विरोधी mitotic एजेंट Docetaxel के प्रतिरोध के प्रोस्टेट कैंसर सेल मॉडल की पीढ़ी

Cancer Research
 

Summary

कैंसर के उपचार के लिए प्रतिरोध रोग प्रगति और मौत के लिए योगदान देता है । प्रतिरोध के यंत्रवत आधार का निर्धारण चिकित्सीय प्रतिक्रिया में सुधार के लिए महत्वपूर्ण है । इस पांडुलिपि विवरण प्रोटोकॉल प्रोस्टेट कैंसर (पीसी) के taxane प्रतिरोधी कोशिका मॉडल उत्पंन करने में मदद करने के लिए पीसी रोगियों में प्रतिरोध Docetaxel के लिए प्रगति में शामिल रास्ते विदारक ।

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Mohr, L., Carceles-Cordon, M., Woo, J., Cordon-Cardo, C., Domingo-Domenech, J., Rodriguez-Bravo, V. Generation of Prostate Cancer Cell Models of Resistance to the Anti-mitotic Agent Docetaxel. J. Vis. Exp. (127), e56327, doi:10.3791/56327 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Microtubule लक्ष्यीकरण एजेंटों (MTAs) ट्यूमर की एक विस्तृत श्रृंखला के उपचार में एक मुख्य हैं । हालांकि, कीमोथेरेपी दवाओं के लिए प्रतिरोध प्राप्त रोग प्रगति और घातक ट्यूमर के एक शकुन-निर्धारक सुविधा का एक आम तंत्र है । प्रोस्टेट कैंसर में (पीसी), इस तरह के taxane Docetaxel के रूप में MTAs प्रतिरोध उपचार विफलता हुक्म के रूप में अच्छी तरह से रोग है कि एक गरीब पूर्वानुमान और उच्च मृत्यु दर द्वारा परिभाषित कर रहे है की घातक चरणों की ओर प्रगति । हालांकि दशकों के लिए अध्ययन किया, अधिग्रहण प्रतिरोध के लिए योगदान तंत्र की सरणी पूरी तरह से समझ में नहीं हैं, और इस तरह के नए चिकित्सीय रणनीतियों के विकास के लिए एक महत्वपूर्ण सीमा है कि इन उंनत चरणों में रोगियों को लाभ हो सकता है रोग. इस प्रोटोकॉल में, हम Docetaxel-प्रतिरोधी प्रोस्टेट कैंसर सेल लाइनों की पीढ़ी का वर्णन है कि देर से चरण प्रोस्टेट कैंसर के घातक सुविधाओं की नकल है, और इसलिए तंत्र है जिसके द्वारा अधिग्रहण chemoresistance उठता अध्ययन किया जा सकता है । संभावित सीमाओं के बावजूद एक सेल आधारित मॉडल के लिए आंतरिक, समय के साथ प्रतिरोध संपत्तियों की हानि के रूप में, Docetaxel-प्रतिरोधी सेल इस पद्धति द्वारा उत्पादित लाइनों सफलतापूर्वक हाल के अध्ययनों में इस्तेमाल किया गया है और अवसर की पेशकश करने के लिए अग्रिम हमारे घातक प्रोस्टेट कैंसर में अधिग्रहीत chemoresistance की आणविक समझ ।

Introduction

कोशिका चक्र नियंत्रण के नुकसान की वजह से प्रसार की एक वृद्धि की दर1कैंसर की एक बानगी है । इस कार्यात्मक गुण विशिष्ट रूप से एस के दौरान सेल चक्र की प्रमुख प्रक्रियाओं की निष्ठा पर निर्भर कैंसर कोशिकाओं renders और एम चरणों, जो विभिन्न कोशिका चक्र perturbing दवाओं है कि डीएनए क्षति या mitotic दोषों के लिए प्रेरित के विकास के लिए नेतृत्व किया है. हालांकि कई विरोधी mitotic एजेंटों, mitotic kinases या मोटर प्रोटीन के अवरोधकों की तरह, वर्तमान में विकसित किया जा रहा है और नैदानिक परीक्षणों में परीक्षण, लिगेसी microtubule लक्ष्यीकरण एजेंटों (MTAs) के लिए केवल नैदानिक अनुमोदित दृष्टिकोण होना जारी 2,3,4कैंसर में बँटवारा लक्ष्यीकरण । MTAs या तो अस्थिर (Vinblastine, Vincristine, Vinorelbine) या स्थिर (taxane-व्युत्पंन एजेंटों Paclitaxel, Docetaxel या Cabazitaxel) microtubules और इस तरह एक कार्य के गठन को रोकने के mitotic धुरी5,6। इन एजेंटों धुरी विधानसभा7,8है, जो एक लंबे समय तक mitotic गिरफ्तारी में परिणाम और9,10 और mitotic दोषों में ट्यूमर11 में अंतिम कोशिका मौत ट्रिगर ,12 और इसलिए कैंसर की एक बड़ी विविधता के इलाज के लिए उपयोगी हैं, उनमें प्रोस्टेट कैंसर13

प्रोस्टेट कैंसर सबसे अक्सर निदान कैंसर और पुरुषों में कैंसर से संबंधित मौतों का एक प्रमुख कारण है14। Antimitotic एजेंटों जैसे Docetaxel प्रोस्टेट कैंसर रोगी के अस्तित्व में सुधार और इस रोग के उपचार में एक मुख्य है15,16,17। दुर्भाग्य से, प्रारंभिक ट्यूमर संकोचन के बावजूद, ट्यूमर कोशिकाओं को अक्सर उपचार के दौरान दवा प्रतिरोध का विकास । कई सेलुलर तंत्र chemoresistance के विकास के कारण में फंसाया गया है, अपोप्तोटिक और भड़काऊ रास्ते के विनियमन सहित, या सक्रियण/एटीपी बाध्यकारी कैसेट ट्रांसपोर्टर की तरह दवा समाप्ति पंपों की एक्सप्रेस p-ग्लाइकोप्रोटीन (p-gp/ABCB1), जो परिणाम की कीमोथेरेपी एजेंट्स को कक्षों से बाहर के निर्यात में18,19। taxanes के लिए प्रतिरोध भी tubulin isotypes या tubulin उत्परिवर्तनों, जो दवा और उसके लक्ष्य 20,21के बीच बातचीत को रोकने की अभिव्यक्ति में परिवर्तन के रूप में अंय कारणों से जोड़ा गया है । इसके अलावा, प्रतिरोध जीनोम अस्थिरता संचय और ट्यूमर विविधता22,23से संबंधित किया गया है । हालांकि, taxane प्रतिरोध करने के लिए योगदान तंत्र पूरी तरह से समझ में नहीं हैं, जो चिकित्सीय रणनीतियों है कि अपनी उपस्थिति को रोकने के अभाव से स्पष्ट है । इसलिए, वहां एक तत्काल प्रयोगात्मक मॉडल है कि इन तंत्र के विच्छेदन में सहायता और उपंयास चिकित्सीय दृष्टिकोण है कि इन दवाओं के लिए प्रतिरोध के विकास को रोकने की पहचान उत्पंन करने की आवश्यकता है ।

इस लेख में हम एक विधि है जो Docetaxel की पीढ़ी प्रतिरोधी (डॉ) प्रोस्टेट कैंसर की कोशिकाओं की अनुमति देता है का वर्णन । हम आगे कैसे कालोनी गठन परख और मात्रात्मक आरटी-पीसीआर का उपयोग कर इन कोशिकाओं के प्रतिरोध की स्थिति को मांय करने के लिए वर्णन करेंगे । इस विधि द्वारा उत्पादित कोशिकाओं को बहुमुखी प्रतिभा प्रदान करने के लिए प्रयोगात्मक परख की एक विस्तृत विविधता प्रदर्शन के अतिरिक्त लाभ के साथ सार्वजनिक रूप से उपलब्ध मानव ट्यूमर नमूना डेटाबेस में पाया आणविक सुविधाओं के कई recapitulating का लाभ है ट्यूमर के नमूनों द्वारा अनुमति की तुलना में समय की लंबी अवधि । चिकित्सा प्रतिरोध के ये कैंसर मॉडल ऊतक संस्कृति में कई हफ्तों के लिए विस्तारित किया जा सकता है, और अंय दृष्टिकोण के बीच, आनुवंशिक रूप से चालाकी, सूक्ष्म तरीके से कल्पना की जा सकती है और जीन अभिव्यक्ति के लिए विश्लेषण किया । इसके अलावा, वे और vivo मेंट्यूमर के गठन और विकास में प्रभाव का विश्लेषण करने के लिए चूहों में xenotrasplanted जा सकता है । वर्तमान में, मुख्य वैकल्पिक विधि प्रोस्टेट कैंसर के संदर्भ में दवा प्रतिरोध का अध्ययन करने के लिए ट्यूमर के नमूनों के प्रत्यक्ष विश्लेषण है । हालांकि इन नमूनों को जीन अभिव्यक्ति और दिए गए ट्यूमर के उत्परिवर्तन स्थिति के बारे में जानकारी इकट्ठा करने के लिए एक बहुत ही शक्तिशाली प्रणाली मौजूद, उन तक पहुँच बहुत सीमित किया जा सकता है और वे आगे जोड़तोड़ और प्रयोगात्मक विश्लेषण, जो के लिए बनाए रखने के लिए मुश्किल कर रहे हैं आसानी से इस प्रोटोकॉल24,25के साथ उत्पंन सेल लाइनों के साथ किया जा सकता है । महत्वपूर्ण बात, भविष्य में, इस तरह के रोगियों से सीधे मानव व्युत्पंन organoids की पीढ़ी के रूप में वैकल्पिक दृष्टिकोण एक बहुत शक्तिशाली उपकरण और वर्तमान विधि26,27के लिए वैकल्पिक होगा । के बाद से वे एक 3 डी संदर्भ क्या एक ट्यूमर अपने मूल वातावरण में था में दोहराऊंगा होगा, organoids सेल लाइनों और मानव ट्यूमर के बीच सही मॉडल हो जाएगा । फिर भी, प्रायोगिक सेल इस प्रोटोकॉल में वर्णित मॉडल अभी और अधिक बनाए रखने और तेजी से विश्लेषण के लिए उपयुक्त है सस्ती । इन सेल लाइनों का अध्ययन करके प्राप्त परिणामों को extrapolated जा सकता है और मानव नमूने और 3 डी संस्कृतियों में पुष्टि । इसलिए, इस प्रोटोकॉल सेल मॉडल की मांग के लिए किसी भी सेल लाइन में chemoresistance तंत्र का अध्ययन शोधकर्ताओं के लिए ब्याज की हो सकती है, क्योंकि हमारे प्रोटोकॉल अंय दवाओं और कैंसर के प्रकार के अध्ययन के लिए अनुकूलित किया जा सकता है । यहां वर्णित तरीकों को किसी भी प्रयोगशाला में लागू आसान कर रहे हैं, सस्ती और आणविक और दवा प्रतिरोध के सेलुलर तंत्र के प्रारंभिक अध्ययन की अनुमति ।

Protocol

< p class = "jove_title" > 1. Docetaxel एकाग्रता का निर्धारण जिसके कारण कॉलोनी में ५०% घट गठन की क्षमता (IC50)

< p class = "jove_content" > नोट: इस प्रोटोकॉल में, Docetaxel IC50 एकाग्रता का मूल्यांकन किया गया है कॉलोनी गठन का उपयोग क्षमता. वैकल्पिक तरीकों का मूल्यांकन करने के लिए इस्तेमाल किया सेल व्यवहार्यता ( यानी, MTS परख) जांचकर्ताओं & #39; वरीयताओं के आधार पर इस्तेमाल किया जा सकता है ।

  1. एक ७५ सेमी 2 कुप्पी में DU145 या 22Rv1 कोशिकाओं को विकसित करने और Docetaxel में पतला 10 मिमी DMSO के पर्याप्त स्टॉक तैयार भविष्य के प्रयोगों में इस्तेमाल किया जा करने के लिए ।
  2. Docetaxel के IC50 के निर्धारण के लिए प्लेट कोशिकाओं को
  3. , कुप्पी से मीडिया को हटाने, सावधानीपूर्वक 5 मिलीलीटर पंजाबियों के साथ कोशिकाओं को धोने, और 2 मिलीलीटर ०.०५% के साथ मशीन Trypsin-EDTA 3-5 मिनट के लिए ३७ & #176; सी कुप्पी सतह से कोशिकाओं को अलग करने के लिए.
  4. ताजा मीडिया के 5 मिलीलीटर का उपयोग कर कुप्पी से trypsinized कोशिकाओं कुल्ला और एक 15 मिलीलीटर ट्यूब में सेल निलंबन इकट्ठा । केंद्रापसारक द्वारा गोली कोशिकाओं (३०० एक्स जी, 3 मिनट, कमरे के तापमान (आरटी)).
  5. supernatant निकालें, ताजा मीडिया के 5 मिलीलीटर में सेल गोली reसस्पेंड और कोशिकाओं की गिनती । सेल सस्पेंशन को पतला करने के लिए 2-2.5 x 10 5 कोशिकाओं/एमएल DU145 के लिए और 4-4.5 x 10 5 कोशिकाओं/22Rv1 के लिए मिलीलीटर, अच्छी तरह से ऊपर और नीचे pipetting और बीज दो 6-अच्छी तरह से प्लेटें के प्रत्येक कुआं में निलंबन के 2 मिलीलीटर मिश्रण ।
  6. के बाद 24 ज, जब कोशिकाओं 70-80% संगम पर हैं, खुराक जोड़-1 एनएम के Docetaxel सांद्रता, २.५ एनएम, 5 एनएम, 10 एनएम, 25 एनएम, ५० एनएम, १०० एनएम, २५० एनएम, ५०० एनएम, और एक अच्छी तरह से १००० एनएम । Docetaxel (< सुदृढ वर्ग = "xfig" > चित्रा 2a ) के लिए प्रयुक्त उच्चतम मात्रा पर DMSO के साथ अच्छी तरह से व्यवहार करें.
  7. के बाद ७२ ज, मीडिया युक्त महाप्राण दवा और ताजा मीडिया के 2 मिलीलीटर जोड़ें । लगभग 4-5 दिनों के भीतर, प्लेटें धुंधला के लिए तैयार हो जाएगा ।
  8. के लिए कालोनियों दाग, उंहें 2-3 मिलीलीटर पंजाबियों के साथ धीरे धोने और उंहें 2-3 मिलीलीटर क्रिस्टल वायलेट समाधान (०.१% डब्ल्यू/वी 10% formalin में) ऊतक संस्कृति हूड या एक धुएं हुड के अंदर 20 मिनट के लिए के साथ गर्मी ।
  9. धुंधला समाधान निकालें और 2-3 एमएल के एच 2 ओ के साथ प्लेटें धो लें, h 2 o और एयर-ड्राय प्लेट्स निकालें ।
  10. कुओं visualizing जो एक Docetaxel एकाग्रता है कि सेल व्यवहार्यता ५०% (IC50) द्वारा घटाता है निर्धारित करने के द्वारा परिणामों का विश्लेषण । मैन्युअल रूप से एक मार्कर पेन की मदद से कालोनियों गिनती (एक ही कालोनियों दो बार गिनती से बचने के लिए) और एक ग्राफ में सेल व्यवहार्यता के प्रतिशत का प्रतिनिधित्व (< मजबूत वर्ग = "xfig" > चित्रा 2a ). अंत में, चित्रा प्रतिनिधित्व के लिए प्लेटों की डिजिटल छवियों को ले (के रूप में < मजबूत वर्ग में दिखाया गया = "xfig" > चित्रा 3 ए ).
< p class = "jove_title" > 2. Docetaxel-प्रतिरोधी प्रोस्टेट कैंसर कोशिकाओं की पीढ़ी

< p class = "jove_content" > नोट: IC50 दवा एकाग्रता के निर्धारण के लिए इस्तेमाल किया एक ही Docetaxel समाधान स्टॉक का उपयोग कर सेल उपचार प्रदर्शन (प्रयोगात्मक के लिए अग्रिम में पर्याप्त स्टॉक तैयार उपयोग). हमेशा पिछले कदम से कोशिकाओं की एक छोटी कुप्पी रखने के लिए, बस के मामले में कुछ अच्छी तरह से काम नहीं करता है. माता पिता की कोशिकाओं को समानांतर में पूरे प्रक्रिया भर में एक छोटी कुप्पी में उगाया जाना चाहिए और वाहन (DMSO) इसी मात्रा में Docetaxel इलाज कुप्पी में इस्तेमाल किया मात्रा नकल उतार में उजागर ।

  1. प्लेट DU145 या 22Rv1 कोशिकाओं में १५० सेमी 2 की कुप्पी युक्त मीडिया की 20 मिलीलीटर (३.५ x 10 के लिए 6 DU145 कोशिकाओं की कुप्पी प्रति) और के लिए 6.5 * 10 6 22Rv1 कोशिकाओं के प्रति कुप्पी). कोशिकाओं की 10 से 20 बोतल का उपयोग प्रोटोकॉल के अंत में पर्याप्त कोशिकाओं के लिए सिफारिश की है.
  2. के बाद 24 ज, जब कोशिकाओं के बारे में 70-80% संगम पर है (< मजबूत वर्ग = "xfig" > चित्रा 2 बी , Docetaxel से पहले), प्रोटोकॉल के चरण 1 में निर्धारित Docetaxel एकाग्रता पर IC50 जोड़ें (इस प्रोटोकॉल में वर्णित कोशिकाओं के लिए 5 एनएम).
  3. के बाद ७२ ज, महाप्राण दवा युक्त मीडिया और जोड़ ताजा, Docetaxel-फ्री मीडिया (< मजबूत वर्ग = "xfig" > चित्रा बी , ७२ एच के बाद Docetaxel). हर 3-4 दिन मीडिया बदलें । लगभग 1-2 सप्ताह के भीतर, प्रतिरोधी क्लोनों माइक्रोस्कोप के तहत स्पष्ट दिखाई देगा (< मजबूत वर्ग = "xfig" > चित्रा 2 बी , 7 और 14 दिनों के बाद Docetaxel).
  4. महाप्राण मीडिया, ध्यान से 15 मिलीलीटर पंजाबियों के साथ कोशिकाओं को धो और 4 मिलीलीटर ०.०५% Trypsin-EDTA के साथ मशीन 3-5 मिनट के लिए ३७ & #176; सी कुप्पी सतह से कोशिकाओं को अलग करने के लिए.
  5. ताजा मीडिया के 8 मिलीलीटर का उपयोग कुप्पी से trypsinized कोशिकाओं reसस्पेंड । सभी इलाज कुप्पी से पूल कोशिकाओं । केंद्रापसारक द्वारा गोली कोशिकाओं (३०० x g, 3 मिनट, RT).
  6. supernatant निकालें, ताजा मीडिया और प्लेट के 20 मिलीलीटर में सेल गोली reसस्पेंड १५० cm 2 कुप्पी (३.५ x 10 के लिए कुप्पी प्रति 6 कोशिकाओं और 6.5 * DU145 के लिए कुप्पी प्रति 10 6 कोशिकाओं) में कोशिकाओं । 22Rv1
  7. के बाद 24 ज, जब कोशिकाओं के बारे में 70-80% संगम पर हैं, जोड़ें 5 एनएम Docetaxel (प्रारंभिक IC50 एकाग्रता) फिर से ।
  8. दोहराएँ चरण २.३ करने के लिए २.६ दिन पर 3.
  9. के बाद 24 ज, जब कोशिकाओं के बारे में 70-80% संगम पर हैं, 2x IC50 Docetaxel एकाग्रता (इस प्रोटोकॉल में वर्णित कोशिकाओं के लिए 10 एनएम) के साथ कोशिकाओं का इलाज ।
  10. दोहराने चरणों २.३ करने के लिए २.८, एक खुराक के बाद-Docetaxel सांद्रता की वृद्धि (25 एनएम, ५० एनएम, १०० एनएम और २५० एनएम), अंतिम उच्चतम एकाग्रता के तहत अपनी कुप्पी में बढ़ती कोशिकाओं की एक स्थिर जनसंख्या उत्पन्न करने के लिए. उच्च सांद्रता के लिए, खुराक-वृद्धि प्रोटोकॉल १,००० एनएम एकाग्रता तक पहुँच गया है जब तक 6 महीने तक के लिए लागू किया जा सकता (< मजबूत वर्ग = "xfig" > चित्रा 1a ).
< p class = "jove_title" > 3. अधिग्रहीत Docetaxel प्रतिरोध की कॉलोनी गठन परख द्वारा कार्यात्मक लक्षण वर्णन

< p class = "jove_content" > नोट: इस प्रोटोकॉल में, chemoresistance कॉलोनी के गठन की परख का उपयोग कर मूल्यांकन किया गया है । वैकल्पिक तरीकों का मूल्यांकन करने के लिए इस्तेमाल किया सेल व्यवहार्यता ( यानी, MTS परख) जांचकर्ताओं & #39; वरीयताओं के आधार पर इस्तेमाल किया जा सकता है ।

  1. प्लेट २,००० कोशिकाओं (DU145 या 22Rv1, दोनों माता पिता और Docetaxel प्रतिरोधी) 6-अच्छी तरह से प्लेटों में प्रति अच्छी तरह से प्रति मीडिया के 2 मिलीलीटर का उपयोग कर ।
  2. 24 एच के बाद, Docetaxel की बढ़ती सांद्रता जोड़ें (पैतृक कोशिकाओं: ०.२५, ०.५, 1, २.५ और 5 एनएम; डॉ कोशिकाओं: ५०, १२५, २५०, ५०० और १,००० एनएम) । दोनों DU145 और 22Rv1 सेल लाइनों के लिए । DMSO को केवल एक ही रूप में एक ही वॉल्यूम पर एक नियंत्रण के रूप में सबसे अधिक Docetaxel खुराक के लिए प्रयुक्त जोड़ें ।
  3. के बाद ७२ ज, मीडिया युक्त महाप्राण दवा और ताजा Docetaxel-फ्री मीडिया जोड़ें.
  4. 1-2 सप्ताह के लिए मशीन प्लेटें जब तक कालोनियों खुर्दबीन के नीचे दिखाई दे रहे हैं ।
  5. के लिए कालोनियों दाग, उंहें 2-3 मिलीलीटर पंजाबियों के साथ धीरे धोने और उंहें 2-3 मिलीलीटर क्रिस्टल वायलेट समाधान (०.१% डब्ल्यू/वी 10% formalin में) ऊतक संस्कृति हूड या एक धुएं हुड के अंदर 20 मिनट के लिए के साथ गर्मी ।
  6. धुंधला समाधान निकालें और 2-3 एमएल के एच 2 ओ के साथ प्लेटें धो लें, h 2 o और एयर-ड्राय प्लेट्स निकालें ।
  7. कुओं visualizing द्वारा परिणाम का विश्लेषण और मैन्युअल रूप से एक मार्कर पेन की मदद से कालोनियों की गिनती (एक ही कालोनियों दो बार गिनती से बचने के लिए) और एक ग्राफ में सेल व्यवहार्यता के प्रतिशत का प्रतिनिधित्व करते हैं । चित्र निरूपण के लिए प्लेटों की डिजिटल छवियां लें (< सशक्त वर्ग = "xfig" > चित्र 3 ए ).
< p class = "jove_title" > 4. Docetaxel प्रतिरोध का Phenotypic लक्षण वर्णन Phenotype via qRT का अधिग्रहण किया-पीसीआर विश्लेषण

< p class = "jove_content" > नोट: Docetaxel-प्रतिरोधी (DR) कक्ष किसी भिन्न व्यंजक प्रोफ़ाइल की तुलना में उनके पैतृक कक्ष रेखाओं का प्रदर्शन < सुप वर्ग = "xref" > २८ , < सुप वर्ग = "xref" > २९ . इसलिए, चयन की सफलता qRT द्वारा सत्यापित किया जा सकता है-पीसीआर विशिष्ट मार्करों के लिए प्राइमरों का उपयोग कर (प्राइमर दृश्यों के लिए, सामग्री अनुभाग को देखें; विवरण के लिए, परिणाम अनुभाग को देखें) । यह तीसरे दौर के बाद शुरू चयन के प्रत्येक दौर के बाद किया जाना चाहिए । वैकल्पिक रूप से, पश्चिमी सोख्ता द्वारा Docetaxel प्रतिरोधी phenotype का मूल्यांकन भी संभव है.

  1. एक आरएनए निष्कर्षण किट का उपयोग कर माता-पिता और Docetaxel-प्रतिरोधी कोशिकाओं दोनों से आरएनए निकालने और निर्माता & #39; s निर्देश का पालन (सामग्री और विवरण के लिए रिएजेंट की तालिका देखें). 1-2 x 10 6 कक्षों की एक ंयूनतम का उपयोग अनुशंसित है ।
  2. २६० एनएम अवशोषक में आरएनए यों, एक spectrophotometer का उपयोग कर । सबसे अच्छी पवित्रता के लिए, २६० एनएम/280 एनएम अवशोषक अनुपात २.० के करीब होना चाहिए ।
  3. Perform रिवर्स प्रतिलेखन पूरक डीएनए (सीडीएनए) रिवर्स प्रतिलेखन किट का उपयोग कर प्राप्त करने के लिए और निंनलिखित निर्माता & #39; s निर्देश (विवरण के लिए सामग्री और रिएजेंट की तालिका देखें), का उपयोग कर 1 & #181; आरएनए के जी में एक 20 & #181; L प्रतिक्रिया मिश्रण (सीडीएनए की एक उच्च राशि की जरूरत है, तो तदनुसार प्रतिक्रिया मिश्रण ऊपर पैमाने पर).
  4. हित के प्रत्येक जीन के लिए तपसिल में qPCR प्रतिक्रिया निम्नानुसार तैयार करें:
    -2 & #181; l का 10 & #181; m आश प्राइमरी
    -2 & #181; l का 10 & #181; M रिवर्स प्राइमरी
    -10 & #181; l SYBR ग्रीन पीसीआर मास्टर मिक्स
    -5 & #181; ल H 2 O
    -1 & #181; l के नए तैयार सीडीएनए से कदम ४.३.
    नोट: इस प्रोटोकॉल में प्रयुक्त प्राइमरों के जुगाड़ के लिए
    सामग्री की तालिका देखें.
  5. ने पीसीआर प्रोग्राम निम्नानुसार सेट किया:
    -९५ & #176; ग फॉर 15 मिन
    -९४ & #176; ग फॉर 30 s & #160; & #160; & #160; & #160; & #160;|
    -५६ & #176; ग त्यात ४० s & #160; & #160; & #160; & #160; & #160;| & #160; ४० times
    -७२ & #176; c फॉर 30 s & #160; & #160; & #160; & #160; & #160;|
  6. qPCR परिणामों का विश्लेषण और माता पिता और डॉ नमूने के बीच जीन अभिव्यक्ति में परिवर्तन का निर्धारण करने के लिए, ब्याज की प्रत्येक जीन के लिए चक्र दहलीज (सीटी) मूल्यों तपसिल में निर्धारित कर रहे हैं और औसत लोड हो रहा है नियंत्रण करने के लिए सामान्यीकृत (Actin तपसिल औसत ) के लिए डॉ (सीटी डॉ) और माता पिता की कोशिकाओं (सीटी माता पिता) । पैतृक कोशिकाओं के लिए मान 1 के लिए सामान्यीकृत हैं । & #916; सीटी (सीटी डॉ-सीटी माता पिता) अंतिम mRNA गुना परिवर्तन प्राप्त करने और एक ग्राफ में प्रतिनिधित्व करने के लिए निर्धारित किया जाता है. & #62 की एक वृद्धि; 2 या क कमी & #60; ०.५ को महत्वपूर्ण माना जाता है और Docetaxel अधिग्रहित प्रतिरोधी phenotype की स्थापना का एक अच्छा सत्यापन (< सुदृढ वर्ग = "xfig" > चित्रा 3 बी ).

Representative Results

इस प्रोटोकॉल Docetaxel प्रतिरोधी (डॉ) प्रोस्टेट कैंसर की कोशिकाओं की पीढ़ी के लिए नेतृत्व करेंगे । पूरा होने के लिए समयरेखा 4 से 7 महीने के रूप में चित्रा 1a और चित्र 1bमें प्रोटोकॉल कदम के योजनाबद्ध प्रतिनिधित्व में संक्षेप के रूप में हो सकता है । समय निवेश पसंद के सेल लाइन और प्रोटोकॉल में वर्णित के रूप में इस्तेमाल दवा सांद्रता की सीमा के आधार पर अलग हो सकता है । महत्वपूर्ण बात, प्रत्येक सेल लाइन के लिए Docetaxel IC50 एकाग्रता के निर्धारण के लिए विकल्प की कोशिकाओं (चित्रा 2a) के लिए प्रोटोकॉल में उपयोग करने के लिए दवा बढ़ती एकाग्रता रेंज के डिजाइन की अनुमति देता है । एक बार प्रोटोकॉल शुरू कर दिया है, DU145 और 22Rv1 कोशिकाओं पर प्रारंभिक Docetaxel प्रभाव खुर्दबीन के नीचे अलग समय बिंदुओं पर देखा जा सकता है अगर प्रोटोकॉल ठीक से काम कर रहा है की निगरानी के लिए । सुझाए गए समय अंक Docetaxel उपचार प्रक्रिया की निगरानी करने के लिए कर रहे हैं: Docetaxel एक्सपोजर (आधारभूत) से पहले, ७२ ज, 7 दिन और 14 दिनों के लिए Docetaxel जोखिम के बाद. ध्यान दें कि केवल ट्यूमर कोशिकाओं के एक अल्पसंख्यक Docetaxel जोखिम जीवित रहते हैं और क्लोन उत्पन्न, जो माइक्रोस्कोप के तहत मनाया जा सकता है (चित्रा बीसी).

प्रतिनिधि कॉलोनी के गठन की परख और माता पिता के ठहराव रेखांकन और नव जनित Docetaxel प्रतिरोधी (डॉ) कोशिकाओं को चित्र 3ए में दिखाया जाता है । ध्यान दें कि जनित Docetaxel-प्रतिरोधी कोशिकाओं को जीवित कर सकते हैं दवा सांद्रता अप करने के लिए १,०००-गुना अधिक पैतृक कोशिकाओं की तुलना में.

अंत में, Docetaxel प्रतिरोधी phenotype qRT-पीसीआर (चित्र बी) द्वारा मान्य किया जा सकता है । ध्यान दें कि Docetaxel प्रतिरोधी कोशिकाओं, पैतृक कोशिकाओं की तुलना में, प्रदर्शन विशेषता अप-ABCB1 और GATA2 के विनियमन और नीचे CK19 और CDH1 के विनियमन । इन जीनों सत्यापन के लिए चयन किया गया क्योंकि हम पहले से ही प्रयोग किया जाता है हमारे पहले से प्रकाशित काम में दिखाया GATA2 ऊपर और downregulation CK19 के साथ एक साथ CDH1 दोनों में डॉ सेल मॉडल28,29। ABCB1 जीन भी एक प्रधान जीन है कि दूसरों के द्वारा दिखाया गया है के रूप में चुना गया था लगातार दवा प्रतिरोधी कोशिकाओं18,19में विनियमित । हालांकि, यह ध्यान रखें कि अंय जीन साहित्य के अनुसार चुना जा सकता है और सेल मॉडल और शोधकर्ता द्वारा प्रतिरोधी कोशिकाओं को पैदा करने के लिए चुना दवाओं के आधार पर महत्वपूर्ण है ।

Figure 1
चित्रा 1: Docetaxel-प्रतिरोधी प्रोस्टेट कैंसर सेल मॉडल की पीढ़ी के लिए समयरेखा । (A) Docetaxel-प्रतिरोधी सेल मॉडलों के उत्पादन के लिए प्रोटोकॉल समयरेखा का प्रतिनिधि आरेख । चित्रण Docetaxel उपचार, मांयता कदम, और प्रत्येक भाग के लिए आवश्यक समय को दर्शाया गया है । (B) ७२ (लाल में) के लिए संकेत Docetaxel सांद्रता के साथ व्यवहार किया पैतृक और Docetaxel प्रतिरोधी कोशिकाओं के कार्यात्मक कॉलोनी के गठन की परख सहित प्रोटोकॉल के सत्यापन चरणों का योजनाबद्ध प्रतिनिधित्व, प्रतिनिधि phenotypic सत्यापन के लिए कॉलोनी प्रतिशत और qRT-पीसीआर का ग्राफ । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्रा 2: Docetaxel के उत्पादन-प्रतिरोधी प्रोस्टेट कैंसर सेल मॉडल सिस्टम । (क) माता-पिता के प्रोस्टेट कैंसर कोशिका रेखाओं में Docetaxel IC50 के निर्धारण का चित्रण करनेवालाआरेख DU145 और 22Rv1 (प्रोटोकॉल का चरण 1). सेल व्यवहार्यता की उंमीद प्रतिशत और Docetaxel खुराक-बढ़ती सांद्रता की जरूरत शामिल हैं । प्रतिनिधि DU145 और 22Rv1 सेल व्यवहार्यता रेखांकन Docetaxel एक्सपोजर के ७२ एच के बाद IC50 के रूप में 5 एनएम का संकेत शामिल हैं । प्रयोगों triplicates कर रहे हैं और डेटा मतलब ± एसडी का प्रतिनिधित्व करता है () Docetaxel प्रतिरोध की पीढ़ी के दौरान संकेत दिया समय पर DU145 और 22Rv1 कोशिकाओं के प्रतिनिधि उज्ज्वल क्षेत्र माइक्रोस्कोपी छवियों (प्रोटोकॉल के चरण 2). लाल तीर प्रोटोकॉल पूरा होने के बाद एक Docetaxel प्रतिरोधी क्लोन इंगित करते हैं । स्केल बार्स = ५० एनएम । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 3
चित्र 3: Docetaxel-प्रतिरोधी सेल मॉडल के कार्यात्मक और phenotypic लक्षण वर्णन. () प्रतिनिधि कॉलोनी माता पिता और Docetaxel प्रतिरोधी कोशिकाओं के ७२ घंटे के लिए संकेत Docetaxel सांद्रता के साथ इलाज के गठन की परख हर इलाज एकाग्रता के लिए कालोनियों का प्रतिशत शामिल ग्राफ में प्रतिनिधित्व किया है । प्रयोगों triplicates कर रहे हैं और डेटा मतलब ± एसडी का प्रतिनिधित्व करता है. स्केल बार्स = 5 मिमी. (B) डॉ/पैतृक रिश्तेदार mRNA गुना वृद्धि मात्रा द्वारा qRT-ABCB1, GATA2, CK19 और CDH1 की पीसीआर को दिखाया गया है । सभी qPCR रॉ डेटा Actin के लिए सामान्यीकृत है (विवरण के लिए प्रोटोकॉल देखें) । प्रयोगों triplicates कर रहे हैं और डेटा मतलब ± एसडी प्रतिनिधित्व करते हैं. * p & #60; ०.०५. कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Discussion

इस पांडुलिपि में, हम एक विधि का वर्णन करने के लिए उत्पंन Docetaxel-प्रतिरोधी प्रोस्टेट कैंसर सेल मॉडल सिस्टम है कि chemoresistance phenotype के अधिग्रहण के लिए योगदान तंत्र के अध्ययन के लिए अनुमति देता है । जबकि यह दृष्टिकोण अत्यधिक विश्वसनीय और प्रतिलिपि है, कुछ संभावित सीमाओं पर विचार किया जाना चाहिए । केवल कोशिकाओं की थोक आबादी का एक छोटा सा अंश के बाद से28chemoresistance प्रदर्शन करेंगे, यह कोशिकाओं की एक बड़ी आबादी के साथ शुरू करने के लिए सिफारिश की है (हम आम तौर पर १५० सेमी2, जो लगभग १.२ x 108 के लिए खाते की 20 बोतल थाली कक्ष) । प्रोटोकॉल के प्रमुख कदम प्रक्रिया की सफलता सुनिश्चित करने के लिए विचार किया जाना चाहिए । सबसे पहले, यह बहुत ही Docetaxel हौसले से लंबी अवधि के उपयोग के लिए तैयार स्टॉक का उपयोग करें (10 मिमी स्टॉक aliquots साल के लिए इस्तेमाल किया जा सकता है जब ठीक से कम-८० डिग्री सेल्सियस में संग्रहीत महत्वपूर्ण है) । Docetaxel aliquot में मामूली परिवर्तन IC50 के परिणाम, सेल लाइन समय की पीढ़ी और कॉलोनी के गठन के परिणाम को प्रभावित कर सकते हैं । दूसरा, यह प्रत्येक व्यक्ति सेल लाइन में IC50 का निर्धारण प्रोटोकॉल शुरू महत्वपूर्ण है, क्योंकि बदलाव हो सकता है जब कोशिकाओं के एक नए बैच का उपयोग कर । तीसरा, यह है कि दवा उपचार माइक्रोस्कोप के तहत कोशिकाओं की जांच से प्रभावी है पर नजर रखने के लिए आवश्यक है अक्सर किसी भी त्रुटि का पता लगाया जा सकता है जल्दी और सही । अंत में, हम हमेशा संदूषण या अप्रत्याशित समस्याओं के मामले में मध्यवर्ती चरणों का भंडार रखने की सलाह देते हैं जो प्रोटोकॉल के बीच में कोशिकाओं की व्यवहार्यता को प्रभावित कर सकता है । महत्वपूर्ण बात, हमारे प्रोटोकॉल के लिए Docetaxel की उच्च खुराक के लिए प्रोस्टेट कैंसर की कोशिकाओं को उजागर द्वारा दवा प्रतिरोध के मॉडल उत्पन्न करने के लिए करना है ७२ ज लंबी वसूली अवधि के बाद, के बजाय सबसे अच्छा नैदानिक नकल करने के प्रयास में दवा की कम लगातार सांद्रता परिदृश्य इस taxane एजेंट के साथ प्रोस्टेट कैंसर के इलाज के लिए रिपोर्ट15,16

इसके अतिरिक्त, यह ध्यान दिया जाना चाहिए कि दवा प्रतिरोधी कोशिकाओं को एक उच्च प्लास्टिक का प्रदर्शन, जो समय के साथ अर्जित प्रतिरोध संपत्तियों की एक प्रगतिशील हानि के लिए नेतृत्व कर सकते हैं । इसलिए, संस्कृति में 2-3 से अधिक महीनों के लिए इन कोशिकाओं के उपयोग का विस्तार अनुशंसित नहीं है । यदि एक स्थाई आपूर्ति की जरूरत है यह लगातार प्रतिरोधी कोशिकाओं के नए बैचों उत्पंन करने के लिए सलाह दी जाती है । हालांकि, अगर कोशिकाओं के बैचों एक विस्तारित समय के लिए किया गया है, कॉलोनी गठन परख और qPCR उनके प्रतिरोध का पुनर्मूल्यांकन करने के लिए इस्तेमाल किया जा सकता है । एक अंय विकल्प ७२ ज (500-1000 एनएम) के लिए Docetaxel की एक उच्च खुराक के साथ कोशिकाओं के इलाज के द्वारा ढलते प्रतिरोध को बढ़ावा देने के लिए है । एक से दो सप्ताह की वसूली की अवधि के बाद, phenotype फिर से qPCR और कॉलोनियों के गठन की परख द्वारा परीक्षण किया जा सकता है । यह भी संभव है, हालांकि अनुशंसित नहीं, तरल नाइट्रोजन में इलाज कोशिकाओं के aliquots स्टोर करने के लिए (FBS में, 10% DMSO). कृपया ध्यान दें कि एक फ्रीज-गल चक्र के बाद, chemoresistance phenotype हमेशा aforementioned तरीकों के साथ फिर से मूल्यांकन किया जाना चाहिए ।

इन निरंतर के बावजूद, हम28,29 और अंय30,31,३२,३३ को सफलतापूर्वक इन मॉडल सिस्टम को रोजगार के लिए महत्वपूर्ण उपंयास सेलुलर की पहचान कर रहे थे और आणविक तंत्र को उंनत ट्यूमर की शुरुआत क्षमता, सेल अस्तित्व, और Docetaxel प्रतिरोधी कोशिकाओं में आक्रामकता । इन कैंसर सेल मॉडल सिस्टम का प्रयोग, हमें पता चला कि कोशिकाओं को एक विभेदित phenotype का प्रदर्शन, उपकला और प्रोस्टेट के अभाव से संबंधित भेदभाव मार्करों और लक्षित विकास (पायदान और के व्यक्ती की विशेषता हेज हॉग) संकेत रास्ते, कीमोथेरेपी जोखिम बच28. एक दूसरे अध्ययन में, सार्वजनिक रूप से उपलब्ध रोगी जीन डेटा के साथ एक साथ इन मॉडलों का उपयोग कर24,25सेट, हम पर्दाफाश किया है कि पायनियर प्रतिलेखन कारक GATA2 अत्यधिक मेटास्टेटिक बधिया में व्यक्त प्रतिरोधी है कीमोथेरेपी प्रतिरोधी प्रोस्टेट कैंसर की कोशिकाओं । GATA2 सीधे एक IGF2-निर्भर बहाव कळेनासे संकेतन नेटवर्क29सक्रिय द्वारा कोशिकाओं का अस्तित्व बढ़ जाती है । विशेष रूप से, इन अध्ययनों के लिए उंनत मेटास्टेटिक प्रोस्टेट कैंसर बुद्धिमता३४में GATA2 के उपंयास प्रमुख भूमिकाओं की पहचान करने में मदद की ।

दवा प्रतिरोध का विकास एक समस्या यह है कि Docetaxel और प्रोस्टेट कैंसर तक ही सीमित नहीं है, के रूप में यह कीमोथेरेपी दवाओं की एक विस्तृत सरणी के साथ इलाज के कैंसर के कई अंय प्रकार के बीच प्रचलित है । दरअसल, प्रयोगात्मक मॉडल की उपलब्धता पर इसी तरह के प्रतिबंध लागू होते हैं, और यह कल्पना है कि हमारे प्रोटोकॉल के लिए अंय प्रकार के कैंसर और उनके संबंधित chemoresistance तंत्र का अध्ययन अनुकूलित किया जा सकता है ।

इस प्रोटोकॉल में वर्णित के रूप में Docetaxel प्रतिरोधी कोशिकाओं की पीढ़ी के उपंयास प्रासंगिक आणविक और सेलुलर तंत्र chemoresistance की पहचान करने के लिए एक कार्यात्मक उपकरण के रूप में इस्तेमाल किया जा सकता है । यह नया लक्ष्य है, जिस पर अत्यधिक घातक प्रोस्टेट कैंसर के लिए नए उपचार के विकास मुखर हो सकता है खोजने के लिए दरवाजे खोलता है, एक बार और क्या हम इस रोग के बारे में पता है की सीमाओं को आगे बढ़ाने और कैसे हम अपने रोगियों का इलाज ।

Disclosures

लेखकों की घोषणा है कि वे कोई प्रतिस्पर्धा वित्तीय हितों की है ।

Acknowledgments

V.R.-बी. अमेरिका के स्वास्थ्य विभाग से धन प्राप्त करता है & #38; मानव सेवा, NIH, राष्ट्रीय कैंसर संस्थान अनुदान संख्या 1 K22 CA207458-01 और जद-डी. अमेरिका के स्वास्थ्य विभाग से धन प्राप्त करता है & #38; मानव सेवा, NIH, राष्ट्रीय कैंसर संस्थान अनुदान संख्या 1 R01 CA207311-01.

Materials

Name Company Catalog Number Comments
DU145 cells ATCC HTB-81
22Rv1 cells ATCC CRL-2505
Docetaxel Selleck Chemicals S1148 in DMSO (10mM)
Tissue culture flask 150cm2 Falcon 355001
6-well tissue culture plates Falcon 353046
RPMI 1640 Medium Gibco 11875093 Supplemented with 10% FBS and 1% Penicilin/Streptomycin
Foundation B Fetal Bovine Serum Gemini 900208
1X Phosphate-Buffered Saline (PBS) Corning 21-040-CM
0.05%Trypsin-EDTA Gibco 25300-062
Penicillin-Streptomycin Gibco 15140122
RNeasy Mini Kit Qiagen 74106
SuperScript III first strand synthesis system for RT-PCR Invitrogen 18080051
Power SYBR Green PCR Master Mix Invitrogen 4367659
Crystal Violet Sigma-Aldrich C0775
10% Formalin Solution Sigma-Aldrich HT501128
Primers for qRT-PCR: Life technologies
CK19 F: CTGCGGGACAAGATTCTTGGT
CK19 R: CCAGACGGGCATTGTCGAT
CDH1 F: GGAAGTCAGTTCAGACTCCAGCC
CDH1 R: AGGCCTTTTGACTGTAATCACACC
ABCB1 F: TGTTCAAACTTCTGCTCCTGA
ABCB1 R: CCCATCATTGCAATAGCAGG
GATA2 F: CATCAAGCCCAAGCGAAGA
GATA2 R: TTTGACAGCTCCTCGAAGCA
ACTIN F: CATGTACGTTGCTATCCAGGC
ACTIN R: CTCCTTAATGTCACGCACGAT

DOWNLOAD MATERIALS LIST

References

  1. Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, (5), 646-674 (2011).
  2. Lapenna, S., Giordano, A. Cell cycle kinases as therapeutic targets for cancer. Nature reviews. Drug discovery. 8, (7), 547-566 (2009).
  3. Jackson, J. R., Patrick, D. R., Dar, M. M., Huang, P. S. Targeted anti-mitotic therapies: can we improve on tubulin agents? Nature reviews. Cancer. 7, (2), 107-117 (2007).
  4. Dumontet, C., Jordan, M. A. Microtubule-binding agents: a dynamic field of cancer therapeutics. Nature reviews. Drug discovery. 9, (10), 790-803 (2010).
  5. Schiff, P. B., Fant, J., Horwitz, S. B. Promotion of microtubule assembly in vitro by taxol. Nature. 277, (5698), 665-667 (1979).
  6. Schiff, P. B., Horwitz, S. B. Taxol stabilizes microtubules in mouse fibroblast cells. Proceedings of the National Academy of Sciences of the United States of America. 77, (3), 1561-1565 (1980).
  7. Musacchio, A., Salmon, E. D. The spindle-assembly checkpoint in space and time. Nature reviews. Molecular cell biology. 8, (5), 379-393 (2007).
  8. Kops, G. J. P. L., Weaver, B. A. A., Cleveland, D. W. On the road to cancer: aneuploidy and the mitotic checkpoint. Nature reviews. Cancer. 5, (10), 773-785 (2005).
  9. Derry, W. B., Wilson, L., Jordan, M. A. Substoichiometric binding of taxol suppresses microtubule dynamics. Biochemistry. 34, (7), 2203-2211 (1995).
  10. Jordan, M. A., Wendell, K., Gardiner, S., Derry, W. B., Copp, H., Wilson, L. Mitotic block induced in HeLa cells by low concentrations of paclitaxel (Taxol) results in abnormal mitotic exit and apoptotic cell death. Cancer research. 56, (4), 816-825 (1996).
  11. Orth, J. D., Kohler, R. H., Foijer, F., Sorger, P. K., Weissleder, R., Mitchison, T. J. Analysis of mitosis and antimitotic drug responses in tumors by in vivo microscopy and single-cell pharmacodynamics. Cancer research. 71, (13), 4608-4616 (2011).
  12. Zasadil, L. M., et al. Cytotoxicity of paclitaxel in breast cancer is due to chromosome missegregation on multipolar spindles. Science translational medicine. 6, (229), (2014).
  13. Dominguez-Brauer, C., Thu, K. L., Mason, J. M., Blaser, H., Bray, M. R., Mak, T. W. Targeting Mitosis in Cancer: Emerging Strategies. Molecular cell. 60, (4), 524-536 (2015).
  14. Torre, L. A., Bray, F., Siegel, R. L., Ferlay, J., Lortet-Tieulent, J., Jemal, A. Global cancer statistics, 2012. CA: a cancer journal for clinicians. 65, (2), 87-108 (2015).
  15. Petrylak, D. P., et al. Docetaxel and estramustine compared with mitoxantrone and prednisone for advanced refractory prostate cancer. The New England journal of medicine. 351, (15), 1513-1520 (2004).
  16. Tannock, I. F., et al. Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer. The New England journal of medicine. 351, (15), 1502-1512 (2004).
  17. Sweeney, C. J., et al. Chemohormonal Therapy in Metastatic Hormone-Sensitive Prostate Cancer. The New England journal of medicine. 373, (8), 737-746 (2015).
  18. Mahon, K. L., Henshall, S. M., Sutherland, R. L., Horvath, L. G. Pathways of chemotherapy resistance in castration-resistant prostate cancer. Endocrine-related cancer. 18, (4), R103-R123 (2011).
  19. Follit, C. A., Brewer, F. K., Wise, J. G., Vogel, P. D. In silico identified targeted inhibitors of P-glycoprotein overcome multidrug resistance in human cancer cells in culture. Pharmacology research & perspectives. 3, (5), e00170 (2015).
  20. Ranganathan, S., Benetatos, C. A., Colarusso, P. J., Dexter, D. W., Hudes, G. R. Altered beta-tubulin isotype expression in paclitaxel-resistant human prostate carcinoma cells. British journal of cancer. 77, (4), 562-566 (1998).
  21. Martello, L. A., et al. Elevated levels of microtubule destabilizing factors in a Taxol-resistant/dependent A549 cell line with an alpha-tubulin mutation. Cancer research. 63, (6), 1207-1213 (2003).
  22. Lee, A. J. X., et al. Chromosomal instability confers intrinsic multidrug resistance. Cancer research. 71, (5), 1858-1870 (2011).
  23. Sansregret, L., Swanton, C. The Role of Aneuploidy in Cancer Evolution. Cold Spring Harbor perspectives in medicine. 7, (1), (2017).
  24. Grasso, C. S., et al. The mutational landscape of lethal castration-resistant prostate cancer. Nature. 487, (7406), 239-243 (2012).
  25. Taylor, B. S., et al. Integrative genomic profiling of human prostate cancer. Cancer cell. 18, (1), 11-22 (2010).
  26. Gao, D., et al. Organoid cultures derived from patients with advanced prostate cancer. Cell. 159, (1), 176-187 (2014).
  27. Drost, J., et al. Organoid culture systems for prostate epithelial and cancer tissue. Nature Protocols. 11, (2), 347-358 (2016).
  28. Domingo-Domenech, J., et al. Suppression of acquired docetaxel resistance in prostate cancer through depletion of notch- and hedgehog-dependent tumor-initiating cells. Cancer cell. 22, (3), 373-388 (2012).
  29. Vidal, S. J., et al. A targetable GATA2-IGF2 axis confers aggressiveness in lethal prostate cancer. Cancer cell. 27, (2), 223-239 (2015).
  30. Marín-Aguilera, M., et al. Identification of docetaxel resistance genes in castration-resistant prostate cancer. Molecular cancer therapeutics. 11, (2), 329-339 (2012).
  31. Zhao, L., et al. Identification of candidate biomarkers of therapeutic response to docetaxel by proteomic profiling. Cancer research. 69, (19), 7696-7703 (2009).
  32. Lin, H. -M., et al. Circulating microRNAs are associated with docetaxel chemotherapy outcome in castration-resistant prostate cancer. British journal of cancer. 110, (10), 2462-2471 (2014).
  33. Puhr, M., et al. Epithelial-to-mesenchymal transition leads to docetaxel resistance in prostate cancer and is mediated by reduced expression of miR-200c and miR-205. The American journal of pathology. 181, (6), 2188-2201 (2012).
  34. Rodriguez-Bravo, V., Carceles-Cordon, M., Hoshida, Y., Cordon-Cardo, C., Galsky, M. D., Domingo-Domenech, J. The role of GATA2 in lethal prostate cancer aggressiveness. Nature reviews. Urology. 14, (1), 38-48 (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics