생물학적 유형을 유지하고 차별화하기 위해 사용되는 실험실 기술 * These authors contributed equally

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

이 원고는 일련의 생화학 분석법 외에도 적절한 Vibrio cholerae 유지 기술을 설명하며, 임상 적 및 환경 적 V 사이의 신속하고 안정적인 차별화를 위해 집합 적으로 활용됩니다. 실험실 환경에서 cholerae biotypes.

Cite this Article

Copy Citation | Download Citations

Brumfield, K. D., Carignan, B. M., Ray, J. N., Jumpre, P. E., Son, M. S. Laboratory Techniques Used to Maintain and Differentiate Biotypes of Vibrio cholerae Clinical and Environmental Isolates. J. Vis. Exp. (123), e55760, doi:10.3791/55760 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

수중 그람 음성 박테리아 Vibrio cholerae 는 감염성 위장병 콜레라의 원인균입니다. 이 질병의 세계적 유병률과 중증도 때문에 V. cholerae 는 환경 및 실험실 환경에서 광범위하게 연구되어 왔으며 적절한 유지 관리 및 배양 기술이 필요합니다. Classical과 El Tor는 V 를 구성하는 두 가지 주요 biotypes입니다. cholerae O1 serogroup은 각각 고유 한 genotypic과 phenotypic 특성을 나타내어 생물 종 특성 결정을위한 신뢰할 수있는 메커니즘을 제공하고 배양 조건을 유도하는 독성을 필요로한다. 주어진 감염 또는 발병에 대한 원인 균주의 생물 유형에 관계없이, 질병의 표준 치료에는 항생제 처방으로 보충 된 수분 요법이 포함됩니다. 그러나 생물학적 분류는 실험실 연구에 필요할 수 있으며 생물 의학 분야에서 더 광범위한 영향을 미칠 수 있습니다.2000 년대 초반에는 임상 적으로 분리 된 균주가 확인되었는데, 이는 고전 및 엘 토 바이오 타입의 유전형 및 표현형 특성을 나타냅니다. 엘 토르 (El Tor) 변종으로 불리는 새롭게 확인 된 잡종 (hybrid)은 임상 적 및 환경 적으로 격리 된 생물 종 식별을 이전의 전통적인 단일 분석 식별 프로토콜보다 더 복잡하게 만들었다. V 를 기술하는 것 외에. (copyyyin B 저항성, 구연산 대사, 단백 분해 활성, 용혈 활성, 운동성 및 포도당 대사)에 대한 일련의 유전자 특이 적 ( ctxBtcpA ) PCR 기반 유전자 스크린과 표현형 분석을 기술하고있다. Proskauer assay)은 고전적 및 엘 토르 생물 유형을 특성화 및 / 또는 구별하기 위해 집합 적으로 사용되었습니다. 함께,이 assays는 대안으로, 또는 추가로, characteriza에 비용이 많이 드는, 노동 집약적 인 실험에 사용되는 효율적인 체계적인 접근 방식을 제공합니다V의 변화 . cholerae 임상 (및 환경) 균주.

Introduction

콜레라 (Cholera)는 오염 된 음식물이나 수생 그람 음성 박테리아 인 비브리오 콜레라 (Vibrio cholerae)를 함유 한 물의 섭취로 말초 소장의 질병입니다. 콜레라의 증상으로는 구토와 통제 할 수없는 수분 설사가 있으며 심한 탈수증을 유발합니다. 제대로 치료하지 않으면 사망에 이릅니다. V. 콜레라 는 세포 표면 리포 폴리 사카 라이드 O- 항원의 구조에 따라 200 개 이상의 혈청군으로 나눌 수 있습니다. 그러나 O1과 O139의 2 가지 혈청군 만이 전염병 또는 유행성 잠재력 1 , 2을 나타냈다. 또한, 혈청 그룹 O13은 주로 동남 아시아 3 , 4에 격리되어 있으며 혈청 그룹 O1은 전 세계적으로 분포되어있다. 또한, O1 혈청 그룹은 2 가지 주요 바이오 타입으로 분류 될 수있다 : 클래식 및 엘 토르. 고전적인 생물 종은 콜레라 전염병 유행병진행중인 일곱 번째 전염병은 엘 토르 (El Tor) 바이오 타입의 결과로 환경에서 5 , 6 , 7 의 고전적 바이오 타입을 전 세계적으로 대체하고있다. 최근에는 클래식 및 엘 토 바이오 타입 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 의 특징을 지닌 균주가 생겨 났으며 , 이후 엘 토르 변종 13 , 17 이라고 명명되었습니다. 일부 엘 토르 (El Tor) 변종은 이전에 관찰 된 것보다 더 빠르고 심각한 질병 진행으로 상승 된 병독성 능력을 입증했으며,에이전트 식별 및 질병 예방 및 치료에 대한보다 포괄적 인 접근 방법의 필요성 8 , 9 , 18 . 생물 종 동정은 치료를 즉시 지시하지는 않지만 백신 개발 및 향후 치료제의 발전은 생물 형별의 이점을 얻을 수 있습니다.

여기에 열거 된 첫 번째 일련의 프로토콜은 조사자가 V 를 적절히 유지할 수있게합니다. cholerae 실험실 환경에서의 변종. 일관성 및 후속 분석을 위해서는 생물학적 특성에 의존하지 않는 균주의 재배 및 성장이 필요합니다. 그러나, 독성 유전자 발현을 최적으로 유도하기 위해서는 독립적 인 생물 종 특이 적 배양 기술이 필요합니다 19 . 또한, 다양한 유전 및 생화학 분석을위한 준비가이 원고에 설명되어 있습니다.

콜레라 독소 (CT)와 독소가 다시 반응합니다.gulated pilus (TCP)는 V 의 두 가지 생물 유형 모두에서 마스터 조절 자 ToxT에 의해 제어되는 두 가지 주요 독성 인자이다. cholerae O1 혈청 군 20 . CT는 5 개의 CtxB로 구성된 bipartite 독소입니다. 단일 CtxA 서브 유닛을 둘러싸고있는 서브 유닛이며 콜레라와 관련된 급속한 전해질 손실을 일으킨다. TCP는 tcp 오페론 ( tcpABQCRDSTEF )에 의해 암호화 된 유형 IV 파일로 말초 소장의 부착과 집락에 관여합니다. tcpA 는 필라 스 8 구축에 필수적인 개별 필린 서브 유닛을 암호화하는 tcp 오페론의 첫 번째 유전자입니다. ctxA 의 유전자 서열은 클래식과 El Tor 바이오 타입 사이에서 완전히 보존되는 반면, ctxBtcpA 는 두 바이오 타입 간에 다르지만 각 바이오 타입 내에서 보존된다. ctxB 는 2 개의 염기 자리를 제외한 바이오 타입 사이에서 완전히 보존된다(115 및 203). 엘 토르 (El Tor) 바이오 타입에서, 티민은 115 번과 203 번 위치에 있고, 전형적인 바이오 타입은이 염기에 시토신을 포함하고있다. tcpA 는 각 바이오 타입 내에서 완전히 보존되지만, 바이오 타입 사이의 여러 기지에서 다르다. 이러한 유전 적 특성은 일차적 인 생물 종 식별 마커 역할을하며, 이들 부위를 포함하는 폴리 메라 이제 연쇄 반응 (PCR) 증폭 산물을 시퀀싱 한 후에 야생형 (WT) 고전 O395 또는 WT El Tor N16961과 비교하여 생물 형질의 배경을 결정할 수있다 주어진 V. cholerae 균주에서 CT와 TCP의 발현 양상을 비교 하였다.

클래식과 El Tor biotypes 21 , 22 , 23 사이의 표현형 차이를 특성화하기 위해 수많은 프로토콜이 개발되었습니다. Polymyxin B는 그람 음성 백신에서 외부 세포막의 완전성을 손상시키는 펩타이드 항생제입니다.teria 및 polymyxin B 저항성은 polymyxin B 저항성 분석을 통해 시각화 할 수 있습니다 21 . 구연산염은 크렙스 사이클의 주요 기질이며 구연산염을 유일한 탄소원으로 대사하는 능력은 구연산 대사 분석법 22 를 사용하여 결정할 수 있습니다. hapR 은 다양한 프로모터 지역에 결합하고 유전자와 오페론 발현을 조절하는 V. cholerae, HapR의 글로벌 조절기와 마스터 쿼럼 감지 조절기를 암호화합니다. V. cholerae 의 일부 병원성 균주는 hapR 유전자에서 자연적으로 발생하는 프레임 변이 돌연변이를 가지고 있으며, 이로 인해 독성 유전자 발현의 밀도 의존적 ​​조절이 24 , 25 개 손실되었다. 우유 한천 배지를 사용하여 HapR- 조절 프로테아제 활성을 측정하면 연구자는 특정 분리주가 기능적 HapR23을 함유하고 있는지 여부를 확인할 수 있습니다. 그만큼용혈 분석법은 적혈구를 용해시키는 용혈 효소를 분비하는 균주의 능력을 시험한다. 용혈 정도를 혈액 한천 플레이트 23 에서 시각화 할 수 있습니다. 운동성은 종종 V. cholerae의 병독성과 관련이 있으며 운동성 한천 플레이트 23을 사용하여 분석 할 수 있습니다. Voges-Proskauer assay는 포도당을 유일한 탄소원으로 발효시켜 부산물 인 acetoin 21 을 생산하는 균주의 능력을 시험합니다. 엘 토르 (El Tor) 변종이 출현함에 따라 광범위한 유전자형 스크리닝없이 V의 바이오 타입 배경을 추론하기 전에 주어진 표현형 분석의 결과를 예측하기가 어렵습니다. cholerae isolates의 경우, assays 23 의이 assembly를 수행하고 그 결과를 표 2 에서와 같이 참조 균주와 비교하는 것이 추천된다.

여기서 우리는 일련의 프로토콜을 발전 시켰으며,V 를 특성화하기위한보다 포괄적 인 접근을위한 genotypic 및 phenotypic 분석법의 사용. cholerae biotypes. 또한, 우리는 알려진 V 의 genotypic 및 phenotypic 구분을 설명했다. (WT 고전적 O395, WT El Tor C6706 및 WT El Tor N16961, 표 1 )와 비교하여, 콜레라 엘 토르 변이체 (MQ1795 및 BAA-2163)를 사용하는 것이 바람직하다. 엘 토르 (El Tor) 변종의 출현은 이전에 사용 된 단일 분석 생물 형질 규명 프로토콜의 신뢰성에 대한 문제점을 제기했다. 그러나,이 다중 분석법 식별 시스템은 임상 및 환경 V 의보다 신뢰성있는 특성 분석을 가능하게합니다. cholerae isolates.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

참고 : 개별 배지 준비가 다른 시간을 필요로하기 때문에 각 분석에 대한 시간 고려 사항을 만들어야합니다. 예를 들어, 고체 한천 평판 배지는 충분히 냉각되고 건조되어야합니다 (1-2 일). 추가적인 시간 고려 사항 ( 즉, 단일 식민지와 야간 배양기의 성장)은 각 프로토콜에 명시되어 있으며 표 2나와 있습니다.

1. 미디어 준비

  1. 1x Phosphate Buffered Saline (PBS)
    1. NaCl 4.0g, KCl 0.1g, Na2HPO4 0.72g 및 KH2PO4 0.12g을 칭량한다. 1 L 삼각 플라스크에 성분을 합하고, 탈 이온수로 부피를 500 mL로 조정하고, pH 미터를 사용하여 pH를 7.2로 조정하고, HCl을 용액에 적가 한 다음, 0.22 ㎛ 필터를 사용하여 오토 클레이브 또는 필터 멸균한다. 1x PBS는 실온에서 무기한 보관할 수 있습니다.
      주의 : HCl은 농축산이므로 취급시주의해야합니다.기관, 지방, 주 및 연방 규정에 따라 다릅니다. 적절한 취급 지침은 제조업체가 제공 한 안전 데이터 시트를 참조하십시오.
  2. Luria-Bertani (LB) 배지
    1. 트립 톤 5.0g, 효모 추출물 2.5g, NaCl 2.5g. 구성 성분을 1L 병에 넣고 탈 이온수, 오토 클레이브로 500mL로 부피를 조절하고 최대 6 개월 동안 실온에서 보관하십시오. 고전적인 생물 형 독성 유발 조건의 경우, 오토 클레이브 전에 HCl을 사용하여 pH를 6.5로 조정하십시오.
  3. 0.03 % (w / v) NaHCO3를 함유하는 AKI 배지
    1. 성분 1 (AKI 배지)의 경우 : 펩톤 7.5g, 효모 추출물 2.0g 및 NaCl 2.5g의 무게를 잰다. 1 L 병에 성분을 넣고 탈 이온수와 오토 클레이브로 용량을 450 mL로 맞 춥니 다. AKI 배지는 실온에서 최대 6 개월 동안 보관할 수 있습니다.
    2. 성분 2 (NaHCO3)의 경우 : 1.5g NaHCO3의 무게를 재고, 부피를 조절한다멸균 된 소포에서 탈 이온수로 50 mL로. 0.22 μm 필터를 사용하여 NaHCO 3 을 멸균 여과하십시오. NaHCO 3 는 사용 직전에 준비해야합니다.
    3. 사용하기 전에 구성 요소 2를 구성 요소 1로 필터링하여 1:10 비율을 만드는 두 구성 요소를 무작위로 결합합니다.
  4. Luria-Bertani (LB) 한천 플레이트
    1. 트립 톤 5.0 g, 효모 추출물 2.5 g, NaCl 2.5 g 및 한천 7.5 g의 무게를 잰다. 1L 삼각 플라스크에 성분을 넣고 탈 이온수, 오토 클레이브로 500mL로 부피를 조절하고 표준 크기의 100mm x 15mm 무균 페트리 접시로 준비합니다. 도금 된 배지는 최대 6 개월 동안 플라스틱으로 싸서 보관할 수 있으며, 뚜껑면이 위로 4 ° C까지 보관할 수 있습니다.
  5. Polymyxin B가 보충 된 LB 한천 플레이트
    1. 성분 1 (LB 한천)의 경우 : 트립 톤 5.0 g, 효모 추출물 2.5 g, NaCl 2.5 g 및 한천 7.5 g을 잰다. 성분을 1L 삼각 플라스크에 합치고 부피를 500 mL로 맞춘다.탈 이온수 및 오토 클레이브.
    2. 성분 2 (polymyxin B)의 경우 : 멸균 된 2 mL microcentrifuge tube에서 탈 이온수에 polymyxin B를 50,000 IU / μL의 농도로 용해시키고 0.22 μm 필터를 사용하여 필터 살균합니다.
    3. 일단 성분 1이 차갑지 만 아직 고화되지 않으면 무균 적으로 성분 2 500 μL를 성분 1에 첨가하여 50 IU / μL의 최종 농도를 만들고 철저하게 혼합합니다. 페트리 접시에 혼합 한천 미디어를 부어 표준 크기의 100mm x 15mm 멸균 배양 접시에서 준비합니다. 도금 된 용지는 최대 3 개월 동안 플라스틱으로 싸서 보관할 수 있으며, 뚜껑이있는 쪽은 4 ° C까지 보관할 수 있습니다.
  6. 최소 구연산염 중형 한천 플레이트
    1. 성분 1 (브롬 티몰 블루가 포함 된 한천) : 7.5g 한천과 0.02g 브로 모티 몰 블루. 1L 엘렌 마이어 플라스크에 성분을 넣고 탈 이온수로 450mL로 부피를 조절하고 혼합물을 고압 멸균한다.
    2. 구성 요소 2 (10x VBMM)의 경우 : 1MgSO4 7H2O 10g, 구연산 H2O 10.0g, K 2 HPO 4 무수물 50.0g 및 NaNH 4 HPO 4 4H 2 O 17.5g을 넣는다. 1L 삼각 플라스크에 성분을 합하여 용량을 500mL 탈 이온수 및 오토 클레이브로 여과하거나 0.22 ㎛ 필터를 사용하여 필터 살균합니다. 10x VBMM은 실온에서 6 개월까지 저장할 수 있습니다.
    3. 구성 요소 1에 구성 요소 2 50 ML을 추가하고 페트리 접시에 혼합 한천 미디어를 부어 표준 크기의 100mm x 15mm 무균 페트리 접시에서 준비하십시오. 도금 된 배지는 최대 6 개월 동안 플라스틱으로 싸서 보관할 수 있으며, 뚜껑면이 위로 4 ° C까지 보관할 수 있습니다.
  7. 우유 한천 접시
    1. 성분 1 (우유)의 경우 : 1L 삼각 플라스크에 인스턴트 무 지방 분유 8.0g을 달아 탈 이온수와 오토 클레이브로 부피를 200mL로 맞춘다.
    2. 성분 2 (뇌 심장 주입 한천) : 뇌 심장 주입 3.68 g과 한천 6.0 g의 무게를 잰다. 사기를 맺어 라.수용액을 500 mL 삼각 플라스크에 넣고 탈 이온수와 오토 클레이브로 부피를 200 mL로 맞춘다.
    3. 오토 클레이브 한 후 성분 2를 성분 1에 붓고 두 성분을 혼합하고 철저히 혼합합니다. 150mm x 15mm 무균 페트리 접시를 준비하십시오. 밀크 플레이트는 플라스틱으로 싸여 1 주일 동안 보관할 수 있으며, 뚜껑면이 아래로 4 ° C 아래에 보관할 수 있습니다. 페트리 접시에 혼합 한천 미디어를 부어 150mm x 15mm 무균 페트리 접시에서 준비합니다.
  8. 운동성 한천 플레이트
    1. 성분 1 (LB 한천) : tryptone 5.0g, 효모 추출물 2.5g, NaCl 2.5g 및 한천 2.0g을 잰다. 1L 엘렌 마이어 플라스크에 성분을 넣고 탈 이온수와 오토 클레이브로 부피를 500mL로 맞춘다.
    2. 성분 2 (1 % (w / v) 트리 페닐 테트라 졸륨 클로라이드; TTC) : 0.25 g TTC의 무게. 멸균 소포에서 탈 이온수로 25 mL로 부피를 조정하고 0.22 μm 필터를 사용하여 필터 살균합니다. 상온에서 6 개월 동안 보관하십시오.광 노출을 최소화하기 위해 호일에 넣습니다.
    3. 1 % (w / v) 멸균 TTC 2.5 ML을 autoclaved 미디어에 추가합니다.
    4. 대형 150mm x 15mm 무균 페트리 접시에 가능한 한 두꺼운 배지 (≥50mL / 플레이트)를 붓습니다. 도금 된 미디어는 최대 1 주일 동안 플라스틱으로 싸서 보관할 수 있으며, 뚜껑면이 위로 4 ° C까지 보관할 수 있습니다. 페트리 접시에 혼합 한천 미디어를 부어 150mm x 15mm 무균 페트리 접시에서 준비합니다.
  9. 보그 - 프로스카 우어 (VP)
    1. 성분 1 (Methyl Red-Voges-Proskauer broth, MR-VP) : 500 mL 삼각 플라스크에 1.7 g MR-VP 배지를 달고 탈 이온수와 오토 클레이브로 100 mL로 부피를 조절한다. 무균 MR-VP 배지는 실온에서 6 개월까지 보관할 수 있습니다.
    2. 성분 2 (5 % (w / v) 알파 (나) 나프톨)의 경우 : 멸균 소포에서 1.0 g의 α- 나프톨을 달아 95 % 에탄올로 20 mL로 부피를 조절한다. α- 나프톨은 실온에서 최대 1 주간 호일에 싸여 가벼운 효과를 최소화 할 수 있습니다.오 슈레.
    3. 성분 3 (40 % (w / v) 수산화 칼륨, KOH) : 멸균 소포에서 KOH 20.0g을 멸균 탈 이온수로 50mL로 부피를 조절한다. KOH는 상온에서 최대 6 개월 동안 플라스틱 용기에 보관할 수 있습니다.

2. V의 유지와 성장. 콜레라 균 균주

  1. 냉동 주식 배양 물의 준비와 사용
    1. 멸균 2 ML microcentrifuge 튜브에서 centrifugation (≥8,600 xg)에 의해 2 분 동안 액체 밤새 문화의 펠렛 1.8 ML, 뜨는 제거하고 pipetting하여 신선한 LB 국물의 900 μL에서 세포 펠렛을 다시 일시 중지합니다.
    2. 멸균 60 % (V / V) 글리세롤 900 μL를 배양 물에 넣고 볼 텍싱하여 혼합합니다.
    3. 혼합물을 멸균 2 mL 극저온 튜브에 옮기고 -80 ° C에 무기한 보관하십시오.
    4. 사용하려면 LB ag에 단일 식민지에 대한 멸균 접종 루프 및 줄무늬를 사용하여 소량의 얼어 붙은 주식을 제거하십시오ar 접시. 배양 물이 완전히 해동되는 것을 방지하기 위해 냉동 재고를 사용 후 즉시 -80 ° C로 되돌립니다. 37 ° C에서 12 ~ 16 시간 동안 뚜껑을 아래로하여 배양 판을 배양하십시오.
  2. 액체 배지에서의 밤새 배양의 성장
    1. 얼린 주식에서 LB 한천 플레이트로 단일 식민지에 대한 줄무늬 (섹션 2.1.4에 따라). 37 ° C에서 12 ~ 16 시간 동안 뚜껑을 아래로하여 배양 판을 배양하십시오.
    2. 멸균 어플리케이터 스틱으로 단일 식민지의 표면을 만지고 액체 배지로 식민지를 전송하여 단일 식민지와 멸균 10 ML 배양 튜브에 액체 LB 배양액 4 ML을 예방 접종.
    3. 37 ° C에서 12 ~ 16 시간 동안 225 rpm으로 쉐이커 배양기에서 통기와 함께 품어 낸다.
  3. 성장 곡선
    1. 이전에 프로토콜 2.2에 명시된대로 액체 LB 배지에서 밤새 문화를 준비합니다.
    2. 밤새 문화 250 μL를 2로 옮겨서 야간 배양 물을 1 : 100로 희석한다.멸균 된 250 mL 삼각 플라스크에 5 mL의 신선한 LB 브로스.
    3. 접종 시간 (T 0 )에 시작하여 매시간 600 nm (OD 600 )에서 액체 배양 물의 광학 밀도를 측정합니다.
    4. 37 ° C에서 30 시간 동안 225 rpm의 쉐이커 배양기에서 통기와 함께 밤새 배양 한 1 : 100 희석 배양 물을 배양하거나 배양액이 최대 밀도에 도달 할 때까지 배양하십시오.
    5. OD 600 vs. Time을 그래프로 표시하고 선형 회귀를 사용하여 각 변형에 대한 대략적인 배가 시간을 결정합니다.
  4. 엘 토르 바이오 타입 병원성 유도 조건
    1. 얼린 주식에서 LB 한천 접시에 단일 식민지에 대한 줄무늬. 37 ° C에서 12 ~ 16 시간 동안 플레이트 뚜껑면을 아래로 배양하십시오.
    2. 단일 식민지와 0.03 % (w / v) NaHCO 3 함유 AKI 매체 10 ML을 예방 접종.
    3. 37 ° C에서 3.5 시간 통기없이 배양하십시오.
    4. 배양액 7 mL를 제거하고 나머지 3 mL 배양쉐이커 인큐베이터 (saker incubator)에서 225rpm으로 폭기하여 추가 4 시간.
  5. 고전적 Biotype 병적 상태 유도 조건
    1. 얼린 주식에서 LB 한천 접시에 단일 식민지에 대한 줄무늬. 37 ° C에서 12 ~ 16 시간 동안 뚜껑을 아래로하여 배양 판을 배양하십시오.
    2. 단일 콜로니와 함께 4 ML 액체 LB 브로스 (pH 6.5)를 예방 접종.
    3. 30 ° C에서 12 ~ 16 시간 동안 225 rpm으로 쉐이커 인큐베이터에서 폭기로 품어 낸다.
  6. 1x PBS로 세척 셀 펠렛
    1. 멸균 2 ML microcentrifuge 튜브에서 원심 분리 (≥8,600 XG)에 의해 2 분 동안 밤새 문화의 펠렛 1.8 ML 및 피펫을 사용하여 뜨는을 제거하십시오. pipetting하여 1.8 ML 1X PBS에서 세포 펠렛을 다시 중단하십시오.
    2. 1.8 ML 1X PBS에서 최종 resuspension 다음에 세 번 세척 절차를 반복합니다.

3. V 특성화. cholerae Biotypes

  1. ctxBtcpA 를 이용한 CR 기반 유전자 스크린
    1. ctxB 및 tcpA의 번역 시작 및 정지 부위의 상류 및 하류에 각각 약 50-70 bp 어닐링하는 프라이머 세트를 설계하십시오.
    2. 이전에 프로토콜 2.2에 명시된대로 액체 LB 배지에서 밤새 문화를 준비합니다.
    3. 염색체 DNA를 그람 음성 세균 용으로 설계된 시판용 키트를 사용하여 분리합니다. 정화 된 염색체 DNA는 -20 ° C에서 무기한 보관할 수 있습니다. 상업적으로 이용 가능한 키트를 사용하는 염색체 DNA 분리는 일반적으로 약 4 시간이 걸립니다.
    4. 마이크로 볼륨 분광 광도계를 사용하여 염색체 DNA 샘플이 고품질 (A 260/280 > 1.8)인지 확인하십시오.
    5. 각 염색체 DNA 단리에 대해 멸균 200 μL PCR 튜브 (s)에서 얼음으로 중합 효소 연쇄 반응 (PCR)을 만들고 표준 PCR 성분을 사용하여 ctxBtcpA의 영역을 증폭시킵니다 : Taq polymerase and buffer (또는 등가물), dNTP 용액 및 정방향 / 역방향 프라이머가 포함됩니다. 표준 PCR 매개 변수를 사용하십시오 (~ 3 시간). 예를 들어, 다음 프로토콜을 사용하십시오.
      1. 95 ° C에서 120 초 동안 초기 변성.
      2. 95 ° C에서 60 초 동안 변성.
      3. 60 ° C에서 45 초 동안 Anneal 프라이머.
      4. 72 ° C에서 90 초간 연장하십시오.
      5. 34 사이클 동안 3.1.5.2 ~ 3.1.5.4 단계를 반복하십시오.
      6. 최종 연장 72 ° C에서 600 초.
      7. 4 ° C에서 무한히 기다리십시오.
    6. 표준 6X DNA 겔로드 염료를 사용하여 각각의 PCR 산물 5 μL를 염색하고 1X Tris-Borate-EDTA (TBE)의 1 % 아가 로스 젤에 1 kb 사다리와 10 μL의 PCR 산물 약 10 μL를 넣습니다. 완충기.
    7. 염료 전선이 젤의 끝 부분에 도달 할 때까지 130V에서 겔 전기 영동을 실행하십시오 (약 90 분). 전압에 따라 지속적인 모니터링이 권장되며 장비에 따라 작동 시간이 다를 수 있습니다.
    8. 확인시예상 크기의 성공적인 PCR 증폭, 시중에서 판매하는 DNA 청정 및 농축기 키트를 사용하여 나머지 45 μL PCR 생성물을 정제하십시오.
    9. PCR 증폭에 사용 된 것과 동일한 프라이머를 사용하여 PCR 제품을 세척하고 로컬 시퀀싱 설비 지침에 따라 준비하십시오.
    10. 검색 결과 상자에서 다음 수식 번호를 검색하여 NCBI 웹 사이트 (http://www.ncbi.nlm.nih.gov/gene/)에서 사용할 수있는 출판 된 서열에 대한 각각의 분리 된 유전자 서열의 FASTA 형식을 비교하십시오.
    11. ctxB : (클래식) VC0395_A1059 ~ VC0395_A1060 (엘 토르) VC_1456
    12. tcpA : (클래식) VC0395_A0353 (엘 토르) VC_0828
  2. Spotting을 통한 Biotype 분류를위한 Phenotypic Assays
    1. 이전에 프로토콜 2.2에 명시된대로 액체 LB 배지에서 밤새 문화를 준비합니다.
    2. 프로토콜 2.6에 명시된대로 세포 펠렛을 씻으십시오.
    3. 피펫을 사용하여세척 한 배양액 1 μL를 각각의 배지에 넣는다. 중간 배양 및 항온 배양에 대해서는 표 2를 참조하십시오.
  3. 운동성 분석
    1. 앞서 프로토콜 2.2에 명시된대로 액체 LB 배지에서 밤새 문화를 준비합니다.
    2. 프로토콜 2.6에 명시된대로 세포 펠렛을 씻으십시오.
    3. 씻은 액체 배양액에 주사 접종을 삽입하고 배지에 수직으로 "삽입"하여 운동성 한천 플레이트를 접종합니다. 각 접종 사이에 Bunsen 버너를 사용하여 와이어 찌꺼기를 멸균하고, 한천을 찔렀을 때 접종 된 찌름이 구부러지지 않도록하십시오. 결과가 바뀔 수 있습니다.
    4. 37 ° C에서 14 ~ 24 시간 동안 뚜껑이 위를 향하도록 플레이트를 배양하십시오. 14 시간 후, 운동성 플레이트를 면밀히 모니터하여 배양 물의 과증식을 예방하십시오.
  4. Voges-Proskauer (VP) 분석법
    1. 앞서 프로토콜 2.2에 명시된대로 액체 LB 배지에서 밤새 문화를 준비합니다.
    2. 접종 4미리 준비한 하룻밤 배양액 10 μL를 멸균 배양 튜브에서 MR-VP broth 4 mL에 pipette하고, 쉐이커 배양기에서 225 rpm으로 12에서 16 사이의 통기와 함께 배양하여 메틸 레드 Voges-Proskauer 또는 MR-VP broth h에서 37 ° C.
    3. 멸균 배양 튜브에서 MR - VP 하룻밤 배양의 1 ML의 aliquots 각각 5 % (W / V) α- 나프톨과 50 μL 40 % (W / V) KOH 150 μL를 추가합니다.
    4. 간단히 와동하고 색상 변화가 발생할 때까지 최대 4 시간 동안 실온에서 방치합니다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

박테리아 균주의 적절한 유지 관리 및 사용을 위해서는 관심있는 균주의 배가 시간을 알아 두는 것이 좋습니다. 여기서, 일반적으로 사용되는 V 의 변화하는 성장 속도. 콜레라 균주는 성장 곡선을 통해 입증되었고 근사 배가 시간은 선형 회귀를 사용하여 계산되었다. WT El Tor N16961 및 El Tor 변종 MQ1795는 WT 고전 O395 (~ 2 시간)보다 짧은 배증 시간 (각각 1 시간 및 ~ 1 시간)을 나타냈다 ( 그림 1 ; 표 2 ).

V. cholerae의 유전자 조작 및 후속 분석은 종종 생물 형을 적절하게 구별하는 능력에 의존한다. PCR 기반의 유전자 스크린과 표현형 분석은 총체적으로 V 형의 생물 형질을 구별하는 신뢰성있는 시스템으로 수행되었다. cholerae 임상 및 환경 isolates; (WT 고전적 O395, WT El Tor C6706 및 WT El Tor N16961) 및 대표적인 El Tor 변종 (MQ1795 및 BAA-2163)이 포함되었다 ( 표 1 ). WT 고전 O395는 고전적인 ctxBtcpA 염기 서열을 보였다. 반대로, WT El Tor 균주 N16961 및 C6706은 El Tor ctxBtcpA 서열을 시연했다. 흥미롭게도, MQ1795와 BAA-2163은 O395에 필적할만한 고전적인 바이오 타입 ctxB 서브 유닛을 포함하고 있었지만, 엘 토르 변이체 모두 엘 토르 바이오 타입 배경을 나타내는 tcpA를 포함하고 있었다 ( 표 1 ). WT 클래식 바이오 타입 O395 균주는 polymyxin B에 민감성을 보였으 나, WT El Tor 바이오 타입 균주 (C6706 및 N16961)는 polymyxin B가 첨가 된 LB 한천 플레이트에서 저항성을 보였으며 성장을 보였다. 대표적인 El Tor 변형 균주 (MQ1795 및 BAA-2163) WT El Tor 생물 형에 비하여 항생제와 유사한 내성ins (C6706 및 N16961) ( 도 2 ; 표 2 ). WT 고전적인 생물 형 O395는 최소한의 구연산 배지에서 자라지 않았고, WT El Tor 균주 (C6706 및 N16961)는 구연산염을 탄소원으로 활용할 수 있었고 최소한의 구연산염 배지에서 성장을 보였다. 대표적인 엘 토르 변종 생물 유형 (MQ1795 및 BAA-2163)은 WT El Tor 생물 형 (C6706 및 N16961)과 비교하여 성장을 나타내었다 ( 그림 3 ; 표 2 ). WT 고전 균주 O395 및 WT El Tor 균주 N16961은 비 기능성 HapR을 보유하고, 따라서 HapR 조절 프로테아제 활성을 나타내지 않았다; WT El Tor strain C6706 및 대표적인 El Tor 변이체 (MQ1795 및 BAA-2163)는 접종 시점에서 방출되는 공간의 영역으로서 hapR- 양성 - 시각화된다 ( 도 4 ; 표 2 ). WT 고전 균주 O395는 용혈 효소를 분비하지 않으며 그 때문에 사용되었다.(C6706과 N16961)과 대표적인 El Tor 변종 균주 (MQ1795와 BAA-2163)는 적혈구를 완전히 접종하고 β- 용혈을 나타내는 용혈 효소를 분비 한다. 5 ; 표 2 ). 운동성은 바이오 타입 균주에 따라 다양합니다. 그러나 WT El Tor 균주 N16961 및 El Tor 변이주 (MQ1795 및 BAA-2163)는 비교적 덜 운동성이있는 WT 고전 균주 O395 및 WT El Tor 균주 C6706과 비교할 때과 운동성을 나타내었다 ( 그림 6 ; 표 2 ). WT 고전적 균주 O395와 대표적인 El Tor 변이체는 포도당을 대사하여 아세토 인을 생산하지 못했지만, WT El Tor 생물 형은 Voges-Proskauer 분석에서 짙은 붉은 색의 발달로 표시되는 바와 같이 포도당 발효 부산물로 아세토 인을 생산했습니다 ( 그림 7 표 2 ).

변형 ctxB 유전자 tcpA 참고
기지 115 기지 203 생물 형질 생물 형질
O395 기음 기음 고전 고전 8
C6706 엘 토르 엘 토르 8
N16961 El Tor 엘 토르 8
MQ1795 기음 기음 고전 엘 토르 13
BAA-2163 기음 기음 고전 엘 토르 8

도표 1 : Vibrio cholerae 참고 계통 의 Biotype에 의존하는 유전자 구별 . 이 표에는 DNA 염기 변화 및 유전자 ctxBtcpA 의 상대 위치가 표시되어있다. WT 고전 O395 및 WT El Tor 균주 N16961 및 C6706은 일반적으로 사용되는 생물 형 참조 균주입니다. MQ1795 및 BAA-2163은 El Tor 변형으로 알려져 있습니다.

시험 신청 중간 선택 잠복 예상 결과
O395 C6706 N16961 MQ1795 BAA-2163
2.3) 성장 곡선 27 다양한 V. cholerae 균주 배가 결정 1.2) 액체 LB 배지 최대 30 시간 (폭기시 37 ° C) ~ 2 시간 ND * ~ 1 시간 ~ 1 시간 ND *
3.1) ctxB와 tcpA를 이용한 PCR 기반 유전자 스크린 8 ctxB의 클래식 및 엘로 바이오 타입 배경을 구별합니다. N / A N / A 고전 엘 토르 엘 토르 고전 고전
tcpA의 클래식 및 엘로 바이오 타입 배경을 구별합니다. N / A N / A 고전 엘 토르 엘 토르 엘 토르 엘 토르
3.2) 폴리 믹신 B 저항 21 항생제 polymyxin B에 대한 감도 1.5) 폴리 믹신 B가 보충 된 LB 한천 플레이트 18 시간 (37 ℃) - + + + +
3.2) 구연산 대사 22 구연산염을 유일한 탄소원으로 대사시키는 능력 1.6) 최소 구연산 배지 한천 플레이트 24 시간 (37 ℃) - + + + +
3.2) 카제인 가수 분해 23 HapR- 조절 프로테아제 활성 1.7) 우유 한천 접시 18 시간 (37 ℃) - - + + +
3.2) 용혈 23 용혈 활성 측정 혈액 한천 플레이트 48 시간 (37 ℃) 감마 베타 베타 베타 베타
3.3) 운동성 23 운동성 측정 정도 1.8) 운동성 한천 플레이트 14 ~ 24 시간 (37 ° C) 10 mm 15 mm 21 mm 25 mm 29 mm
3.4) 보그 - 프로스카 우어 21 glocose를 발효시키고 아세톤을 부산물로 생성하는 능력 측정 1.9) 액체 Voges-Proskauer 배지 최대 4 시간 (실내 온도) - + + - -
참고 : "ND *"는 결정되지 않음을 나타냅니다. "+"는 긍정적 결과를 나타냅니다. "-"는 부정적인 결과를 나타냅니다.

표 2 : 사용 된 유전 및 표본 검정 분석 요약 Vibrio cholerae Biotype Distinction. 이 표는 다양한 유전 및 표현형 분석, 응용 및이 연구에서 사용 된 고전 및 엘 토 바이오 타입을 구별하기 위해 집합 적으로 사용 된 예상 결과를 요약합니다. 특정 프로토콜에 대한 프로토콜 번호 및 참조는 분석 열에 표시됩니다. "ND *"는 결정 되지 않음을 나타냅니다 . "+"는 긍정적 결과를 나타냅니다. "-"는 부정적인 결과를 나타냅니다.

그림 1
그림 1 : V. WT Classical O395, WT El Tor N16961 및 El Tor 변형 MQ1795의 콜레라 성장 곡선. 37 ℃에서 폭기하여 LB 배지에서 성장시킨 바이오 타입 참조 균주 (WT 고전 O395 및 WT El Tor N16961) 및 대표적인 El Tor 변형 MQ1795의 성장 속도를 OD 600 eT0에서 시작되는 매우 시간. 성장 곡선은 각각의 시험을위한 독립적 인 배양 사건을 나타내는 8 개의 독립적 인 실험 복제물에서 수행되었다. WT El Tor 균주 N16961 및 El Tor 변이체 MQ1795는 더 긴 배가 시간에 의해 관찰 된 바와 같이 WT 고전 균주 O395 (~ 2 시간)에 비해 더 짧은 배가 시간 (~ 1 시간 및 ~ 1 시간)을 나타냈다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 2
그림 2 : Polymyxin B.로 보충 LB의 한천을 사용하여 Polymyxin B 저항을 결정 펩티드 항생제 polymyxin B에 저항력은 50 IU / μL polymyxin B. 보충 LB 한천에서 성장하는 능력에 의해 결정되었다 WT 고전적 변형 O395는 한천 supplpolymyxin B와 함께 항진균제에 민감한 것으로 간주되었다. WT El Tor 균주 (C6706 및 N16961)와 대표적인 El Tor 변이 형 (MQ1795 및 BAA-2163)은 항생제 존재 하에서 성장을 나타내었고 polymyxin B에 내성이 있다고 여겨졌습니다. 플레이트는 37 시간 동안 18 시간 동안 배양되었습니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 3
그림 3 : 최소 구연산염 매체를 사용하여 구연산염 대사 측정. 단일 탄소원으로 구연산염을 활용하는 능력은 최소 구연산염 배지에서 분리 균주의 능력에 의해 결정되었습니다. WT 고전 균주 O395는 최소한의 구연산 배지에서 자라지 않았다 (음성). 성장은 모든 WT El Tor 균주 (C6706 및 N16961)와 대표 El토르 변종 (MQ1795 및 BAA-2163)은 구연산염을 유일한 탄소 공급원으로 활용하는 능력을 보여 주었다. 플레이트를 37 ℃에서 18 시간 동안 배양 하였다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 4
도표 4 : 우유 한천 매체를 사용하여 HapR 통제 된 단백질 분해성 가수 분해 가수 분해 측정. HapR- 조절 된 프로테아제 활성을 통한 카제인 가수 분해는 우유 한천에서 접종 점을 둘러싼 뚜껑의 가시 영역에 의해 결정되었다. WT 고전 균주 O395 및 WT El Tor 균주 N16961과 같은 비 기능성 HapR을 함유하는 균주는 접종 점 ( hapR- 음성)을 둘러싸는 제거 영역을 생성하지 않았다. WT El Tor 변형 C6706 및 대표적인 El Tor 변형체 (MQ1795 및 BAA-2163)에는 기능적 HapR이 포함되어 있으며, 이는 다양한 크기의 제거 영역 ( hapR- 양성)으로 시각화 할 수 있습니다. 플레이트를 37 ℃에서 18 시간 동안 배양 하였다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 5
그림 5 : 혈액 한천 배지를 사용하여 용혈 활성 측정. 용혈 활성은 양의 혈액이 보충 된 한천 플레이트를 사용하여 측정되었다. WT 고전 균주 O395는 적혈구를 용해시키는 효소 (γ- 용혈성)를 분비하지 않습니다. WT El Tor 균주 (N16961 및 C6706)와 대표적인 El Tor 변이체 (MQ1795 및 BAA-2163)는 용균 효소를 분비하여 접종 지점을 둘러싸는 반투명 영역 (베타 용혈)을 초래합니다. 플레이트를 37 ℃에서 배양 하였다.° C에서 48 시간. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 6
그림 6 : 운동성 한천 플레이트를 사용하여 운동성 결정. 운동성 구역은 소금물 TTC의 시각적 인 색 변화로 나타내 었으며, 대사가되면 투명에서 빨간색으로 변하여 박테리아가 움직이는 곳을 나타냅니다. El Tor 변형 N16961 (21 mm) 및 대표적인 El Tor 변형 (MQ1795 (25 mm) 및 BAA-2163 (29 mm))은 WT 표준 변형 O395 (10 mm) 및 WT El Tor 변형 C6706 (15 mm) )은 O395 및 C6706에 비해과 운동성을 입증했다. 플레이트를 37 ℃에서 18 시간 동안 배양 하였다. 클릭하세요이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 7
그림 7 : Voges-Proskauer 분석. 포도당 발효를 통한 아세토 인 생산은 Voges-Proskauer 분석을 사용하여 결정되었다. WT 고전 균주 O395 및 대표적인 El Tor 변이체 (MQ1795 및 BAA-2163)는 포도당 발효의 결과로서 아세토 인을 생성하지 않았다 (음성). WT El Tor 균주 (N16961 및 C6706)는 부산물 인 아세토 인을 생산하며 진한 적색 변화 (양성)로 시각화 할 수 있습니다. 튜브를 실온에서 4 시간 동안 인큐베이션 하였다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

200 개 이상의 식별 된 V 중 . cholerae serogroups, 오직 O1과 O139만이 전염병 가능성이있다. O1 혈청 그룹은 클래식과 엘 토르의 두 가지 바이오 타입으로 나눌 수 있습니다. 그러나 엘 토르 (El Tor) 변종 13,17이라고 불리는 하이브리드 계통이 엘 토르 (El Tor) 바이오 타입 배경을 가지고 있으며 고전적 특성 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17을 가지고 있다. 이 원고에 설명 된 프로토콜은 V. cholerae 의 다양한 임상 및 비 임상 분리 물을 특성화 및 / 또는 구별하는데 관심있는 조사자에게 신뢰할 수있는다중 분석법 식별 시스템. 대안으로 신뢰할 수있는 멀티 분석법 식별 시스템을 사용하면 이전에 확립 된 단일 분석법 식별 시스템 및 노동 집약적 인 유전자 스크린을 개선 할 수 있습니다. 모든 genotypic 및 phenotypic 분석은 비교를 위해 WT 고전 균주 O395 및 WT El Tor 균주 C6706 및 N16961을 포함해야합니다 ( 표 1 ). 본 연구에 포함 된 MQ1795 및 BAA-2163과 같은 분리 균주는 생물학적 유형 ( 그림 2 , 그림 3 , 그림 4 , 그림 5 , 그림 6 , 그림 7 ) 중 하나의 표현형 프로파일을 표시 할 수 있습니다. 도 7 ; 표 2 ), 신뢰할 수있는 특성화를위한 다중 유전형 및 표현형 형질 분석의 필요성을 설명한다. 모든 프로토콜은 무균 처리해야합니다.달리 명시하지 않는 한 상온에서 26 ℃. V. 콜레라 (cholerae )는 잠재적으로 치명적인 위장병 콜레라의 원인균 인 BSO-2 (Biosafety Level 2) 병원균입니다. 모든 재료 및 폐기물의 적절한 취급 및 폐기는 기관, 지방, 주 및 연방 규정에 따라 시행되어야합니다.

모든 매질 및 시약의 준비는 분석 등급 시약 및 18MΩ-cm의 최소 감도로 탈 이온화 된 초순수를 사용하여 수행해야합니다. 가공하기 전에 매체를 준비하고 충분히 건조시켜야합니다 (1-2 일). 플레이트는 한천 표면에 잔류 액체가 없을 때 충분히 건조한 것으로 간주됩니다. 운동성 범위와 박테리아 성장을 둘러싼 틈새 구역으로 인해, 운동성과 우유판은 대형 페트리 접시 (150 mm x 15 mm)에서 최대 50 mL / 플레이트까지 준비되어야하며 플라스틱으로 포장 된 최대 1 주일 동안 보관할 수 있습니다 리d면이 4 ºC에서 내려갑니다. 또한, 운동 판의 한천 농도는 운동성을 저하 시키도록 조절 될 수있다; 그러나 용액 500mL 당 한천 3g을 초과하는 것은 권장되지 않으며, 이는 전반적인 운동성을 현저하게 감소시켜 차이점을 관찰 할 수 없도록한다. 다른 모든 플레이트 배지는 표준 크기의 페트리 접시 (100mm x 15mm)에서 플레이트 당 약 25mL로 준비되어야하며 플라스틱으로 뚜껑을 덮은 상태에서 4ºC까지 6 개월 동안 보관할 수 있습니다. Polymyxin B 플레이트를 준비하려면 폴리 믹신 B를 첨가하기 전에 고온 가압 멸균 후 용융 된 배지를 식히는 것이 중요합니다. 과열로 인해 항생제가 저하 될 수 있습니다. Polymyxin B 플레이트는 플라스틱으로 싸여있는 최대 3 개월 동안 보관할 수 있으며 뚜껑면이 아래로 4ºC에 보관할 수 있습니다. 이 원고에서 논의 된 분석은 단일 식민지 성장 (12-16 시간), 밤새 문화의 성장을위한 추가 하루 (12-16 시간) 및 유전형 (염색체 DN의 경우 ~ 4 시간)A 격리 및 PCR ~ 3 시간) 또는 표현형 분석 (18-48 시간; 표 2 ). 이 원고에 설명 된 표현형 분석의 생화학 분석에 앞서 문화는 잔류 배양액의 이월을 막기 위해 1x PBS로 세척해야합니다. 또한, polymyxin B, 구연산염, 프로 테아 제 활성, 용혈 및 운동성 분석은 단일 세척 밤새 문화를 사용하여 동시에 예방 접종 수 있습니다. 도금 된 종이를 얼룩이지게 할 때, 문화의 튄 자국이 발생할 수 있으며, 균주간에 교차 오염을 일으킬 수 있습니다. 튀김을 방지하기 위해 피펫에서 배양 물을 완전히 꺼내는 대신 피펫의 첫 번째 멈춤에서 배양 물 방출을 중지하십시오. 또한, 부화하기 전에 반점이 한천 표면에 완전히 흡수되도록하고, 한천을 뚫지 않도록주의하십시오. 이로 인해 결과에 영향을 줄 수 있습니다. 클리어런스 영역을 초래하는 표현형 검정 (Phenotypic assays) ( 도 4 ; 도 5 ; 표 2) 및 / 또는 운동성 ( 도 6 ; 표 2 )은 각각의 직경이 비교 분석을 위해 측정 될 수있는 클리어런스 또는 성장 영역의 합병을 방지하도록 최대 간격으로 배치되어야한다. 지시 된 배양 시간 후, 분리 물을 바이오 타입 참조 균주 (WT 고전 O395, WT El Tor C6706 및 WT El Tor N16961)에 대해 영상화하고 분석 할 수있다.

이 원고에 소개 된 서열 분석을 통한 PCR 기반 유전자 스크린은 초기 PCR 증폭 후 ctxB 및 tcpA 와 관련하여 분리 물의 바이오 타입 배경을 확인하는데 사용될 수있다. 표준 시퀀싱 가이드 라인은 증폭 된 영역의 크기 (ctxB의 경우 580bp 및 tcpA의 경우 1420bp)에 따라 특정 양의 PCR 생성물을 요구하며, 반응을 설정하기 위해 확립 된 프로토콜을 따를 수 있습니다. 간단히 말해, 개별 전달 및 r이브 시퀀싱 반응은 3 ~ 5 pmol의 프라이머 / 반응으로 준비되어야하며, 부피는 1.5 mL 미세 원심 분리 튜브에서 멸균 초순수로 20 μl로 조정되어야합니다. PCR 증폭 및 시퀀싱을위한 프라이머 디자인에 대한 도움을 위해 NCBI 프라이머 디자인 툴 http://www.ncbi.nlm.nih.gov/tools/primer-blast/를 이용할 수 있습니다. 성공적인 증폭 및 ctxB와 tcpA의 시퀀싱은 다음같은 프라이머 (5 '→ 3')를 사용하여 수행되었습니다 : ctxB - forward GGGAATGCTCCAAGATCATCGATGAGTAATAC, ctxB - 반대로 CATCATCGAACCACAAAAAAGCTTACTGAGG, tcpA - 앞으로 CCGCACCAGATCCACGTAGGTGGG, tcpA - 반대로 GTCGGTACATCACCTGCTGTGGGGGCAG. ctxB 의 전체 코딩 영역은 기본 위치 115 및 203 (엘 토르의 클래식 및 티민 모두 시토신)을 제외하고 두 바이오 타입 모두에서 보존 된다는 점에 유의해야한다. 또한, tcpA 에서, 여러 가지 기본 변화가 biotypes 사이에 보존됩니다biotypes를 구별하는데 도움이 될 수있는 두 가지 biotypes ( 표 1 )에 걸쳐 iffer.

모델 유기체 V를 포함한 많은 실험실 연구에서. cholerae , 적절한 유지 관리 및 배양 기술이 중요합니다 27 . 일반적으로 사용되는 V 의 성장률. WT 고전 균주 O395 및 WT El Tor 균주 N16961과 같은 콜레라 (cholerae) 생물 형 참조 균주는 El Tor 변종 균주의 특성에 대한 유용한 통찰력을 제공 할 수있다 ( 그림 1 ; 표 2 ). V 에 걸쳐 다양한 성장률 때문입니다. cholerae isolates의 경우, 늦은 정지 단계에서 배양액이 최대 탁도에 도달 할 때까지 매 시간 분광 광도계 흡광도 값을 읽는 것이 중요합니다. 과도한 세포 파편으로 인한 혼탁의 고원으로 인해 중간에서 늦은 사멸 단계가 시각화되지 않을 수 있습니다. 배양액을 무균 L로 1 : 4 희석 흡광도 판독 값이 OD 600 ≈ 1.0에서 최고점에 도달하므로 B 육즙을 완전히 성장 곡선을 얻고 계측기의 정밀도를 유지하기 위해 수행해야합니다. 여러 균주에서 성장 곡선을 수행 할 때 판독 간의 일관성을 보장하기 위해 흡광도 판독 값을 각 균주마다 약 5 분 간격으로 측정해야합니다. V에 대한 이해 cholerae의 바이오 타입 성장률은 독성 유전자 발현 연구, 대사 활동 분석, 적절한 배양 및 보관 조건을 포함한 많은 연구에서 중요합니다. 후속 분석을 위해 밤새 문화는 세포 성장을 최대화하기 위해 초기 성장 단계 (12-16 시간)에 늦은 로그에서 처리해야하지만 세포의 완전성을 유지해야합니다.

그러나 고전 및 엘 토 바이오 타입 균주의 배양 조건은 V 에서 독성 유전자 발현의 분석과 유사하다. cholerae 는 생물 형 특이 적 독성 유발 조건을 요구한다.예를 들어, El Tor 독성 유도 조건 하에서, ToxT는 전체 세포 추출물을 처리함으로써 분석 될 수있다 (예를 들어, ToxT는 전체 세포 추출물을 처리함으로써 분석 될 수있다 WCE) 또는 세포 펠릿을 3.5 시간 동안 처리하고, CT 및 TCP 발현은 무 세포 상청액 및 WCE를 각각 7.5 시간 동안 처리하여 분석 할 수있다.이 원고 전반에 걸쳐 나타나는 다양한 유전자형 및 표현형 특성은 다양한 V. cholerae biotypes는 이전에 사용 된 single-assay biotype 특성화의 대안이 될 수 있으며이를 설명 할 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 할 것이 없습니다.

Acknowledgements

뉴 햄프셔 - 인 브레 (New Hampshire-INBRE)가 NIH의 국립 종합 의학 연구소 (National Medical Sciences of NIH)의 기관 개발상 (IDeA), P20GM103506을 통해 지원

Materials

Name Company Catalog Number Comments
1 kb DNA Ladder New England Biolabs N3232S https://www.neb.com/products/n3232-1-kb-dna-ladder
60% Glycerol Calbiochem 356352 http://www.emdmillipore.com/US/en/product/Glycerol%2C-Molecular-Biology-Grade---CAS-56-81-5---Calbiochem,EMD_BIO-356352
Agar Becto, Dickinson and Co. 214030 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=214030&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D214030%26typeOfSearch%3DproductSearch
Agar with brain-heart infusion Becto, Dickinson and Co. 237500 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=237500&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D237500%26typeOfSearch%3DproductSearch
Agarose Peqlab 732-2789 https://de.vwr.com/store/catalog/product.jsp?catalog_number=732-2789&_DARGS=/store/cms/de.vwr.com/de_DE/header_2016111711383215.jsp_AF&_dynSessConf=1766917479792147141&targetURL=/store/catalog/product.jsp%3Fcatalog_number%3D732-2789&lastLanguage=en&/vwr/userprofiling/EditPersonalInfoFormHandler.updateLocale=&_D%3AcurrentLanguage=+&currentLanguage=en&_D%3AlastLanguage=+&_D%3A/vwr/userprofiling/EditPersonalInfoFormHandler.updateLocale=+
Anhydrous K2HPO4 Fisher Scientific P288-500 https://www.fishersci.com/shop/products/potassium-phosphate-dibasic-anhydrous-crystalline-powder-certified-acs-fisher-chemical-5/p288500?searchHijack=true&searchTerm=P288500&searchType=RAPID
Blood Agar Plates Remel R01200 Store at 4 °C;  http://www.remel.com/Catalog/Item.aspx?name=Blood+Agar
Boric Acid Fisher Scientific A73-500 https://www.fishersci.com/shop/products/boric-acid-crystalline-certified-acs-fisher-chemical-6/a73500?searchHijack=true&searchTerm=A73500&searchType=RAPID
Bromothymol Blue Fisher Scientific B388-10 https://www.fishersci.com/shop/products/bromothymol-blue-certified-acs-fisher-chemical/b38810?searchHijack=true&searchTerm=B38810&searchType=RAPID
Cirtric acid ·H2O Fisher Scientific S72836-3 https://www.fishersci.com/shop/products/citric-acid-monohydrate-4/s728363#?keyword=s728363
Deoxynucleotide (dNTP) Solution Kit New England Biolabs N0446S Store at -20 °C;  https://www.neb.com/products/n0446-deoxynucleotide-solutionset
Disodium EDTA Fisher Scientific S311-500 https://www.fishersci.com/shop/products/ethylenediaminetetraacetic-acid-disodium-salt-dihydrate-crystalline-certified-acs-fisher-chemical-7/s311500?searchHijack=true&searchTerm=S311500&searchType=RAPID
DNA Clean & Concentrator™ -25 Kit Zymo Research D4007 http://www.zymoresearch.com/dna/dna-clean-up/zymoclean-gel-dna-recovery-kit
GelGreen Nucleic Acid Stain Biotium 41005 https://biotium.com/product/gelgreentm-nucleic-acid-gel-stain-10,000x-in-water/
Genesys 10SUV-VIS Spectrophotometer Thermo Scientific 840-208100 https://www.thermofisher.com/order/catalog/product/840-208100?ICID=search-840-208100
Gentra Puregene Yeast/Bact. Kit Qiagen 158567 https://www.qiagen.com/us/shop/sample-technologies/dna/dna-preparation/gentra-puregene-yeastbact-kit/#orderinginformation
HCl Fisher Scientific A144-212 Corrosive;  https://www.fishersci.com/shop/products/hydrochloric-acid-certified-acs-plus-fisher-chemical-10/a144212?searchHijack=true&searchTerm=A144212&searchType=RAPID
KCl Fisher Scientific P217-500 https://www.fishersci.com/shop/products/potassium-chloride-crystalline-certified-acs-fisher-chemical-4/p217500?searchHijack=true&searchTerm=P217500&searchType=RAPID
KH2PO4 Fisher Scientific P285-500 https://www.fishersci.com/shop/products/potassium-phosphate-monobasic-crystalline-certified-acs-fisher-chemical-5/p285500?searchHijack=true&searchTerm=P285500&searchType=RAPID
KOH Fisher Scientific P250-500 https://www.fishersci.com/shop/products/potassium-hydroxide-pellets-certified-acs-fisher-chemical-5/p250500?searchHijack=true&searchTerm=P250500&searchType=RAPID
Le Loop Decon Labs Inc. MP190-25 http://deconlabs.com/products/leloop/
Le Stab Decon Labs Inc. MP186-5 http://deconlabs.com/products/lestab/
MgSO4·7H2O Fisher Scientific M63-500 https://www.fishersci.com/shop/products/magnesium-sulfate-heptahydrate-crystalline-certified-acs-fisher-chemical-3/m63500?searchHijack=true&searchTerm=M63500&searchType=RAPID
Mini-Sub Cell GT Horizontal Electrophoresis System Bio Rad Labs 1704406 http://www.bio-rad.com/en-us/product/mini-sub-cell-gt-cell?WT.srch=1&WT.mc_id=aw-cbb-NA-sub_cell_systems_brand_gold&WT.knsh_id=7eb1981f-a011-42a3-aece-1236ff453373
MR-VP Broth Difco 216300 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=216300&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3Dmr-vp%2Bmedium%26typeOfSearch%3DproductSearch
Na2HPO4 Fisher Scientific S374-500 https://www.fishersci.com/shop/products/sodium-phosphate-dibasic-anhydrous-granular-powder-certified-acs-fisher-chemical-5/s374500?searchHijack=true&searchTerm=S374500&searchType=RAPID
NaCl Fisher Scientific S271-10 https://www.fishersci.com/shop/products/sodium-chloride-crystalline-certified-acs-fisher-chemical-6/s27110?searchHijack=true&searchTerm=S27110&searchType=RAPID
NaHCO3 Fisher Scientific S233-500 https://www.fishersci.com/shop/products/sodium-bicarbonate-powder-certified-acs-fisher-chemical-5/s233500?searchHijack=true&searchTerm=S233500&searchType=RAPID
NaNH4HPO4·4H2O Fisher Scientific S218-500 https://www.fishersci.com/shop/products/sodium-ammonium-phosphate-tetrahydrate-crystalline-certified-fisher-chemical/s218500?searchHijack=true&searchTerm=S218500&searchType=RAPID
NanoDrop Lite Spectrophtometer Thermo Scientific ND-LITE-PR https://www.thermofisher.com/order/catalog/product/ND-LITE-PR?ICID=search-ND-LITE-PR
Nonfat dry milk Nestle Carnation N/A N/A
Peptone Becto, Dickinson and Co. 211677 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=211677&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D211677%26typeOfSearch%3DproductSearch
Petri Dishes (100 mm x 15 mm) Fisher Scientific FB0875712 https://www.fishersci.com/shop/products/fisherbrand-petri-dishes-clear-lid-12/fb0875712#?keyword=FB0875712
Petri Dishes (150 mm x 15 mm) Fisher Scientific FB0875714 https://www.fishersci.com/shop/products/fisherbrand-petri-dishes-clear-lid-12/fb0875714?searchHijack=true&searchTerm=FB0875714&searchType=RAPID
Polymyxin B sulfate salt Sigma-Aldrich P1004-10MU Store at 2-4 °C; http://www.sigmaaldrich.com/catalog/product/sial/p1004?lang=en&region=US
Taq DNA Polymerase New England Biolabs M0273S Store at -20 °C; https://www.neb.com/products/m0273-taq-dna-polymerase-with-standard-taq-buffer
Taq Reaction Buffer New England Biolabs M0273S Store at -20 °C;  https://www.neb.com/products/m0273-taq-dna-polymerase-with-standard-taq-buffer
Thermal Cycler Bio-Rad C1000 Touch™  Bio Rad Labs 1840148 http://www.bio-rad.com/evportal/evolutionPortal.portal?_nfpb=true&_pageLabel=search_page&sfMode=search&sfStartNumber=1&clearQR=true&js=1&searchString=1840148&database=productskus+productcategories+productdetails+abdProductDetails+msds+literatures+inserts+faqs+downloads+webpages+assays+genes+pathways+plates+promotions&tabName=DIVISIONNAME
Triphenyltetrazolium chloride Alfa Aesar A10870 https://www.alfa.com/en/catalog/A10870/
Tris Base Fisher Scientific BP152-1 https://www.fishersci.com/shop/products/tris-base-white-crystals-crystalline-powder-molecular-biology-fisher-bioreagents-7/bp1521?searchHijack=true&searchTerm=BP1521&searchType=RAPID
Tryptone Becto, Dickinson and Co. 211705 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=211705&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D211705%26typeOfSearch%3DproductSearch
Yeast Extract Becto, Dickinson and Co. 212750 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=212750&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D212750%26typeOfSearch%3DproductSearch
α-napthol MP Biomedicals 204189 http://www.mpbio.com/product.php?pid=05204189

DOWNLOAD MATERIALS LIST

References

  1. Shimada, T., et al. Extended serotyping scheme for Vibrio cholerae. Curr. Microbiol. 28, (3), 175-178 (1994).
  2. Yamai, S., Tadayuki, O., Toshio, S., Yasuji, K. Distribution of serogroups of Vibrio cholerae non-O1 non-O139 with specific reference to their ability to produce cholera toxin, and addition of novel serogroups. Jpn. J. Infect. Dis. 71, (10), 1037-1045 (1997).
  3. Karaolis, D. K., Lan, R., Reeves, P. R. The sixth and seventh cholera pandemics are due to independent clones separately derived from environmental, nontoxigenic, non-O1 Vibrio cholerae. J. Bacteriol. 177, (11), 3191-3198 (1995).
  4. Albert, M. J., et al. Large epidemic of cholera-like disease in Bangladesh caused by Vibrio cholerae O139 synonym Bengal. Lancet. 342, (8868), 387 (1993).
  5. Barua, D. History of Cholera. Cholera. Barua, D., Greenough III, W. B. Plenum Publishing Corporation. 1-36 (1992).
  6. Morales, R., Delgado, G., Cravioto, A. Population Genetics of Vibrio cholerae. Vibrio cholerae-Genomics and Molecular Biology. Faruque, S. M., Nair, G. B. Caister Academic Press. 29-47 (2008).
  7. Samadi, A. R., Chowdhury, M. K., Huq, M. K., Khan, M. U. Seasonality of classical and El Tor cholera in Dhaka, Bangladesh: 17-year trends. Trans. R. Soc. Trop. Med. Hyg. 77, (6), 853-856 (1983).
  8. Son, M. S., Megli, C. J., Kovacikova, G., Qadri, F., Taylor, R. K. Characterization of Vibrio cholerae O1 El Tor biotype variant clinical isolates from Bangladesh and Haiti, including a molecular genetic analysis of virulence genes. J. Clin. Microbiol. 49, (11), 3739-3749 (2011).
  9. Ghosh-Banerjee, J., et al. Cholera toxin production by the El Tor variant of Vibrio cholerae O1 compared to prototype El Tor and classical biotypes. J. Clin. Microbiol. 48, (11), 4283-4286 (2010).
  10. Ansaruzzaman, M., et al. The Mozambique cholera vaccine demonstration project coordination group. Cholera in Mozambique, variant of Vibrio cholerae. Emerg. Infect. Dis. 10, (11), 2057-2059 (2004).
  11. Ansaruzzaman, M., et al. Genetic diversity of El Tor strains of Vibrio cholerae O1 with hybrid traits isolated from Bangladesh and Mozambique. Int. J. Med. Microbiol. 297, (6), 443-449 (2007).
  12. Lan, R., Reeves, P. R. Pandemic spread of cholera: genetic diversity and relationships within the seventh pandemic clone of Vibrio cholerae determined by amplified fragment length polymorphism. J. Clin. Microbiol. 40, (1), 172-181 (2002).
  13. Nair, G. B., Faruque, S. M., Bhuiyan, N. A., Kamruzzaman, M., Siddique, A. K., Sack, D. A. New variants of Vibrio cholerae O1 biotype El Tor with attributes of the classical biotype from hospitalized patients with acute diarrhea in Bangladesh. J. Clin. Microbiol. 40, (9), 3296-3299 (2002).
  14. Nair, G. B., et al. Isolation of Vibrio cholerae O1 strains similar to pre-seventh pandemic El Tor strains during an outbreak of gastrointestinal disease in an island resort in Fiji. J. Med. Microbiol. 55, (11), 1559-1562 (2006).
  15. Nair, G. B., Mukhopadhyay, A. K., Safa, A., Takeda, Y. Emerging hybrid variants of Vibrio cholerae O1. Vibrio cholerae—Genomics and Molecular Biology. Faruque, S. M., Nair, G. B. Horizon Scientific Press. 179-190 (2008).
  16. Safa, A., et al. Genetic characteristics of Matlab variants of Vibrio cholerae O1 that are hybrids between classical and El Tor biotypes. J. Med. Microbiol. 55, (11), 1563-1569 (2006).
  17. Nusrin, S., et al. Diverse CTX phages among toxigenic Vibrio cholerae O1 and O139 strains isolated between 1994 and 2002 in an area where cholera is endemic. J. Clin. Microbiol. 42, (12), 5854-5856 (2004).
  18. Carignan, B. M., Brumfield, K. D., Son, M. S. Single nucleotide polymorphisms in regulator-encoding genes have an additive effect on virulence gene expression in a Vibrio cholerae clinical isolate. mSphere. 1, (5), e00253 (2016).
  19. Iwanaga, M., Yamamoto, K., Higa, N., Ichinose, Y., Nakasone, N., Tanabe, M. Culture conditions for stimulating cholera toxin production by Vibrio cholerae O1 El Tor. Microbiol. Immunol. 30, (11), 1075-1083 (1986).
  20. DiRita, V. J., Claude, P., Georg, J., Mekalanos, J. J. Regulatory cascade controls virulence in Vibrio cholerae. Proc. Natl. Acad. Sci. USA. 88, (12), 5403-5407 (1991).
  21. Kovacikova, G., Lin, W., Skorupski, K. Duel regulation of genes involved in acetoin biosynthesis and motility/biofilm formation by the virulence activator AphA and the acetate-responsive Lys-R type regulator AlsR in Vibrio cholerae. Mol. Microbiol. 57, (2), 420-433 (2005).
  22. Vogel, H. J., Bonner, D. M. Acetylornithinase of Escherechia coli: partial purification and some properties. J. Biol. Chem. 218, (1), 97-106 (1956).
  23. Son, M. S., Taylor, R. K. Genetic screens and biochemical assays to characterize Vibrio cholerae O1 biotypes: classical and El Tor. Curr. Protoc. Microbiol. 6A.2.1-6A.2.17 (2011).
  24. Kovacikova, G., Skorupski, K. Regulation of virulence gene expression in Vibrio cholerae by quorum sensing: HapR functions at the aphA promoter. Mol. Microbiol. 46, (4), 1135-1147 (2002).
  25. Wang, Y., et al. The prevalence of functional quorum-sensing systems in recently emerged Vibrio cholerae toxigenic strains. Environ. Microbiol. Rep. 3, (2), 218-222 (2011).
  26. Sanders, E. R. Aseptic laboratory techniques. J. Vis. Exp. (63), e3064 (2012).
  27. Martinez, R. M., Megli, C. J., Taylor, R. K. Growth and laboratory maintenance of Vibrio cholerae. Curr. Protoc. 6A.1.1-6A.1.6 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics