso attraverso il quale i geni IBD-suscettibilità regolano flora intestinale. L'obiettivo generale di questo metodo è quello di introdurre un protocollo di base di ex vivo della cultura d'organo del colon e dimostrare come questo metodo di coltura può essere usato per studiare antimicrobici risposte di difesa ospite dell 'intestino.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Tutti gli esperimenti descritti qui sono stati effettuati utilizzando 6-8 settimane di età topi maschi wild-type (C57BL6 / J) mantenuto in libera una struttura specifica patogeno (SPF) presso il Centro risorse animali (ARC), UT Southwestern Medical Center. Tutti gli studi sono stati approvati dalla cura e l'uso degli animali Comitato Istituzionale (IACUC) e sono state condotte in conformità con le linee guida IACUC e il National Institutes of Health Guide per la cura e l'uso di animali da laboratorio.

1. Raccolta e preparazione del colon

  1. Euthanize topi con CO 2 asfissia seguita da dislocazione cervicale.
  2. Spray topi con il 70% di etanolo e il pin arti per una scheda di pinning mantenendo il lato del mouse dorsale verso il basso sul tabellone.
  3. Utilizzando forbici e pinze pre-sterilizzati dissezione, fare una incisione linea mediana nel peritoneo dell'addome. Aprire l'addome piegando il peritoneo con una pinza.
  4. Rimuovere l'intestino dalla cavità addominale wiesimo dissezione pinze e forbici. Separare il colon dal piccolo intestino tagliando al fondo cieco e l'altra estremità al retto.
  5. Posizionare i due punti in una capsula di Petri sterile contenente ghiacciata PBS. Lavare il contenuto del lume del colon con PBS freddo utilizzando una siringa da 20 ml in possesso di un ago G 20 o un ago sonda gastrica fino feci nel lume del colon è completamente rimosso.
  6. Tagliare i due punti con le forbici in senso longitudinale. Lavare il colon agitando vigorosamente in PBS ghiacciato in una piastra di Petri sterile.
  7. Tagliare il tessuto del colon in pezzi lunghi circa 1 cm con un bisturi sterile o forbici.
  8. Registrare il peso dei pezzi colon.
    NOTA: tutti i passaggi della sezione 1 possono essere eseguite sia all'interno che all'esterno di una cappa di sicurezza biologica. Una volta che i due punti sono pronti per la cultura, tutti i passaggi devono essere eseguiti all'interno di una cappa di sicurezza biologica per mantenere la sterilità.

2. Colon Orguna cultura

  1. Inserire un filtro cella (100 micron) su una piastra di coltura cellulare 6 pozzetti. Trasferire tutti i pezzi colon raccolti da un topo nel filtro cella.
  2. Aggiungere 5 ml di terreno DMEM / F12 contenente il 5% di FBS, penicillina-streptomicina (1x), e Gentamicina (20 mg / ml). coprire completamente i pezzi del colon con i media.
  3. Incubare per 2 ore a 37 ° C in un incubatore con 5% di CO 2 e dell'aria 95%.
  4. Sollevare il filtro delle cellule e aspirare i media.
  5. Posizionare il filtro delle cellule di nuovo sul bene e aggiungere 5 ml di mezzi freschi senza antibiotici. Sollevare il filtro delle cellule e aspirare i media.
  6. Ripetere la stessa operazione di lavaggio (passo 2,5) altre due volte (3x totale) per rimuovere tutti i residui antibiotici.
  7. Trasferire i pezzi colon da una singola colino cellula in un singolo pozzetto di una piastra di coltura cellulare sterile 12 pozzetti.
  8. Aggiungere DMEM medio / F12 contenente 5% FBS (senza antibiotici). Regolare il volume del mezzo con il weight dei pezzi colon, ad esempio, 1 medio ml per 100 mg di tessuto. Incubare per 12 ore a 37 ° C in un incubatore iniezione 5% di CO 2 e dell'aria 95%.
  9. Raccogliere il supernatante della coltura in una provetta sterile da 1,5 ml.
  10. Centrifugare a 12.000 xga 4 ° C per 5 min. Separare il surnatante in una nuova provetta da 1,5 ml per uso nei batteri uccidendo dosaggio e / o altri saggi immunitari. Il supernatante può essere conservato a -80 ° C fino alla dosaggio.
  11. Raccogliere i pezzi del colon in un tubo per l'isolamento di RNA

3. E. coli Analisi Uccidere

  1. Seminare E. coli in 5 mL Luria-Bertani (LB) brodo in una provetta da 15 ml e incubare a 37 ° C con agitazione a 200 rpm durante la notte. Mantenere il tappo della provetta leggermente allentato.
  2. Centrifugare la provetta di coltura batterica a 1.200 xg per 10 minuti a 4 ° C. Rimuovere il surnatante e risospendere il pellet batterico in 5 ml di PBS ghiacciato.
  3. Trasferire 1 ml della bactsospensione erial nella cuvetta e misurare OD a 600 nm. Utilizzare PBS come bianco.
  4. Calcolare l'unità formanti colonia (cfu) utilizzando una curva standard prestabilito. Qui, si supponga che 1 OD = 2 x 10 9 CFU / ml (circa).
  5. Diluire la sospensione batterica per rendere la sospensione madre 1 x 10 5 CFU / ml.
  6. Trasferire il surnatante cultura colon organo (500 microlitri / pozzetto) raccolte nella sezione 2.10 nei pozzetti duplicati di una piastra di coltura cellulare di 24 pozzetti.
  7. Aggiungere 10 ml cultura coli E. (1.000 ufc) in un pozzetto contenente 500 microlitri colon organo cultura surnatante. Lasciare l'altra e senza alcun coli inoculazione E. per confermare che la cultura surnatante colon organo non contiene alcuna contaminazione.
  8. Incubare lo stesso numero di batteri (1000 cfu) nei mezzi di coltura (DMEM / F12 più 5% FBS) senza antibiotici come controllo.
  9. Incubare a 37 ° C per 1 h.
  10. Mettere 50 ml di ogni campione drop-wiSE su piastre di agar MacConkey. Incubare le piastre MacConkey agar a 37 ° C durante la notte.
  11. Contare il numero di colonie e calcolare la ufc / ml.

4. L'effetto di fattori estrinseci ed intrinseci sul colon antimicrobici Host Difesa Risposte

NOTA: Il saggio uccisione antimicrobico come descritto qui può essere adottato per esaminare l'effetto dei modelli patogeni associati molecolari (PAMPs) e citochine sull'attività battericida della cultura d'organo surnatante. Un esempio di tale esperimento utilizzando IL-1β e IL-18 è descritta di seguito.

  1. Raccogliere i due punti di topi come descritto nella Sezione 1.
  2. Posizionare i due punti su un tovagliolo di carta sterile. Tagliare il colon longitudinalmente in tre parti con le forbici (Figura 2).
  3. Lavare ogni parte del colon in ghiaccio freddo PBS come descritto nella Sezione 1.
  4. Tagliare ogni parte del colon in piccoli pezzi e pesare in modo asettico. Trasferire i pezzi di ogni partedel colon in tre filtri di cellule separate (100 micron) disposte su tre pozzetti di una piastra di coltura cellulare 6 pozzetti (Figura 2).
  5. Aggiungere 2 ml di DMEM medio / F12 contenente il 5% di FBS, penicillina-streptomicina (1x), e Gentamicina (20 mg / ml).
  6. Incubare per 2 ore a 37 ° C in un incubatore iniezione 5% di CO 2 e dell'aria 95%.
  7. Lavare i pezzi del colon, come descritto nella 2,4-2,6. Trasferire i pezzi colon di un singolo colino cellula in un singolo pozzetto di una piastra di coltura cellulare sterile 12 pozzetti. I tre pozzetti contenenti tre parti del colon da un singolo mouse dovrebbero essere designati come greggia, IL-1β e IL-18 (Figura 2).
  8. Aggiungere DMEM medio / F12 contenente 5% FBS (senza antibiotici). Regolare il volume del mezzo con il peso dei pezzi colon, ad esempio, 1 ml di mezzo per 100 mg di tessuto.
  9. Stimolare la cultura organo colon con IL-1β (20 ng / ml) o IL-18 (20 ng / ml) per 12 h. I due punti non trattati cultura organo serve come controllo.
  10. Dopo 12 h di incubazione a 37 ° C in un incubatore iniezione 5% di CO 2 e il 95% di aria, raccogliere il supernatante della coltura in una sterile 1,5 mL provetta.
  11. Trasferire 500 microlitri cultura surnatante in pozzetti duplicati di un 24-pozzetti.
  12. Seminare E. coli (1.000 CFU) nel colon organo cultura surnatante come descritto nella Sezione 3. Per ogni condizione, inoculare E. coli in un singolo pozzo. L'altro pozzetto contenente stesso organo cultura surnatante senza E. coli servirà come controllo per la contaminazione batterica.
  13. Incubare la stessa quantità di batteri in terreni di coltura senza antibiotici come controllo.
  14. Incubare a 37 ° C per 1 h.
  15. Mettere 50 ml di ogni campione goccia a goccia su piastre di agar MacConkey. Incubare le piastre MacConkey agar per una notte a 37 ° C.
  16. Contare il numero di colonie e calcolare la ufc / ml (Figura 4).
e_title "> 5. Misurazione della espressione dei geni antimicrobici

  1. Dopo incubazione per una notte (12 ore) di cultura d'organo del colon, come descritto nelle sezioni 2 e 4, lavare i pezzi del colon con 2 ml ghiacciata PBS (2x).
  2. Raccogliere i pezzi del colon in una provetta libera tappo a vite 2 ml RNasi / DNasi. Mettere i tubi in ghiaccio.
  3. Aggiungere 1 ml di reagente Trizol commerciale e lisi perline matrice nel tubo.
  4. Lyse il tessuto utilizzando un omogeneizzatore tessuto automatizzato.
  5. Raccogliere il lisato di tessuto in una nuova provetta.
  6. Isolare RNA utilizzando il protocollo standard.
  7. Misurare la concentrazione di RNA.
  8. Diluire RNA opportunamente con acqua deionizzata e utilizzando 500 ng di RNA per sintetizzare cDNA.
  9. Utilizzare il cDNA per real-time RT-PCR dei geni mirati antimicrobici, citochine, chemochine, e altri geni di interesse.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Un quadro rappresentativo di due punti nella cultura d'organo è mostrato in Figura 1. I pezzi del colon nella cultura rimangono metabolicamente e fisiologicamente attiva. Essi rispondono in modo efficace agli stimoli esogeni aggiunti al mezzo di coltura. Un flusso di lavoro schematica della preparazione del tessuto colon per coltura ex vivo e stimolazione con stimoli esogeni, per esempio IL-1β e IL-18, è mostrata in figura 2. I dati rappresentativi in figura 3 mostrano che i due punti nella cultura d'organo esprimono peptidi antimicrobici come il β-defensine 2 (BD2), Reg3γ, S100A8, S100A9 e iNOS in risposta a IL-1β e IL-18.

I mediatori rilasciati dagli impianti colon presentano un effetto di uccisione antimicrobico come dimostrato dalla significativamente ridotta crescita di E. coli incubate con supernatante di coltura organo ( 4B). Tale attività E. coli uccidere è ulteriormente potenziato dalla stimolazione di IL-1β e IL-18 (Figure 4A e 4B). Colon sovranatanti organo incubate senza E. coli non mostrano alcuna crescita batterica seguente cultura su agar MacConkey (figure 4C e 4D). Questi risultati suggeriscono inoltre che la inflammasome svolge un ruolo importante nella difesa dell'ospite intestinale antimicrobica.

Nel complesso, i dati qui presentati suggeriscono che ex vivo la cultura d'organo del colon è una tecnica molto utile per studiare le risposte immunitarie intestinali antimicrobiche in vitro.

GAPDH_F TGGCAAAGTGGAGATTGTTGCC
GAPDH_R AAGATGGTGATGGGCTTCCCsol
β-defensine 2 (BD2) _F TGACCACTGCCACACCAATG
β-defensine 2 (BD2) _R CCTGGCAGAAGGAGGACAAA
Reg3γ_F CAAGGTGAAGTTGCCAAGAA
Reg3γ_R CCTCTGTTGGGTTCATAGCC
S100a8_F TGTCCTCAGTTTGTGCAGAATATAAA
S100a8_R TCACCATCGCAAGGAACTCC
S100a9_F GGTGGAAGCACAGTTGGCA
S100a9_R GTGTCCAGGTCCTCCATGATG
iNOS_F TGTGACACACAGCGCTACAACA
iNOS_R GAAACTATGGAGCACAGCCACAT

Tabella 1: Elenco di primer del mouse per real-time PCR.


Figura 1: quadro rappresentativo di pezzi del mouse del colon nella cultura. (A) Incubazione di pezzi colon su un filtro cella (100 micron) posto su una piastra da 6 pozzetti. pezzi Colon sono immersi in 2 terreni di coltura ml Arricchito con antibiotici. (B) Dopo 2 ore di incubazione, pezzi del colon vengono trasferiti nel pozzo di una nuova piastra di coltura cellulare di 12 pozzetti contenenti medio-antibiotici libere. Clicca qui per vedere una versione più grande di questa figura.

figura 2
Figura 2: Rappresentazione schematica delle fasi di preparazione dei tessuti del colon e ex vivo stimolazione con IL-1β e IL-18. I due punti da un mouse è Longi tudinally sezionato in tre parti. Ogni parte è stata tagliata in piccoli pezzi e pesato. I pezzi colon da ogni sezione del colon sono trasferiti su filtri cellulari immessi in pozzetti di una piastra da 6 pozzetti contenenti 2 ml DMEM medio / F12 + 5% FBS e antibiotici. Dopo 2 h di incubazione, pezzi colon da una singola cella di setaccio vengono trasferiti in un singolo pozzetto di una piastra di coltura cellulare 12 pozzetti. DMEM / F12 più 5% FBS (antibiotici) viene aggiunto in ciascun pozzetto e il volume del mezzo viene regolata in base al peso del tessuto (1 mL supporti per 100 tessuto mg). tessuti del colon sono stimolate con IL-1β (20 ng / ml) e IL-18 (20 ng / ml) per 12 h. Sovranatanti vengono centrifugati e utilizzati per E. coli uccidere test e / o di altri test del sistema immunitario. I tessuti del colon sono raccolti in reagente tripsina commerciale per l'isolamento di RNA e le successive analisi di espressione genica antimicrobico di real-time PCR..jpg "target =" _ blank "> Clicca qui per vedere una versione più grande di questa figura.

Figura 3
Figura 3: i tessuti del colon mouse esprimono citochine e peptidi antimicrobici in risposta a IL-1β o IL-18 durante ex vivo della cultura. Colon colture d'organo sono state stimolate con IL-1β (20 ng / ml) o IL-18 (20 ng / ml) per 12 h. L'espressione di BD2, Reg3γ, S100A8, S100A9 e iNOS è stata misurata mediante real-time RT-PCR (Tabella 1). I dati rappresentano mezzi ± SD; * P <0.05, ** p <0.01. Clicca qui per vedere una versione più grande di questa figura.

Figura 4
Figura 4: Surnatante di topo culto colon organoure mostra un'attività battericida. Pezzi Colon state coltivate ex vivo in presenza o in assenza di IL-1β (20 ng / ml) o IL-18 (20 ng / ml) per 12 h. 500 ml di sovranatanti sono stati incubati con E. coli (1,000 cfu) per 1 ora a 37 ° C. Colon organo coltura supernatante senza E. coli è stato anche incubato come controllo. Dopo 1 h di incubazione, 50 microlitri di ciascun campione è stato posto a gocce su piastre di agar MacConkey ed incubato a 37 ° C durante la notte. (A) Immagine di E. coli colonie su agar MacConkey che mostrano attività antimicrobica della cultura del colon organo. (B) di E. coli conteggio che mostra l'uccisione efficienza di IL-1β- e IL-18-trattati surnatante cultura organo colon. (C) Immagine di MacConkey piastra di agar mostrando alcuna crescita batterica nel colon cultura organo incubate senza E. coli. (D) le colonie non E. coli sono stati identificati nel colon organo culture incubato senza E. coli, che indica l'assenza di batteri contaminanti nel campione. I dati rappresentano mezzi ± SD; ** P <0.01, *** p <0.001. Clicca qui per vedere una versione più grande di questa figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Le cellule epiteliali intestinali sono molto sensibili in termini di requisiti di crescita e quindi difficile da coltura. Le cellule epiteliali isolate mediante trattamento EDTA non sopravvivono in mezzi di coltura cellulare convenzionali come DMEM 8. Pertanto, studi di interazione ospite-patogeno utilizzando cripta isolata o cellule epiteliali primarie sono molto impegnativo. Recentemente, Sato et al. descritto un sistema di coltura organoide cripta che è molto promettente e utile per gli studi relativi alla fisiopatologia intestinale 13. Mentre organoidi rappresentano molte caratteristiche della cripta intestinale, ci sono preoccupazioni sul fatto che le risposte immunitarie delle cellule organoide, che vengono coltivate in un ambiente sterile, ricapitolano le risposte delle cellule epiteliali intestinali in vivo. Le tecniche precise richieste per l'isolamento e la coltura di cellule staminali epiteliali e requisito di reagenti costosi per la cultura del organoidi impediscono malaboratori di NY da approfittando di questo sistema. Mentre l'uso di ex cultura organo vivo non è un'alternativa alla cultura organoide, questo sistema offre un metodo semplice ed economico per studiare le risposte antimicrobiche di epitelio intestinale.

Il principale vantaggio di questa tecnica è che l'architettura del tessuto dell'intestino viene mantenuto mentre coltura nei piatti. Abbiamo osservato che i tessuti del colon sono fisiologicamente attiva per almeno 24 ore dopo la loro cultura. Durante la coltura del colon, le cellule epiteliali del colon rispondono agli stimoli esogeni come misurato da espressione di citochine e peptidi antimicrobici. La vitalità delle cellule epiteliali del tessuto intatto può essere ulteriormente migliorata con l'aggiunta di fattori di crescita appropriati e inibitori della morte cellulare nel mezzo di coltura. Studi precedenti suggeriscono che il normale di organi tessuti del colon umano potrebbe essere mantenuta ex vivo per diversi giorni 8 sup>, 23, 24.

Il protocollo per la cultura ex vivo di topo organo del colon può avere molte applicazioni in studi relativi a risposte immunitarie antimicrobiche dell'epitelio intestinale. Gli agenti patogeni e le loro PAMPs sono riconosciuti da PRR, come recettori Toll-like (TLR) e recettori NOD-like (NLRs) presenti nelle cellule epiteliali e del sistema immunitario. espressione e la funzione di molti TLR e NLRs difettosa sono associate con la suscettibilità alle IBD, tumorigenesi del colon-retto, e le infezioni batteriche. Poiché linee cellulari epiteliali immortalizzate non rappresentano tutte le caratteristiche della nicchia intestinale, la vivo coltura ex colon organo è uno strumento sperimentale molto utile. Utilizzando questo sistema, possiamo esaminare l'effetto di varie PAMPs o stimoli sull'induzione di molecole effettrici antimicrobiche nelle cellule epiteliali intestinali. Nell'esperimento rappresentante, abbiamo dimostrato che le citochine piaceIL-1β e IL-18 grilletto l'espressione di peptidi antimicrobici (Figura 3). Mostriamo anche qui che i peptidi antimicrobici prodotte dal tessuto del colon può efficacemente uccidere E. coli (Figura 4). Queste tecniche possono essere applicate per testare l'influenza di lipopolisaccaride (LPS), peptidoglicano (PGN), muramyldipeptide (MDP), e altri PAMPs in antimicrobici risposte di difesa dell'ospite nell'intestino.

Abbiamo leggermente modificato il protocollo coltura colon organo come descritto in precedenza 12, 16, 20, 25. Abbiamo colto i due punti in due fasi. In un primo momento, abbiamo incubato il tessuto del colon in antibiotici contenenti mezzo per 2 ore. Abbiamo quindi rimosso gli antibiotici con ripetuti lavaggi dei pezzi punti seguiti da incubazione con antibiotici media liberi. Così, il supernatante della coltura ottenuta dalla coltura durante la notte delmostre colon solo l'effetto di peptidi antimicrobici secreti quando incubato con E. coli. Questo approccio può essere utilizzato per verificare l'effetto battericida del colon o intestino derivati ​​peptidi antimicrobici in batteri di interesse. Un adeguato supporto agar selettivo deve essere utilizzato per la cultura i batteri.

Come la maggior parte delle tecniche, ci sono limitazioni del sistema di coltura ex vivo organo. In primo luogo, a differenza di coltura cellulare o la cultura organoide, gli organi non crescono e proliferano e, pertanto, non possono essere ampliati. In secondo luogo, le cellule epiteliali intestinali sono molto sensibili e muoiono alquanto rapidamente senza ulteriori fattori di crescita e inibitori dell'apoptosi, che sono utilizzati per la cultura organoide cripta. In terzo luogo, la risposta immunitaria osservata dalla cultura organo è una risposta collettiva di diversi tipi di popolazioni cellulari. Pertanto, il ruolo di tipo singola cella nell'espressione dei geni antimicrobici e effettori non può essere valutata. additigonale, a differenza di linee cellulari e la cultura organoide, l'espressione di peptidi antimicrobici e di altre molecole effettrici nei due punti può variare da mouse per il mouse dello stesso background genetico.

In sintesi, descriviamo qui un semplice protocollo per la ex vivo cultura organo del colon che è molto utile per studiare le risposte immunitarie intestinali antimicrobiche. Questo approccio può essere utilizzato per testare il ruolo dei diversi geni immunitaria innata nell'espressione di peptidi antimicrobici coltivando due punti di genetica topi mutanti di interesse. Inoltre, questo protocollo può essere adattato per l'utilizzo in studi clinici per esaminare le risposte antimicrobiche intestinale di pazienti IBD conducendo cultura organo di campioni di biopsia del colon.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

Questo lavoro è stato sostenuto da un finanziamento di Crohn e Colite Foundation of America, (CCFA; 3711) la prevenzione del cancro e Research Institute del Texas (CPRIT; RP160169), e UT Southwestern Medical Center dati a MHZ

Materials

Name Company Catalog Number Comments
Advanced DMEM/ F12 Life Technologies 12634-010
Dulbecco's phosphate buffered saline, modified, w/o Calcium chloride & Magnesium chloride Sigma 5634
FBS, heat inactivated Sigma F4135
Penicillin-Streptomycin Life Technologies 15070063
Gentamicin solution Sigma G1272
Mouse IL-1b recombinan Reprokine RKP10749
Mouse IL-18 recombinant Reprokine RKP70380
TRIzol Reagent Thermo Fisher Scientific 15596018
Difco Luria-Bertani Broth  BD Bioscience 244620
BD Difco Dehydrated Culture Media: MacConkey Agar Fisher Scientific DF0075-17-1
NanoDrop 1000 Spectrophotometer Thermo Scientific Uded to measure RNA concentration
UV/Vis Spectrophotometer BECKMAN DU 530 Used to determine E. coli count
iScript RT Supermix, 100 rxns Bio-Rad 1708841
iTaq Univer SYBR Green Supermix  Bio-Rad 1725125 
Lysing Matrix S (1/8"), 2 ml Tube MP Biomedicals 116925500 Used to homgenize colon organ for RNA isolation
FastPrep-24 5G System Bio-Rad 116005500
100 mm x 15 mm Petri Dish Falcon 5687
Plate 6 well ps TC CS100, Cellstar, 6w, tc, F-bottom (Flat), w/lid, sterile Cellstar 5085
100 μm cell strainer Falcon 5698
Sorvall Legend Micro 21R Centrifuge Thermo Fisher Scientific
Sorvall ST40R Centrifuge Thermo Fisher Scientific
Forma Scientific orbital shaker Thermo Fisher Scientific

DOWNLOAD MATERIALS LIST

References

  1. Maloy, K. J., Powrie, F. Intestinal homeostasis and its breakdown in inflammatory bowel disease. Nature. 474, 298-306 (2011).
  2. Hooper, L. V., Macpherson, A. J. Immune adaptations that maintain homeostasis with the intestinal microbiota. Nat Rev Immunol. 10, 159-169 (2010).
  3. Vaishnava, S., Behrendt, C. L., Ismail, A. S., Eckmann, L., Hooper, L. V. Paneth cells directly sense gut commensals and maintain homeostasis at the intestinal host-microbial interface. Proc Natl Acad Sci U S A. 105, 20858-20863 (2008).
  4. Kamada, N., Chen, G. Y., Inohara, N., Nunez, G. Control of pathogens and pathobionts by the gut microbiota. Nat Immunol. 14, 685-690 (2013).
  5. Wu, H. J., Wu, E. The role of gut microbiota in immune homeostasis and autoimmunity. Gut Microbes. 3, 4-14 (2012).
  6. Zimmerman, N. P., Vongsa, R. A., Wendt, M. K., Dwinell, M. B. Chemokines and chemokine receptors in mucosal homeostasis at the intestinal epithelial barrier in inflammatory bowel disease. Inflamm Bowel Dis. 14, 1000-1011 (2008).
  7. Elliott, D. E., Siddique, S. S., Weinstock, J. V. Innate immunity in disease. Clin Gastroenterol Hepatol. 12, 749-755 (2014).
  8. Chopra, D. P., Dombkowski, A. A., Stemmer, P. M., Parker, G. C. Intestinal epithelial cells in vitro. Stem Cells Dev. 19, 131-142 (2010).
  9. Autrup, H. Explant culture of human colon. Methods Cell Biol. 21, 385-401 (1980).
  10. Qin, J., et al. A human gut microbial gene catalogue established by metagenomic sequencing. Nature. 464, 59-65 (2010).
  11. Wildenberg, M. E., vanden Brink, G. R. A major advance in ex vivo intestinal organ culture. Gut. 61, 961-962 (2012).
  12. Leushacke, M., Barker, N. Ex vivo culture of the intestinal epithelium: strategies and applications. Gut. 63, 1345-1354 (2014).
  13. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, 262-265 (2009).
  14. Tsilingiri, K., et al. Probiotic and postbiotic activity in health and disease: comparison on a novel polarised ex-vivo organ culture model. Gut. 61, 1007-1015 (2012).
  15. Haque, A., et al. Early interactions of Salmonella enterica serovar typhimurium with human small intestinal epithelial explants. Gut. 53, 1424-1430 (2004).
  16. Hicks, S., Candy, D. C., Phillips, A. D. Adhesion of enteroaggregative Escherichia coli to pediatric intestinal mucosa in vitro. Infect Immun. 64, 4751-4760 (1996).
  17. Knutton, S., Lloyd, D. R., Candy, D. C., McNeish, A. S. In vitro adhesion of enterotoxigenic Escherichia coli to human intestinal epithelial cells from mucosal biopsies. Infect Immun. 44, 514-518 (1984).
  18. Senior, P. V., Pritchett, C. J., Sunter, J. P., Appleton, D. R., Watson, A. J. Crypt regeneration in adult human colonic mucosa during prolonged organ culture. J Anat. 134, 459-469 (1982).
  19. Smollett, K., Shaw, R. K., Garmendia, J., Knutton, S., Frankel, G. Function and distribution of EspG2, a type III secretion system effector of enteropathogenic Escherichia coli. Microbes Infect. 8, 2220-2227 (2006).
  20. Bareiss, P. M., et al. Organotypical tissue cultures from adult murine colon as an in vitro model of intestinal mucosa. Histochem Cell Biol. 129, 795-804 (2008).
  21. Tsilingiri, K., Sonzogni, A., Caprioli, F., Rescigno, M. A novel method for the culture and polarized stimulation of human intestinal mucosa explants. J Vis Exp. e4368 (2013).
  22. Hu, S., et al. The DNA Sensor AIM2 Maintains Intestinal Homeostasis via Regulation of Epithelial Antimicrobial Host Defense. Cell Rep. 13, 1922-1936 (2015).
  23. Moorghen, M., Chapman, M., Appleton, D. R. An organ-culture method for human colorectal mucosa using serum-free medium. J Pathol. 180, 102-105 (1996).
  24. Dame, M. K., et al. Human colon tissue in organ culture: preservation of normal and neoplastic characteristics. In Vitro Cell Dev Biol Anim. 46, 114-122 (2010).
  25. Grant, A. J., Woodward, J., Maskell, D. J. Development of an ex vivo organ culture model using human gastro-intestinal tissue and Campylobacter jejuni. FEMS Microbiol Lett. 263, 240-243 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats