Visualiseren van angiogenese door Multiphoton microscopie In Vivo in genetisch gemodificeerde 3D-PLGA/nHAp steiger voor Calvarial kritische bot Defect reparatie

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Hier presenteren we een protocol om te visualiseren bloedvat vorming in vivo en in real-time in 3D steigers door multiphoton microscopie. Angiogenese in genetisch gemodificeerde steigers werd bestudeerd in een lymfkliertest calvarial kritische bot defect model. Meer nieuwe bloedvaten werden ontdekt in de behandelde groep dan in besturingselementen.

Cite this Article

Copy Citation | Download Citations

Li, J., Jahr, H., Zheng, W., Ren, P. G. Visualizing Angiogenesis by Multiphoton Microscopy In Vivo in Genetically Modified 3D-PLGA/nHAp Scaffold for Calvarial Critical Bone Defect Repair. J. Vis. Exp. (127), e55381, doi:10.3791/55381 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

De wederopbouw van kritisch formaat bot gebreken blijft een ernstig klinisch probleem vanwege slechte angiogenese binnen weefsel-engineered steigers tijdens reparatie, die leidt tot een gebrek aan voldoende bloedtoevoer en veroorzaakt necrose van de nieuwe weefsels. Snelle vascularisatie is een essentiële voorwaarde voor nieuwe weefsel overleving en integratie met bestaande weefsel van de gastheer. De DOVO generatie therapieën in de steigers is een van de belangrijkste stappen in het maken van bot regeneratie efficiënter, waardoor herstel van weefsel te groeien tot een steiger. Om dit probleem aan te pakken, wordt de genetische modificatie van een steiger biomaterial gebruikt voor het versnellen van de angiogenese en osteogenesis. Visualiseren en bijhouden in vivo is bloedvat vorming in real time en in driedimensionale (3D) steigers of nieuwe botweefsel echter nog steeds een belemmering voor weefselengineering van bot. Multiphoton microscopie (MPM) is een roman bio-imaging modaliteit die volumetrische gegevens uit biologische structuren in een hoge resolutie en minimaal-invasieve manier verwerven kan. Het doel van deze studie was om te visualiseren angiogenese met multiphoton microscopie in vivo in een genetisch gemodificeerde 3D-PLGA/nHAp steiger voor calvarial kritische bot defect reparatie. PLGA/nHAp steigers werden matiemaatschappij voor de duurzame levering van een groeifactor pdgf-b gen uitvoering van lentivirale vectoren (LV -pdgfb), ter vergemakkelijking van de angiogenese en ter verbetering van de regeneratie van bot. In een scaffold-geïmplanteerd calvarial kritische bot defect muismodel, de bloedvat gebieden (BVAs) in PHp steigers waren aanzienlijk hoger dan in de steigers van de PH. Bovendien, verhoogd de uitdrukking van de pdgf-b en angiogenese-gerelateerde genen, vWF en VEGFR2, dienovereenkomstig. MicroCT analyse aangegeven dat de nieuwe biomineralisatie in de PHp groep drastisch verbeterd in vergelijking met de andere fracties. Om onze kennis is dit de eerste keer multiphoton microscopie werd gebruikt in bot-weefselengineering te onderzoeken van de angiogenese in een 3D bio-afbreekbaar steiger in vivo en in real-time.

Introduction

Bot is een zeer gevacuoliseerd weefsel dat blijft gedurende de looptijd van een individuele1remodelleren. De snelle en effectieve bot regeneratie van groot bot gebreken als gevolg van trauma, nonunion, resections van de tumor, of craniofaciale misvormingen is een complex fysiologische proces. Traditionele therapeutische benaderingen gebruikt voor bot defect reparatie omvatten autograft en allograft implantatie, maar hun gebruik gepaard gaat met meerdere problemen en beperkingen, zoals beperkte beschikbaarheid, belangrijke donor site morbiditeit, een hoog risico van infectie, en host immuun afwijzing2,3. Kunstmatige Bottransplantaten bieden echter een efficiënt alternatief voor het verlichten van deze beperkingen. Ze kunnen worden gemaakt van biologisch afbreekbare materialen, zijn eenvoudig te fabriceren worden met een geschikt poriegrootte en kunnen genetisch gemodificeerde4,5.

Op dit moment zijn verschillende weefsel engineering steigers tewerkgesteld in de ontwikkeling van de bot weefsel-engineered6,7. Om bot reparatie en regeneratie effectiever, hebben gemanipuleerde biomaterialen gecombineerd met groeifactoren ontstaan en bereikt goede resultaten8,9. Helaas, de korte halfwaardetijd, gemakkelijk-aan-lose activiteit en supraphysiological dosering van groeifactoren voor therapeutische werkzaamheid beperken hun klinische toepassing10. Om deze problemen, is de levering van groeifactor genen in plaats van groeifactoren aangetoond als een effectieve aanpak te handhaven topicale voor de behandeling van ossaal gebreken en ziekten11,12. Virale vectoren zijn veelbelovende levering hulpmiddelen voor weefselregeneratie vanwege hun hoge efficiëntie13uitdrukken.

Onder de groeifactoren, werd bloedplaatjes afkomstige groei factor (PDGF-BB) geselecteerd in deze studie want het is niet alleen een mitogeen en chemoattractant voor mesenchymale en osteogenic cellen, maar ook een stimulans voor angiogenese14,15 . Vorige preklinische en klinische studies toonden aan dat PDGF-BB veilig en effectief bot reparatie van parodontale werden gebreken16,17 bevorderen kan. Recente studies is gebleken dat PDGF-BB angiogenese door motiverende endothelial cel migratie en proliferatie in vivo18,19 stimuleert. Bovendien, PDGF-BB kunt ook renderen mesenchymale stamcellen (MSCs) geschikt voor differentiatie in de endotheliale cellen20, en deze verdere hoogtepunten van de potentiële rol van MSCs in neovascularization. De vorming van DOVO van therapieën in steigers met PDGF-BB inducerende is daarom een belangrijke stap voor de reparatie van weefsel uitgegroeid tot steigers in bot weefselengineering.

Bot defect genezing is een dynamische weefsel morfogenetische proces dat gecoördineerde osteogenesis en angiogenese aan de reparatie posities21 vereist. Neoangiogenesis in de geïmplanteerde weefsels-engineered steigers is een essentiële voorwaarde voor het verstrekken van cellen met voedingsstoffen en zuurstof voor groei en overleving en metabolische afvalstoffen verwijderen. Veelgebruikte methoden imaging, berekend met inbegrip van X-ray micro-tomografie (microCT), magnetische resonantie beeldvorming (MRI), scanning elektronen microscopie (SEM), optische coherentie tomografie (OCT) en confocale laser scanning microscopie, worden toegepast in plaats van histopathologisch onderzoek te verkrijgen van de angiogenese informatie22,23. Deze methoden worden echter verschillende obstakels in het visualiseren en het meten van neovasculature in 3D steigers in bot weefselengineering geconfronteerd. Multiphoton microscopie (MPM) is een relatief nieuwe bio-imaging techniek, die het duidelijke voordeel heeft van gelijktijdig visualiseren van cellen, extracellulaire matrix, en vasculaire netwerken rond in vivo. Het bezit van een inherente driedimensionale beeldvorming capaciteit voor diepe weefsel penetratie en lage photodamage veroorzaakt. Vandaar, in het laatste decennium, MPM heeft opgedaan veel aandacht in biomedische studies24, met inbegrip van in de neurowetenschappen, immunologie en dynamiek van de cel van de stam. Het wordt echter nauwelijks gebruikt in orthopedisch onderzoek.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

de dierenverzorgers was met inachtneming van de gids voor de verzorging en het gebruik van laboratorium dieren van de Chinese provincie Guangdong. Alle procedures werden uitgevoerd onder het toezicht en de goedkeuring van de ethische commissie voor dier onderzoek, Shenzhen Institutes of Advanced Technology, Chinese Academie van Wetenschappen.

1. lentivirale (LV) productie

  1. kloon de pdgf-b-cDNA in een vector van lentivirale expressie (pLenti6/5-eGFP of LV-eGFP) op een aangepaste meerdere-klonen site stroomafwaarts van de promotor van de cytomegalovirus met Spe ik en Sal Ik beperkingsplaatsen voor de bouw van de pLenti6/5-PDGFB-eGFP plasmide (LV - pdgfb) 25.
  2. Lentivirale deeltjes (LV - pdgfb) van HEK - 293 FT cellen produceren door co transfecting met virus verpakking plasmiden (pLP1, pLP2 en pVSV-G) met behulp van de methode standaard calciumfosfaat met chloroquine (eindconcentratie: 25 µM) 25.
  3. na 48u van transfectie, oogst en filteren van 500 mL virus-bevattende supernatant met een filter (0,45 µm). Vervolgens het concentreren van de virale deeltjes door ultracentrifugatie bij 89.000 x g gedurende 2 h. resuspendeer in 200 µL-fosfaatgebufferde zoutoplossing (PBS), aliquoot, en bewaren bij -80 ° C.
  4. Om te bepalen van de titer van lentivirus, HEK293T cellen met serieel verdunde lentivirale oplossing gedurende 24 uur uit te broeden en berekenen van de lentivirale titer, als eerder beschreven 25.

2. Fabricage van 3D-gedrukte PLGA/nHAp steigers en LV immobilisatie

  1. ontbinding van 20 g van PLGA (Poly D, L-lactide-co-glycolide) materiaal in 20 mL van 1,4-dioxaan tot een homogene oplossing vormen. Voeg 2 g nanosized HAp (nano-hydroxyapatide) poeder (nHAp) aan de oplossing; de PLGA: nHAp verhouding moet 10:1 (w/w).
  2. Roer krachtig de gemengde oplossing (roeren snelheid: 1.500 rpm) bij kamertemperatuur gedurende 16 uur een magneetroerder met een uniforme pasta. Het fabriceren in poreuze PLGA/nHAp steigers met behulp van een 3D-printer met lage temperatuur met een geautomatiseerde mondstuk die deposito's van de plakken laag-voor-laag, beneden naar boven, volgens een vooraf ontworpen model 26; de grootte van de poriën van de steigers variëren van 200 tot 400 µm.
  3. Vacuüm freeze-dry de steigers voor 48u oplosmiddel zo volledig mogelijk te verwijderen. Geniet van de steigers in 75% ethanol oplossing voor 1 h voor sterilisatie en lyophilize om neutraal, aseptische steigers.
    Opmerking: De belangrijke parameters voor vacuüm vriesdrogen omvatten de condensatie temperatuur (° C) en vacuüm graad (Pa). Onder een vacuüm mate van 45 Pa, de PLGA/nHAp steigers werden vacuüm bij-78 ° C gedurende 48 h grondig verwijderen het oplosmiddel gevriesdroogd.
  4. Voeg toe 10 µL van LV deeltjes (4.5 x 10 5) aan elke PLGA/nHAp steigerwerk (4 x 4 x 2 mm) en Incubeer de steigers gedurende 2 uur bij 37 ° C in een bevochtigde incubator dat adsorptie.
  5. Na immobilisatie, spoel de steigers tweemaal met PBS om niet-afhankelijke LV deeltjes te verwijderen. Module-freeze de LV deeltje beklede steigers in vloeibare stikstof, weer lyophilize en opslaan bij-80 ° C voor toekomstig gebruik.

3. In Vitro Kinetiek van LV Particle Release van steigers en LV transductie activiteit Assay

  1. Incubate 3D steigers (4 x 4 x 2 mm) vervoeren LV-groene TL proteïne (LV-eGFP, 4.5 x 10 5 LV deeltjes) in 1 mL van de volledige DMEM in 2,0 mL Cryogene flesjes bij 37 ° C met 5 dagen schudden.
  2. Neemt een 1 mL monster elke 12 h vanaf 12u tot 120 h na incubatie en vervangen van het medium. Op elk tijdstip, voeg 1 mL verse medium in plaats van 1 mL van incubatie medium.
  3. De verzamelde media gebruiken om te transduce HEK293T cellen door mede aan het broeden voor 48 h. maatregel het aantal bioactieve LV deeltjes door het bepalen van het aantal HEK293T van GFP-positieve door stroom cytometry 27 cellen.
    1. Voordat de transducing van de HEK293T cellen, verwijdert u het kweekmedium en spoel de cellen van de HEK293T twee keer met PBS. Voeg het verzamelde medium met lentivirus vrijgelaten uit de steigers aan de put (1 mL/putje) en cultuur met de cellen van de HEK293T gedurende 48 uur bij 37 ° C in een bevochtigde incubator.

4. In Vitro Beoordeling van migratie van beenmerg-afgeleide MSC (BMSC)

  1. voor de bepaling van de migratie, bereiden BMSCs tomaat fluorescente proteïne (BMSCs-T) en PDGF-BB eiwit (BMSCs-P) 28.
  2. De BMSC migratie assay uitvoeren met een Boyden kamer met behulp van een 24-well-plate en polycarbonaat filters met een poriegrootte van 8 µm.
    1. Plaats 0,5 mL BMSCs (5 x 10 4) transfected met LV tomaat fluorescente proteïne (BMSCs-T) in de bovenste holten uitdrukken. 0,5 ml van de BMSCs (2 x 10 5) transfected met LV PDGF-BB eiwit (BMSCs-P) in de lagere kamers uitdrukken.
  3. Opnemen van zes fracties in dit experiment en voeg 500 µL tot het onderste compartiment van elk putje.
    A. blanco controle, middellange serumvrij alleen
    B. FBS controle, middellange aangevuld met 10% FBS
    C. PDGF-BB control, 4 ng/mL PDGF-BB in serumvrij middellange
    D. PDGF-BB grijpen groep, PDGF-BB (4 ng/mL) en anti-PDGF-BB (4 ng/mL) polyclonal antilichaam in serumvrij middellange
    E. BMSC groep, 2 x 10 5 BMSCs in serumvrij middellange
    F. BMSCs-P-groep, 2 x 10 5 BMSCs-P in serum gratis middellange.
  4. Incubeer gedurende 48 h bij 5% CO 2 en 37 ° C in een bevochtigde incubator. Daarna de gemigreerde cellen aan de onderkant van de kamer te verwijderen en te verzamelen voor de kwantificering van het aantal BMSCs-T door stroom cytometry.
    1. Verwijderen gemigreerde cellen in de tweede kamer kant met behulp van een cel schraper en resuspendeer de gemigreerde cellen met 2 mL PBS. Het aantal gemigreerde BMSCs-T te kwantificeren door stroom cytometry 29.

5. Oprichting van een lymfkliertest Calvarial kritische bot Defect Model en steiger transplantatie

Opmerking: mannelijke BALB/c muizen (7 weken oud) werden gekocht van Guangdong medisch laboratorium dier centrum (Guangdong, China).

  1. Inschrijven totaal 42 mannelijke muizen voor het calvarial bot defect experimenteren. De muizen willekeurig te verdelen in drie groepen, met veertien in elke groep die ontvangen van de volgende behandelingen: groep A, geen implantaten; Groep B, PH steigers ingeplant (PLGA/nHAp); en groep C, PHp steigers ingeplant (PLGA/nHAp/LV-pdgfb).
  2. Anesthetize de dieren met de intraperitoneale toediening van natrium pentobarbital (50 mg/kg). Verwijder van bont met ontharende plakken en reinig de hoofdhuid met 75% alcohol oplossing alvorens de eerste snede. Herstellen van het hoofd van elke muis met een stereotactische instrument te houden nog steeds tijdens chirurgie.
  3. Maken van een eerste incisie met een scalpel en dan vergroten het with schaar maken een 1 cm lineaire huid incisie. Schraap het beenvlies uit het bot van de schedel te onthullen van het oppervlak van het bot van de schedel met behulp van een steriele wattenstaafje.
  4. Gebruiken een trephine burr te maken van een defect van de kritische-grootte 4 mm-diameter aan de linkerzijde van de snuituil- 30. Transplantatie van de steiger in het bot defect site.
    Opmerking: Kritische omvang gebreken (centrale effectenbewaarinstellingen) waren oorspronkelijk gedefinieerd als " de kleinst mogelijke tekengrootte intraosseous gewikkeld in een name bot en diersoorten die niet spontaan tijdens de levensduur van het dier genezen zal " In dit experiment, het defect van 4 mm-diameter een kritische omvang bot defect, is volgens de eerder studeren 31 , 32.
  5. Ophthalmic pincet
  6. gebruiken om het beenvlies terug kan zetten, zachtjes ter dekking van de chirurgische site. Suture de ingesneden huid met drie steken per cm.
  7. Uitvoeren vóór zorg. De pijnstillende buprenorfine (0,1 mg/kg) voor het verlichten van de pijn te beheren. Handhaven van de lichaamstemperatuur met een verwarming pad totdat het dier ontwaakt. Vervolgens, voederen van de dieren met het voedsel en water en opnemen van hun activiteit elke dag tot het einde van de test. Opmerking: Analgesia kan worden toegediend vóór de ingreep afhankelijk van uw lokale dierenverzorgers Comité richtsnoeren.

6. In Vivo Imaging gebrek angiogenese binnen the Bone met MPM

Opmerking: FITC-geconjugeerd 250 kD dextran (10 mg/mL) in een zoutoplossing werd intraveneus geïnjecteerd in muizen te verkrijgen van hoge-SNR (signaal-/ ruisverhouding) beelden van nieuwe bloedvaten volgens een eerdere studie 33. Let op: dit is een procedure overleving.

  1. monteren van het systeem van de multiphoton microscopie (MPM) voor twee-foton opgewonden fluorescentie (TPEF) en tweede-harmonische generatie signaal (SHG) imaging.
  2. Anaesthetize de dieren met een intraperitoneale injectie pentobarbital natrium (50 mg/kg) en de dieren op een verwarmingsplaat om hun lichaamstemperatuur bij 37 ° C gedurende de experimenten te immobiliseren. 3,0% Isofluraan gas in 100% zuurstof gebruiken om bevredigende anesthesie en analgesie tijdens de procedure. Intraperitoneally injecteren saline (200 µL/dier) ter voorkoming van uitdroging voor imaging.
  3. Tune de femtoseconde Ti-saffier-laser om 860 nm. Maken van een gebied van 512 x 512 µm bemonstering door het scannen van een paar galvo spiegels en gebruiken van NA1.0 water-immersie objectief naar focusthe excitatie lichtbundels in de steekproef en voor het verzamelen van de terugverstrooide TPEF/SHG signaal.
    Opmerking: De beeldvorming werd uitgevoerd op een home-build multiphoton microscopische imaging systeem (MPM). Tijdens imaging, een femtoseconde Ti-saffier-laser was afgestemd op 860 nm als de optimale excitatie golflengte. De laserstraal was raster gescand via een vliegtuig van de monster met behulp van een paar galvanometer spiegels. Na het passeren van een dichroïde spiegel van 685 nm, de straal was gericht op het model door een 20 X NA1.0-doelstelling. De geïnduceerde TPEF en SHG signalen waren verzameld door de dezelfde doelstelling. De signalen waren afgesplitst van de laser van excitatie door de dichroïde spiegel hierboven vermeld en gezuiverd door een 680 nm korte-pass filter. De TPEF en SHG signalen waren verzameld door een vezelbundel en geleid tot een spectrograph. De detector op de spectrograph was een lineaire reeks van fotomultiplicator buizen (PMTs). De combinatie van spectrograph en lineaire matrix PMTs bood de mogelijkheid om het signaal opnemen in 16 opeenvolgende spectrale banden, vanaf 400 nm tot 600 nm, 12,5-nm tussenpozen. Daarom werden de TPEF en SHG signalen gedetecteerd op hetzelfde moment en gescheiden in spectrale domeinen. Bovendien, voor 3D-beeldbewerking, een axiaal motor werd gebruikt om de beeldvorming diepte. Het gebied van elke afbeelding is ingesteld op 512 x 512 µm en de diepte-interval is ingesteld op 2 µm (controlegroep, 5 µm). Met name 5 sites op elk defect waren beeld om statistisch significante gegevens te verzamelen, en de geselecteerde imaging sites werden gelijkmatig en willekeurig verspreid langs de defect.
  4. Scan 5 sites op elk gebrek te verzamelen van statistisch significante gegevens voor het meten van de vorming van het schip.
    1. Gebruik scannen sites gelijkmatig en willekeurig verdeeld langs het gebrek. Voor de controlegroep, het gebied van (FOV) dekking bekijken, zowel het oorspronkelijke bot-gebied en de rand van het gebrek echter voor de PH en PHp groepen, hebben de FOV op de geïmplanteerde steiger.
    2. Maken van een 1-cm lineaire huid incisie met behulp van een scalpel en suture van de open huid aan de fixatie te onthullen van de transplantatie-site. Gebruik een spuit om een druppel water tussen de dompelen lens en transplantaties te vormen van een waterglas.
  5. Ophaal afbeelding wordt gestapeld elke 12 s meer dan een 2 h imaging periode. Weergeven en analyseren van de volumetrische gegevens met behulp van een aangepast programma MATLAB en kwantificeren van de bloedvat-gebieden met ImageJ software 34 , 35.

7. Gen expressie analyse van de pdgf-b en angiogenese-gerelateerde genen door RT-qPCR

Opmerking: PCR werd uitgevoerd volgens de gebruikelijke stappen: 95 ° C gedurende 30 s, 40 cycli van 95 ° C voor 5 s en 60 ° C gedurende 30 s. Post-PCR smelten curven bevestigd de specificiteit voor single-target-amplificatie, en de verandering van de vouw van het gen van belang ten opzichte van de β-actine werd bepaald. De reactie voor elk monster driemaal werd getest.

  1. Oogst geïmplanteerd steigers en weefsels van de experimentele muizen op 2, 4 en 8 weken na operatie 36; controle van monsters van de groep (n = 4), genomen op dezelfde tijd punten, moet uit de aangrenzende botweefsel.
    Opmerking: Op elk tijdstip (2, 4 en 8 weken), euthanized de muizen met CO 2 inademing. Ontleden de snuituil, vervolgens verwijderen en oogst van de geïmplanteerde steigers van de snuituil.
  2. Gebruiken een commerciële reagens uitpakken van de totaal RNA van elk monster volgens de fabrikant ' s-protocol. De omgekeerde transcriptie Kit gebruiken om te keren-transcriberen het RNA in cDNA na de fabrikant ' s-protocol.
  3. Uitvoeren kwantitatieve PCR in real time met behulp van de SYBR Green Detection System; de inleidingen zijn vermeld in tabel 1.
Primer(5'–3')
gen voorwaarts omgekeerde
pdgfb CATCCGCTCCTTTGATGATCTT GTGCTCGGGTCATGTTCAAGT
vWF CTCTTTGGGGACGACTTCATC TCCCGAGAATGGAGAAGGAAC
VEGFR2 GAAATGACACTGGAGCCTACA AG TCCATGCTGGTCACTAACAGAA G
β-actine GTATCCATGAAATAAGTGGTTAC AGG GCAGTACATAATTTACACAGAAG CAAT

tabel 1: Pimer Sets.

8. MicroCT analyse van bot regeneratie

  1. euthanaseren muizen met CO 2 inademing bij 8 weken na operatie. In een goed geventileerde omgeving, zachtjes plaats elke muis in een kooi schoon muis en CO 2 gas pomp in de kooi om de muizen voordat de euthanasie anaesthetize.
  2. Ontleden de schedel voor beeldvorming van de microCT van het bot defect regio. De volgende gebruiker scanparameters in de experimenten: 9 µm resolutie, Al 0,5 mm filter, 50 kV spanning en 142 µA huidige.
  3. Reconstruct alle imaging gegevens met behulp van commerciële software verstrekt door het bedrijf. Kalibreren van de scans die met behulp van de kalibratiefunctie van een software CTAn.
    BEMERKING: Plaats een Hounsfield-eenheid (HU) onder de muizen in elke scan.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Cilindrische poreuze PLGA/nHAp steigers 0.6 mm in hoogte en diameter van 4 mm werden vervaardigd met een 3D-printer. De morphologies van de steigers werden geanalyseerd via scanning elektronen microscopie en microCT. Figuur 1A toont de foto van de geïmplanteerde steiger. MicroCT scannen onthulde dat meer dan 85% van de poriën had maten variërend van 200 tot 400 µm (figuur 1B). SEM imaging aangetoond dat het oppervlak van de steiger had een ruwe microtopography, met micropores (diameter ongeveer 5-10 µm) die met elkaar binnen de steigers (figuur 1 D-F verbonden). Ongeveer 40% van de totale hoeveelheid gecoate LV-eGFP deeltjes (4.5 x 105) vrijgelaten uit de steigers van de PLGA/nHAp begonnen met een effect van de eerste uitbarsting binnen de 24u. De topicale van vrijgegeven LV virussen bereikt top op 24 h en vervolgens voortdurend afgenomen, naderen op 0 bij 120 h (Figuur 2). Deze gegevens wijzen erop dat de topicale van meest steiger-geïmmobiliseerd LV deeltjes voor maximaal 96 uur konden worden gehandhaafd. De capaciteit van de migratie van MSCs-T werd waargenomen met de methode FACS te onderzoeken of LV pdgf-b -cDNA uitvoering kon uiten en tot BMSC chemotaxis leiden, zoals in Figuur 3. Zowel de positieve controle (C) en de groep van PDGF-BB-uitdrukken (F) tentoongesteld een aanzienlijk hoger niveau van BMSC migratie dan de andere 4 groepen. Bovendien, was de migratie van BMSCs in groep F aanzienlijk hoger dan die in groep C. Er waren geen significante verschillen in BMSC migratie onder de andere 4 groepen.

Angiogenese binnen het bot defect evalueerden uit de 2e tot de 8e week na implantatie door MPM scannen. Figuur 4A ziet u een schematische afbeelding van een muis onder MPM scannen. Voor de hand liggende angiogenese werd ontdekt in de groepen PH en PHp, maar bloedvaten waren nauwelijks waarneembaar in de controlegroep, waar alleen een laag van vezelige membranen in de hele regio defect gevormd (figuur 4B). De GIF-grafieken tonen de tomographs van het bloedvat van elke groep (Aanvullende gegevens). Het gebied van nieuwe bloedvaten geleidelijk opgetrokken na verloop van tijd in groepen PH en PHp, met vergelijkbare toenemende patronen. Op de 8e week verscheen de schepen qua morfologie die waargenomen in de beginfase; de enige verandering was dat een toenemend aantal kleinere schepen in de steigers (figuur 4B groeide). De BVA van de PHp groep was aanzienlijk hoger is dan dat van de andere twee groepen ten allen punten (figuur 4C tijde). Bovendien waren er veel collageen afzetting sites, zoals aangegeven door de SHG signalen (de groene kleur in de grafieken en de grafieken van de GIF) in de groepen PH en PHp, maar niet in de controlegroep (figuur 4B).

Ter verduidelijking van de relatie van PDGF-BB meningsuiting en angiogenese, vergeleken we de gene transcript expressie niveaus van de pdgf-b, vWFen VEGFR2 met de methode van de RT-qPCR op 2, 4 en 8 weken na implantatie ( Figuur 5). Zoals verwacht, was pdgf-b -expressie aanzienlijk verhoogd in de PHp groep op alle punten van de tijd, met een verhoging van de 5 - tot 13-keer in vergelijking met de controle en de PH groepen (figuur 5A). Was er geen significant verschil tussen het besturingselement en de PH-groep, en de expressie PDGF-BB bijna bleef constant vanaf week 2 week 8, zoals aangetoond in figuur 5A. De mRNA niveaus van expressie van vWF en VEGFR2 hebben in alle drie de groepen geleidelijk verhoogd en waren de hoogste in de PHp groep helemaal tijd drie punten (figuur 5B en 5 C). Voor de Fractie van de PH was er geen statistische significantie in vergelijking met de controlegroep, ondanks duidelijk angiogenese (figuur 4B).

Verder bevestigen dat pdgf-b-met steigers bevorderen bot regeneratie in vivo kritisch formaat calvarial gebreken met mannelijke BALB/c muizen, microCT scannen verstrekte informatie om te beoordelen van bot regeneratie op 8 weken na implantatie. Zoals aangegeven in Figuur 6, werden gebreken in de PHp groep gevuld met een massa van nieuw bot weefsel ingroei in de steigers, terwijl er veel minder nieuw bot in de controle- en PH-groepen was.

Figure 1
Figuur 1: structurele karakterisering van een 3D PLGA/nHAp steiger. (A) foto van een 3D afdruk steiger. (B) een microCT beeld van de algehele porositeit van de steiger. (C) de microtopography van het schavot oppervlak waargenomen door SEM op 60 X, 2.000 X (D), 5.000 X (E), en 10.000 X vergroting (F). Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2: voorbereiding van de Lentivirus en de evaluatie van de topicale van de LV-GFP deeltjes. (A) Schematische weergave van het lentivirale vector-construct. Na 48u van transfectie, werden HEK - 293FT cellen waargenomen onder licht (B) en fluorescentie veldomstandigheden (C). (D) In vitro beoordelingvan de topicale van de deeltjes van de LV-GFP cumulatief vrijgelaten uit PLGA/nHAp steigers. Alle gegevens worden gepresenteerd als de gemiddelde ± SEM (n = 4). Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3. PDGF-BB topicale als een krachtige Chemotactische Factor reactie van BMSC migratie. BMSCs-T (5 x 104) op de top van transwell kamers, waren bezaaid met verschillende voorwaarde media geplaatst in de bodem van de kamers. (A) blancocontrole, serumvrij medium alleen; (B) FBS controle, middellange aangevuld met 10% FBS; (C) PDGF-BB control, 4 ng/mL PDGF-BB in serumvrij drager wordt vastgelegd; (D) PDGF-BB grijpen groep, PDGF-BB (4 ng/mL) en anti-PDGF-BB (4 ng/mL) polyclonal antilichaam in serumvrij drager wordt vastgelegd; (E) BMSCs groep, 2 x 105 BMSCs in serumvrij drager wordt vastgelegd; en (F) BMSCs-P-groep, 2 x 105 BMSCs-P in serumvrij medium. Alle gegevens worden weergegeven als de gemiddelde ± SEM (n = 4). #: vergelijking tussen groep C en alle andere groepen, behalve de groep F, # p < 0,0001. *: vergelijking tussen groep F en alle andere fracties, * p < 0,05, *** p < 0,0001. Klik hier voor een grotere versie van dit cijfer.

Figure 4
Figuur 4: Hoge resolutie Multiphoton microscopie (SHG/TPEF) beeldvorming en kwantificering van de angiogenese in het bot Defect regio van muis snuituil.Trong > (A) A Schematische afbeelding van een muis onder MPM scannen. De oranje cirkel staat de defect-site, de rode tubuli vertegenwoordigen bloedvaten en de groene voor collageen. (B) Unoperated en bediende dieren werden gescand met MPM op 8 weken na implantatie. SHG, TPEF, SHG/TPEF samengevoegd en 3D-beelden worden getoond. De stippellijn geeft de grens langs de bot defect in de controlegroep op basis van signalen van de SHG. (C) bloedvat gebied kwantificering binnen het defect gebied van controle, PH en PHp vanaf week 2 aan week 8 na implantatie. Alle gegevens worden weergegeven als de gemiddelde ± SEM (n = 5). : Statistische analyse tussen groepen PH en PHp, p < 0,0001. Klik hier voor een grotere versie van dit cijfer.

Figure 5
Figuur 5: RT-qPCR analyse van de pdgf-b (A) en angiogenese-gerelateerde genen vWF (B) en VEGRF2 (C) expressie in drie groepen. Monsters van 4 dieren werden geanalyseerd voor elk punt van de tijd. #: vergelijking tussen de groepen van PHp en PH, # p < 0,05, # p < 0.01 en #p < 0,0001. *: vergelijking tussen de PHp- en controlegroepen, * p < 0,05, ** p < 0,01, en *** p < 0,0001. Klik hier voor een grotere versie van dit cijfer.

Figure 6
Figuur 6: Evaluatie van In Vivo biomineralisatie met MicroCT scannen. Controlegroep zonder geïmplanteerde steigers. PH groep binnen geïmplanteerde PLGA/nHAp steiger alleen. PHp groep binnen geïmplanteerde PLGA/nHAp steiger gewijzigd door de LV- pdgfb deeltjes. Klik hier voor een grotere versie van dit cijfer.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Bot is een zeer gevacuoliseerd weefsel met een unieke capaciteit om voortdurend te genezen en remodelleren gedurende de levensduur van een individuele1. Het niveau van de vascularisatie is belangrijk voor osteogenesis en defect reparatie. Lage vascularisatie beperkt de brede klinische toepassing van weefsel-engineered bot. Bouw van een zeer gevacuoliseerd weefsel-engineered bone volgens de theorie van biomimetics is een hulpprogramma voor het repareren van grote segment bot gebreken geworden. Verschillende soorten steigers zijn met succes toegepast om te herstellen van relatief kleine ossaal gebreken. Echter voor kritische bot gebreken, de toepassing van de steigers te repareren nog gezichten belemmeringen, voornamelijk als gevolg van onvoldoende bloed leveren voor reparatie van het defect. Verbetering van de bloedtoevoer tijdens het proces van het herstel van de gebreken van groot bot is daarom een van de belangrijkste onderwerpen in weefselengineering.

Mensen gebruiken bioactieve materiaal-gecoate steigers te helpen om de nodige morfogenetische velden die kunnen stimuleren, werven en bevorderen de chemotaxis differentiatie en de proliferatie van de cellen die nodig zijn voor neovasculature en been vorming 37. Neovasculature in weefsel-engineered steigers is essentieel voor de cellen om te ontvangen van zuurstof en voedingsstoffen, voor de verwijdering van afvalproducten, en uiteindelijk voor de vervulling van de functie van steigers. De doelstellingen van deze studie waren te onderzoeken van de angiogenese met in vivo multiphoton microscopie in een genetisch gemodificeerde, 3D-gedrukte PLGA/nHAp steiger voor calvarial kritische bot defect reparatie en te evalueren van de effecten van het gebruik van de regeneratie van de bot microCT.

Ondanks de dramatische verworvenheden op bot weefselengineering, de in vivo visualisatie en de kwantificering van neovascularization in de steigers tijdens bot is regeneratie nog steeds een uitdaging. Meest microscopische imaging systemen zijn volumetrische informatie te verstrekken over angiogenese. Traditionele beeldvormende methoden, zoals microCT, MRI en histologische analyses, zijn destructieve, ingewikkelde en moeizame en hebben lage ruimtelijke resoluties en lange Beeldacquisitie keer38. MPM imaging is echter een nieuwe bio-imaging modaliteit die bloedvat kan vangen signalen in vivo in een hoge resolutie en minimaal invasieve manier. Is het kundig voor speurder van nieuwe schepen dunner dan 10 µm (figuur 4B). Naast bloedvat beelden zien we ook een massa van nieuw collageen afzetting (de groene kleur in de figuur 4B) en de grafieken van de GIF in het aanvullend materiaal, zoals aangegeven door de SHG signalen, die aangeven van biomineralisatie weefsel vanuit een andere hoek. Theoretisch, bloedvat beelden kunnen worden verkregen zonder het gebruik van contrastmiddelen. Echter in de huidige studie, wij een contrast-agent gebruikt om betere beelden en verwijderd van de lokale huid om ervoor te zorgen de juiste scannen diepte. Dit zou niet nodig zijn wanneer meer krachtige imaging systemen beschikbaar in de toekomst voor echt niet-invasieve imaging zijn.

HAp is een biomedische materiaal voor bot-weefselregeneratie die veel vanwege de goede osteoconduction en osteoinduction eigenschappen gebruikt wordt. HAp heeft goed vermogen bindend DNA vectoren en het behoud en het stabiliseren van vectoren, met inbegrip van virale vectoren39. In vergelijking met microsized HAp, nanosized HAp deeltjes hoge specifieke oppervlaktes bezitten en dus beter cellulaire gedrag en mechanische eigenschappen40. Om deze redenen zijn nHAp deeltjes een van de onderdelen van de steigers. De oppervlakte en transversale SEM beelden van de PLGA/nHAp steiger afgebeeld in figuur 1 geeft aan dat de verzonnen steigers vertonen een goed onderling verbonden poriënstructuur en gelijkmatig verdeelde porie maten. De immobilisatie van het virus op biomaterial vervoerders kan beïnvloeden virusactiviteit. Dus we getest de topicale van LV deeltjes vrijgelaten uit de steigers door te onderzoeken hun transfectie activiteit. De profielen van de release van LV deeltjes uit de steigers en hun bioactivities werden geëvalueerd in vitro, demonstreren de gecontroleerde aflevering van bioactieve LV deeltjes gedurende vijf dagen (Figuur 2). Bovendien, onze in vitro -studie concentreerde zich op het potentieel van PDGF-BB ter stimulering van de migratie van primaire MSCs. Deze resultaten suggereren dat de LV-deeltjes bioactieve PDGF-BB en effectief gestimuleerde migratie van de BMSC uitgedrukt.

Om te bevestigen de capaciteit voor angiogenese en bot regeneratie in vivo, werden PHp steigers lymfkliertest calvarial kritische bot gebreken ingeplant. Vaartuig vorming werd bevestigd met de angiogenic markers, RT-qPCR analyse en bloedvat dichtheden waargenomen met SHG/TPEF imaging. Zowel van de twee verzamelingen van experimenten aangetoond dat angiogenese en bloedvat vorming aanzienlijk zijn verbeterd met de behandeling van genetisch gemodificeerde steigers. Deze resultaten wijzen erop dat de PDGF-BB niet alleen rechtstreeks angiogenese stimuleert, maar ook andere angiogenese-gerelateerde genen induceert. Ondertussen, microCT metingen laten zien dat pdgf-b-bevattende steigers aanzienlijk bevorderd biomineralisatie in vergelijking met de ongewijzigde steigers, die met de neovasculature in de steiger correleert. Deze resultaten wijzen erop dat genetisch gemodificeerde, biologische actieve steigers angiogenese en weefsels regeneratie aanzienlijk verbeteren.

De resultaten die hier gepresenteerd aantonen dat de lentivirus-gemedieerde genetische modificatie van steigers grote werden defect reparatie in een lymfkliertest calvarial kritische bot defect model, waarschijnlijk door middel van verbeterde angiogenese vergemakkelijkt. Daarnaast, biedt in vivo MPM imaging een uniek instrument te begrijpen van de angiogenese en osteogenesis in bot steigers en kunt verdere opheldering van de vraag of een bepaalde steiger gunstig voor de neovascularization is. Intravital multiphoton microscopie imaging biedt een modaliteit voor het begrijpen van de Fysiologie en pathofysiologie van angiogenese in weefsels en steigers. Er zijn echter enkele beperkingen bij het gebruik van deze techniek. Ten eerste, de chirurgische voorbereiding vereist specifieke expertise. Ontsteking veroorzaakt door ongeschoolde operatie zal leiden tot aanzienlijke afname van de MPM imaging kwaliteit. Ten tweede, als gevolg van de MPM imaging snelheidsbegrenzing, een speciaal ontworpen hoofd muishouder is nodig om te verminderen de artefacten, veroorzaakt door de hartslag en ademhaling. Ten derde, voor lange termijn imaging, dieren moeten worden intraperitoneally of intraveneus ingespoten met zoutoplossing om uitdroging te voorkomen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs verklaren dat zij geen concurrerende financiële belangen hebben.

Acknowledgements

Deze studie werd ondersteund door het Shenzhen Peacock programma, China (nr. 110811003586331), de Shenzhen Basic Research Program (nr. JCYJ20150401150223631, nr. JCYJ20150401145529020 en nr. JCYJ20160331190714896), het Guangdong openbaar onderzoek en capaciteitsopbouw Special Program (nr. 2015A020212030), de nationale natuurlijke Science Foundation van China (nr. 81501893), de nationale Major Basic Research Program van China (2013CB945503), en de SIAT innovatie programma voor uitstekende jonge onderzoekers (Y5G010).

Materials

Name Company Catalog Number Comments
Poly(D,L-lactide-co-glycolide) (PLGA) Sigma P1941 L/G ratio 75:25, MW 66000-107000
Hydroxyapatite nanoparticles Sigma 702153 Average diameter < 200 nm
Chloroquine diphosphate salt Sigma C6628
FITC-conjugated 250-kD dextran Sigma FD250S
1,4-dioxane lingfeng,Shanghai 0.45 micron
Stericup filters Merck Millipore Corporation SLHV033RB
PDGF-BB Cdna Sino Biological, Inc MZ50801-G
Anti-PDGF-BB mouse polyclonal antibody  BioVision, Inc 5489-30T
PDGF-BB recombinant protein 4489-50
Calcium-phosphate transfection solution Promega Corporation E1200
L-DMEM Hyclone SH30021.01
DPBS Hyclone SH30028.01
Penicillin-Streptomycin, Liquid Thermo Fisher Scientific 15140122
FBS Thermo Fisher Scientific 10099-141
Transwell  Corning 3422
Male BALB/c mice Guangdong Medical Laboratory Animal Center 
sodium pentobarbital  Merck 1063180500
multiphoton microscopy A homemade in Shenzhen Institutes of Advanced Technology to detect two-photon excited fluorescence (TPEF) and second harmonic generation signal (SHG).
isoflurane Keyuan, Shandong 401750169
TRIzol reagent Invitrogen 15596018
PrimeScript RT Master Mix (Perfect Real Time) Takara RR420B
SYBR Premix Ex Taq (Tli RNaseH Plus) Takara RR036B
Hematoxylin and eosin Beyotime C0105
Paraffin Leica  RM2235
Ultracentrifuge OPtima L-100XP Beckman Coulter L-100XP
Low-temperature printer  Tsinghua university A homemade in Tsinghua university
LightCycler 480 instrument  Roche 5815916001
microCT Bruker 1176
commercial software Bruker
Buprenorphine

DOWNLOAD MATERIALS LIST

References

  1. Hu, X., et al. GPNMB enhances bone regeneration by promoting angiogenesis and osteogenesis: potential role for tissue engineering bone. J Cell Biochem. 114, (12), 2729-2737 (2013).
  2. Schroeder, J. E., Mosheiff, R. Tissue engineering approaches for bone repair: concepts and evidence. Injury. 42, (6), 609-613 (2011).
  3. Chiarello, E., et al. allograft and bone substitutes in reconstructive orthopedic surgery. Aging Clin Exp Res. 25, S101-S103 (2013).
  4. Elangovan, S., et al. The enhancement of bone regeneration by gene activated matrix encoding for platelet derived growth factor. Biomaterials. 35, (2), 737-747 (2014).
  5. Bouyer, M., et al. Surface delivery of tunable doses of BMP-2 from an adaptable polymeric scaffold induces volumetric bone regeneration. Biomaterials. 104, 168-181 (2016).
  6. Rezwan, K., et al. Biodegradable and bioactive porous polymer/inorganic composite scaffolds for bone tissue engineering. Biomaterials. 27, (18), 3413-3431 (2006).
  7. Burg, K. J., Porter, S., Kellam, J. F. Biomaterial developments for bone tissue engineering. Biomaterials. 21, (23), 2347-2359 (2000).
  8. Xiao, Y., et al. Modifications of collagen-based biomaterials with immobilized growth factors or peptides. Methods. 84, 44-52 (2015).
  9. Chen, G., Lv, Y. Immobilization and Application of Electrospun Nanofiber Scaffold-based Growth Factor in Bone Tissue Engineering. Curr Pharm Des. 21, (15), 1967-1978 (2015).
  10. Kofron, M. D., Li, X., Laurencin, C. T. Protein- and gene-based tissue engineering in bone repair. Curr Opin Biotechnol. 15, (5), 399-405 (2004).
  11. Chen, F. M., et al. New insights into and novel applications of release technology for periodontal reconstructive therapies. J Control Release. 149, (2), 92-110 (2011).
  12. Winn, S. R., et al. Gene therapy approaches for modulating bone regeneration. Adv Drug Deliv Rev. 42, (1-2), 121-138 (2000).
  13. Chang, P. C., et al. Adenovirus Encoding Human Platelet-Derived Growth Factor-B Delivered to Alveolar Bone Defects Exhibits Safety and Biodistribution Profiles Favorable for Clinical Use. Hum Gene Ther. 20, (5), 486-496 (2009).
  14. Phipps, M. C., Xu, Y. Y., Bellis, S. L. Delivery of Platelet-Derived Growth Factor as a Chemotactic Factor for Mesenchymal Stem Cells by Bone-Mimetic Electrospun Scaffolds. Plos One. 7, (7), (2012).
  15. Gehmert, S., et al. Angiogenesis: The role of PDGF-BB on Adiopse-tissue derived Stem Cells (ASCs). Clin Hemorheol and Microcirc. 48, (1-3), 5-13 (2011).
  16. Chang, P. C., et al. PDGF-B gene therapy accelerates bone engineering and oral implant osseointegration. Gene Ther. 17, (1), 95-104 (2010).
  17. Javed, F., et al. Significance of the platelet-derived growth factor in periodontal tissue regeneration. Arch Oral Biol. 56, (12), 1476-1484 (2011).
  18. Murali, R., et al. Biomimetic hybrid porous scaffolds immobilized with platelet derived growth factor-BB promote cellularization and vascularization in tissue engineering. J Biomed Mater Res A. 104, (2), 388-396 (2016).
  19. Andrae, J., Gallini, R., Betsholtz, C. Role of platelet-derived growth factors in physiology and medicine. Genes Dev. 22, (10), 1276-1312 (2008).
  20. Wosnitza, M., et al. Plasticity of human adipose stem cells to perform adipogenic and endothelial differentiation. Differentiation. 75, (1), 12-23 (2007).
  21. Hankenson, K. D., et al. Angiogenesis in bone regeneration. Injury. 42, (6), 556-561 (2011).
  22. Schmidt, C., et al. Rapid three-dimensional quantification of VEGF-induced scaffold neovascularisation by microcomputed tomography. Biomaterials. 30, (30), 5959-5968 (2009).
  23. Perng, C. K., et al. In Vivo Angiogenesis Effect of Porous Collagen Scaffold with Hyaluronic Acid Oligosaccharides. J Surg Res. 168, (1), 9-15 (2011).
  24. Sun, Y., et al. Imaging tissue engineering scaffolds using multiphoton microscopy. Microsc Res Tech. 71, (2), 140-145 (2008).
  25. Fan, X., et al. Noninvasive monitoring of placenta-specific transgene expression by bioluminescence imaging. PLoS One. 6, (1), e16348 (2011).
  26. Yeo, M. G., Kim, G. H. Preparation and Characterization of 3D Composite Scaffolds Based on Rapid-Prototyped PCL/β-TCP Struts and Electrospun PCL Coated with Collagen and HA for Bone Regeneration. Chem Mater. 24, (5), 903-913 (2012).
  27. Mao, Y., et al. Lentiviral Vectors Mediate Long-Term and High Efficiency Transgene Expression in HEK 293T cells. Int J Med Sci. 12, (5), 407-415 (2015).
  28. Li, J., et al. Investigation of angiogenesis in bioactive 3-dimensional poly (D,L-lactide-co-glycolide)/nano-hydroxyapatite scaffolds by in vivo multiphoton microscopy in murine calvarial critical bone defect. Acta Biomater. 42, 389-399 (2016).
  29. Abbasi, H., et al. Lentiviral vector-mediated transduction of goat undifferentiated spermatogonia. Anim Reprod Sci. 163, 10-17 (2015).
  30. Pigossi, S. C., et al. Bacterial cellulose-hydroxyapatite composites with osteogenic growth peptide (OGP) or pentapeptide OGP on bone regeneration in critical-size calvarial defect model. J Biomed Mater Res A. (2015).
  31. Bos, G. D., et al. The effect of histocompatibility matching on canine frozen bone allografts. J Bone Joint Surg Am. 65, (1), 89-96 (1983).
  32. Hollinger, J. O., Kleinschmidt, J. C. The critical size defect as an experimental model to test bone repair materials. J Craniofac Surg. 1, (1), 60-68 (1990).
  33. Hollanders, K., et al. Bevacizumab Revisited: Its Use in Different Mouse Models of Ocular Pathologies. Curr Eye Res. 40, (6), 611-621 (2015).
  34. Gao, L. QSIM: quantitative structured illumination microscopy image processing in ImageJ. Biomed Eng Online. 14, 4 (2015).
  35. Kobat, D., et al. Deep tissue multiphoton microscopy using longer wavelength excitation. Opt Express. 17, (16), 13354-13364 (2009).
  36. Lohmann, P., et al. Bone regeneration induced by a 3D architectured hydrogel in a rat critical-size calvarial defect. Biomaterials. 113, 158-169 (2016).
  37. Lv, J., et al. Enhanced angiogenesis and osteogenesis in critical bone defects by the controlled release of BMP-2 and VEGF: implantation of electron beam melting-fabricated porous Ti6Al4V scaffolds incorporating growth factor-doped fibrin glue. Biomed Mater. 10, (3), (2015).
  38. Guldberg, R. E., et al. 3D imaging of tissue integration with porous biomaterials. Biomaterials. 29, (28), 3757-3761 (2008).
  39. Boehler, R. M., et al. A PLG/HAp composite scaffold for lentivirus delivery. Biomaterials. 34, (21), 5431-5438 (2013).
  40. Heo, S. J., et al. Fabrication and characterization of novel nano- and micro-HA/PCL composite scaffolds using a modified rapid prototyping process. J Biomed Mater Res A. 89, (1), 108-116 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics