Author Produced

זיהוי החיידק מחלת ליים, Borrelia Burgdorferi, בשנתות באמצעות PCR מקוננים

Biology
 

Summary

PCR מקוננת היא טכניקה רגיש, ספציפית, וברור כי ניתן להחיל על שנתות ש-DNA תמציות כדי לחקור Borrelia burgdorferi, סוכן סיבתי של מחלת ליים. הניסוי הראשוני של ה-PCR משתמשת תחל גנים ספציפיים כדי ליצור amplicons ארוכה, אשר לאחר מכן הופכים תבניות עבור ריאקציה עוקבות באמצעות תחל פנימי.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Wills, M. K., Kirby, A. M., Lloyd, V. K. Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR. J. Vis. Exp. (132), e56471, doi:10.3791/56471 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

מחלת ליים היא זיהום רציני בעקיצות וקטור הנגרם על ידי משפחת לאטו Borrelia burgdorferi כמו. שאתה והחיידקים, אשר מועברים לבני אדם באמצעות הנשיכה של קרציות Ixodes נגוע. הסוכן etiological ראשי בצפון אמריקה הוא stricto. שאתה Borrelia burgdorferi . אזורי הסיכון הגיאוגרפי הרחב, זה שקול לשם תמיכה בתוכניות מעקב חזקים יכולים למדוד שנתות זיהום המחירים, ולא לדווח ממצאים רופאים, וטרינרים, והציבור הרחב. הטכניקה מולקולרית של תגובת שרשרת של פולימראז מקוננים (nPCR) שימש זמן למטרה זו, והוא נותר בגישה המרכזי, זול וחזק זיהוי Borrelia קרציות והן חיות הבר.

מאמר זה מדגים את היישום של nPCR לסמן את תמציות דנ א כדי לזהות דגימות נגועים. שני עצמאית burgdorferi נולד ב- מטרות, גנים קידוד Flagellin B (FlaB) החיצון משטח חלבון א' (OspA), נעשה שימוש נרחב בטכניקה זו. הפרוטוקול כרוך אוסף שנתות, הפקת דנ א, ולאחר מכן התחלתית של ה-PCR לזהות כל אחד שני Borrelia-לוקוסים ספציפיים. תגובת שרשרת של פולימראז עוקבות (PCR) משתמש המוצר של התגובה הראשונה תבנית חדשה להפקת רסיסים קטנים, פנימי הגברה. הגישה מקוננים משפר על ירידה לפרטים והן רגישות של ה-PCR קונבנציונלי. קרציה נחשב חיובי עבור המחלה כאשר ניתן להבחין amplicons הפנימי של שני הגנים Borrelia agarose בג'ל.

Introduction

מחלת ליים (LD) הוא הזיהום בעקיצות וקטורי הנפוץ ביותר בחצי הכדור הצפוני, שכיחותה ממשיך לגדול1. מחלה מתישה זו נגרמת על ידי פתוגנים spirocheteal של ליים borreliosis (LB) מורכבים (בדרך כלל מכונה לאטו. שאתה Borrelia burgdorferi , או ס), אשר מבחינה היסטורית כוללת את הפתוגן בצפון אמריקה הדומיננטית, B. burgdorferi . שאתה stricto (אס), בנוסף afzelii ב' garinii ב', אשר נפוץ ברחבי אירופה ואסיה, ויש מינים של המתעוררים הרלוונטיות הקלינית2,3. חיידקים אלה מועברים לבני אדם באמצעות הנשיכה של נגוע Ixodes קרציות2. למרות הווקטורים בצפון אמריקה המרכזית scapularis ט וט pacificus, מרובות בתוך הסוג התגלו הנמל ולהעביר את החיידק4. בבני אדם, נולד ב- burgdorferi יכול לגרום לסימפטומים מכשל המשפיעים על העור המפרקים, הלב, מערכת העצבים, בלוטות אנדוקריניות, מערכת העיכול, האיברים הפנימיים5,6,7, 8,9,10. המרכז לבקרת מחלות ומניעתן הערכות כיום מעל 300,000 מקרים אנושיים חדשים מדי שנה בארצות הברית11,12. בזמן האבחנה היא חיובית לעיתים קרובות כאשר המחלה מאובחנים ומטופלים בשלבים המוקדמים, מחקרים הראו כי בכל מקום בין 10% ו- 60% מהחולים אשר קיבלו את משטר אנטיביוטי המומלצת המשיך לחוות סימפטומים לאחר טיפול הפסקת, בתופעה כינה תסמונת מחלת ליים טיפול פוסט (PTLDS)13,14,15. יתר על כן, עיכובים בהתערבות קלינית יכול להיווצר עקב חוסר המודעות של קרצייה, שאינם ספציפיים במצגת של המחלה הראשונית, ואת הרגישות הנמוכה של מסורתי באבחון מבוסס סרולוגיה בעת שימוש עם תחילת הזיהום. כשל לטפל במהירות והולם מאפשר התקדמות סימפטום זה יכול להתבטא יותר ויותר מתישה סיבוכים16,17. מניעת מחלת ליים לכן אבן יסוד של ניהול סיכונים. אסטרטגיות כדי להתמודד עם האיום הגוברת כוללת מעקב חזקים אמצעים כדי לציין את השכיחות הפתוגן קרציות וזהה אזורים גיאוגרפיים של דאגה.

מאמר זה מדגים את התועלת של תגובת שרשרת של פולימראז מקוננים (nPCR) ככלי מיון המולקולרי שבאמצעותו לזהות קרציות נגועים. כדי להגדיל ירידה לפרטים, שני גנים Borrelia משמשים עבור הגברה מקבילים. Flagellin B (FlaB) מקודד חלבון פילמנט הגדולות שוטון18, הגן ממוקם בכרומוזום ליניארי יחיד, בעוד שהמוצר ליפופרוטאין החיצון משטח חלבון א' (OspA) שמתווכת קרציות-פיתול קולוניזציה, הוא פלסמיד מקודד19,20. זרימת העבודה מורכב אוסף שנתות, הפקת דנ א, ולאחר מכן התחלתית של ה-PCR לזיהוי Borrelia-לוקוסים ספציפיים. PCR עוקבות משתמש המוצר של התגובה הראשונה תבנית חדשה להפקת רסיסים קטנים, פנימי הגברה. קרציה נחשב חיובי עבור Borrelia burgdorferi כאשר ניתן להבחין amplicons הפנימי של שני הגנים Borrelia agarose בג'ל.

הטכניקה nPCR, ולא של FlaB וגם מטרות הגן OspA , היה בשימוש נרחב עבור מעקב אקולוגית וזיהוי קליני של החיידק ליים מאז תחילת שנות ה-9021,22,23 ,24,25. לפני הפיתוח של פרוטוקולים מולקולרית, קרציות היו העריכו במינים תוכן הבטן אנטי -Borrelia immunofluorescence (אם) מכתים, התרבות חיידקים או שילוב הימנו26. גישות אלה סובלים מגבלות הטבועות, כולל את הצמיחה האיטית והטבע בררן27 Borrelia, בעיות ביצועים נוגדן ואת הדרישה של קרציות בשידור חי אם עיבוד21. PCR לאחר מכן אומץ כדי לספק זיהוי מהיר, רגיש, וספציפי של וקטורים נגועים. הוא הציע שיפורים מסומן על המתודולוגיה מסורתיים, כולל יישום ישיר תלויית תרבות לסוגי הדגימה מגוונים, כמו קרציות בארכיון ומתה שאחרת היה מתאים לבדיקה21,22 . עיצובים מוטוריים מקוננות נוספות להשתפר ירידה לפרטים, ורגישות של ה-PCR קלאסית על ידי העסקת שתי מערכות נפרדות של גנים ספציפיים תחל בשני סבבים רצופים של הגברה25,28.

ניסיוני ההצלחה תלויה באופן ביקורתי בחירה אסטרטגית גנים ועיצוב אמפליקון. כדי לאמוד במדויק את הנוכחות של Borrelia burgdorferi, תחל אמור לזהות פתוגנים הרלוונטי ללא cross-reacting עם חום relapsing והחיידקים גם של הסוג Borrelia . במקרה של FlaB, סגוליות זה מושגת על ידי מיקוד משתנה אזור פנימי של הגן, יותר מאשר את רצפי איגוף יחסית שנשמרת שמשותפות מגוונות חיידקים (איור 1)24,29 , 30.

Figure 1
איור 1: הרעיון של nPCR, כמופיע באמצעות Borrelia FlaB ג'ין כמטרה. טרמיני 5' ו 3' של הגן נפוצים לאורגניזמים מעבר ס Borrelia burgdorferi , טיוח אזורים אלה מתאימים להערכה ספציפית של פתוגנים הגורמים ליים. באמצעות הרצף פנים והתפאורה פחות כמטרות פריימר, שני סיבובים של PCR מתבצעות כדי לזהות אמפליקון גמר, פנימי. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

בבדיקה של קיבולת המפלה שלהם, תחל FlaB הפנים היו קיצוניות מעל 80 מבודד Borrelia שונים, וניתן למצוא כדי לזהות רק אלה הקשורים במחלת ליים24. הגבול התחתון של זיהוי של nPCR תועד ב בין שישה24 וחיידקים31 עשר מתרבות טהור, למרות הרגישות ניתן לשפר עוד יותר על ידי הדרומי סופג את אמפליקון, hybridizing radiolabelled או בדיקה chemiluminescent. צימוד הטכניקות מפחית את סף גילוי שמחולל יחיד31. על ידי השוואה ישירה, PCR יחיד-עגולים המקובלת, unprobed נמצאה לדווח הנוכחות של מינימום של4 10 והחיידקים31. יצוין, עם זאת, כי רגישות assay יהיה נמוך יותר בעת עבודה עם דגימות קליניות וסביבתיות מורכבים, בשל נוכחותם המכריע של DNA שאינם קשורים וחומרים מעכבות פוטנציאליים. האתגרים הללו יכולים שיפרו במידה רבה על ידי שימוש nPCR.

למרות ההתקדמות הטכנולוגיות מולקולרית בעשורים האחרונים, nPCR נשאר טכניקה סיכות מאמצי המעקב המודרנית. אם הטיפול נלקח עיצוב, ביצוע של פרוטוקול זה, זה בגישה רב-עוצמה, יכולת הסתגלות, פשוטה יחסית כדי ללכוד את הנוכחות של פתוגנים בוקטורים שנתות.

Protocol

1. DNA בידוד מפני קרציות

  1. רוכשים קרציות דרך שדה אוסף או מעקב סביל וטרינרים, הציבור. קרציות צריכים להיות נהרג על ידי הקפאת, להציב בשקית אטומה, שלח בטמפרטורת החדר.
    1. באמצעות טופס ההגשה, לאסוף מידע על תאריך, מיקום גיאוגרפי של המפגש, מצב קובץ מצורף שנתות, המארח מינים, נסיעות להיסטוריה של המחשב המארח.
    2. מאז ה-PCR מקונן הוא מטבעו פגיעים לזיהום, ודא כי סביבת העבודה מעבדה מוגדרת כדי למזער את הצלב-חשיפה של דגימות. פעולה זו כוללת ביצוע אלמנטים שונים של הפרוטוקול בקובץ נפרד חללים טוב מבודדים אחד מהשני הם מנקים ביסודיות את מחוטא, ולהבטיח כי כל כלים חופשיים של מזהמים.
    3. עם קבלת הדגימה, לצלם את תקתוק ולקבוע מינים, שלב התפתחותי, מין ומצב engorgement על ידי השוואה זיהוי מפתח32 .
    4. בתנאים aseptic, קטיעות השניה באמצעות גילוח סטרילי או אזמל, למקם את השברים שנתות שני צינורות microcentrifuge נפרדים.
  2. כדי לחלץ סך ה-DNA, להשתמש בכל הליך בידוד המניבה PCR תואמי תבנית; פרוטוקול זה מדגים גישה מבוססת קלאציה פשוטה.
    1. התחל על-ידי הוספת אמצעי אחסון המתאים (לעיתים קרובות בין 50-200 µL) של ריאגנט קלאציה lytic למקטע שנתות. הסכום הספציפי תלוי הדגימה הגודל engorgement ומצב; הנחיות צריך להינתן על ידי היצרן. Homogenize באמצעות כבעלי microtube.
    2. דגירה בדגימות באמבט מים ב 60 מעלות צלזיוס במשך 45 דקות, ו מערבולת בקצרה.
    3. צנטריפוגה דגימות במשך 4 דקות ב x 16,276 g (ומכרה כ-13,300 סל ד) ב- microcentrifuge שולחן העבודה.
    4. העברה תגובת שיקוע microtube טריים, שכותרתו המכיל 50 אלכוהול איזופרופיל µL, שילוב על-ידי היפוך ולאחר centrifuge מחדש כמו (1.2.3).
    5. Decant את תגובת שיקוע, ולשטוף את צניפה DNA עם 50 µL של 70% אתנול.
    6. להסיר את עודף אתנול עם פיפטה, ולאפשר בגדר מילה נהדרת. למשך 15 דקות בטמפרטורת החדר.
    7. Resuspend DNA, להוסיף 50 µL של 1 מ מ טריס pH 7.0 של דגירה בדגימות באמבט מים עבור h 1-60 ° C. עכשיו ניתן לאחסן את ה-DNA ב-20 ° C לבדיקה מולקולרית בעתיד.

2. PCR לזיהוי של Borrelia OspA , FlaBמקונן.

הערה: סקירה כללית של כללי PCR עקרונות ושיטות מסופק על ידי לורנץ, 201233.

  1. לסנתז או להשיג Borrelia גנים ספציפיים החיצוני והפנימי לנוקלאוטידים. ראה טבלה 1 פריימר ערכות שלהם גדלים אמפליקון בהתאמה, טמפרטורות ההיתוך.
פריימר שם ג'ין היעד רצף (5' - 3') גודל אמפליקון חישול טמפרטורה
FlaB החוצה Fw FlaB gcatcactttcagggtctca 503 bp 55° C
FlaB החוצה Rv FlaB tggggaacttgattagcctg
FlaB ב- Fw FlaB ctttaagagttcatgttggag 447 bp 58° C
FlaB ב Rv FlaB tcattgccattgcagattgt
OspA אאוט Fw OspA cttgaagttttcaaagaagat 487 bp 55° C
Rv OspA החוצה OspA caactgctgacccctctaat
OspA ב Fw OspA acaagagcagacggaaccag 350 bp 58° C
OspA ב Rv OspA ttggtgccatttgagtcgta

טבלה 1: הפנימיים והחיצוניים צבעי יסוד nPCR של Borrelia burgdorferiFlaB, OspA.
בפועל, לזהות תחל FlaB burgdorferi בי אס מקרוב נלווים אחרים Borrelia genospecies, בעוד OspA תחל ללכוד רק burgdorferi נולד ב- אס הגברה של שני לוקוסים יצביע B. burgdorferi. אס

  1. מראש לעקר את ארון PCR עם UV אור ו- 70% אתנול.
    הערה: כדי לצמצם אפשרות של זיהום הדגימה, סביבת עבודה זו צריכה להיות ברורים מהמיקום של שנתות לנתיחה, הפקת דנ א, והוא ג'ל אלקטרופורזה.
    1. לריצה PCR הראשונית, להשתמש את תחל החיצוני בשילוב עם תבנית ה-DNA התאושש בשלב 1.0 לעיל, ולהגדיר את תערובת התגובה כמפורט בטבלה מס ' 2. במקביל, לבצע חיובי הבקרה פועל המורכב מאומת Borrelia DNA, ופועל שליטה שלילי כולל תגובות לא-תבנית כדי לזהות זיהום ריאגנט, תרסיס. להוסיף את הדנ א בסוף כדי לצמצם אפשרות של ריאגנטים זיהום. ודא שכל שפופרת סגורה בכלל פעמים כאשר ריאגנטים אינן מתווספות וסגור צינורות מיד לאחר תוספת ה-DNA, ולפני צינורות אחרים נפתחים.
    2. תוכנית הצנטרפוגה תרמי כדלקמן: 95 מעלות צלזיוס למשך 5 דקות; 40 מחזורי 95 ° C 15 s, חישול טמפרטורה ל 30 s, 72 מעלות צלזיוס במשך 45 s; 72 מעלות צלזיוס למשך 5 דקות; ולהחזיק ב 4 º C.
  2. ביצוע השלב השני של ה-PCR הדומה התגובה הראשונה, אלא להשתמש תחל פנימי עם 2 µL של המוצר הראשון PCR (מיוצר 2.2.2).
    הערה: התגובה כרכים ניתנים שוב בטבלה 2. יש לנקוט כדי למנוע זיהום של amplicons על-ידי תבנית ה-DNA מתווסף אחרונה מבטיחות כי צינורות היחיד המתאים דוגמא אחת פתוחות בו-זמנית.
     
    רכיב PCR # 1 כרכים PCR # 2 כרכים
    Taq מיקס מאסטר פולימראז 2 X 12.5 ΜL 12.5 ΜL
    נוקלאז ללא מים 8.5 ΜL 8.5 ΜL
    10 מיקרומטר תחל לפנים ולא לאחור תחל החיצוני 1.0 µL 1.0 µL תחל פנימי
    תבנית ה-DNA µL 2.0, בין מדגם החילוץ (1.2.7) µL 2.0, סיבוב 1 של ה-PCR (2.2.2)
    טבלה 2: ה-PCR התגובה תערובות amplifications הראשון והשני.
     
    1. תוכנית הצנטרפוגה תרמי כמו קודם, אבל להתאים את טמפרטורת מחזק כדי להתאים את צבעי יסוד הפנימי (ראה טבלה 1).

3. Agarose בג'ל והדמיה

הערה: לקבלת הוראות בסיסיות המפריד בין ה-DNA על ידי אלקטרופורזה, ראה לי et al., 201234.

  1. הכנת ג'ל 1.2% agarose באמצעות מאגר X SB 20 (0.2 מ' NaOH, pH פנמיות 0.8 מ' 8), מדולל 1 X, ולהוסיף כ 5 µL של כתם דנ א, לפני לשפוך, אם מראש מכתים של הג'ל רצוי.
  2. לטעון 10 µL של המוצר מן התגובה השנייה PCR (הפנימי) של כל ניסיוני, ולטעום שליטה, לצד סולם bp 100 (5 µL).
    1. Electrophorese עבור 1 h 107 V (5V/ס מ).
  3. להציג ולתעד את הג'ל באמצעות transilluminator ו המשויכים מצלמה ותוכנות.

Representative Results

nPCR היא גישה אלגנטית כדי להגביר את ירידה לפרטים ואת הרגישות של זיהוי הפתוגן, במיוחד כאשר הם דוגמאות סביבתיים מורכבים תחת חקירה. כמתואר באיור1, שני סיבובים של PCR פילוח אזור אסטרטגי של לוקוס Borrelia FlaB (וגם OspA, לא בתמונה) יכול לדווח על נוכחותם של חיידקים Borrelia burgdorferi באמצעות הדור של הפנימית קצר amplicons. כאשר נפתרה על ידי אלקטרופורזה בג'ל, המוצרים FlaB התגובה OspA מן כל שנתות יכול להיות חזותי הבקיע והשוו פקדים. איור 2, מזהים ייחודיים הדגימה מסופקים לאורך החלק העליון של כל ג'ל, ויש לא-תבנית בקרות תרסיס מיוצגים בצד השמאלי המרוחק וימינה, בהתאמה, סמוך הסולמות.

להקות אמפליקון חזקים הם נראים בבירור בדגימות נסיוני בחירה, והם בקלות להבחין בין תחל עודפים, שרידי דנ א (איור 2). בהתבסס על עקרונות עיצוב ניסיוני שנקבעו, קרצייה נחשב חיובי עבור Borrelia כאשר במקביל פקדים שלילי להפגין אין הגברה, amplicons הפנימית מיוצרים מ תחל גם FlaB וגם OspA . במקרה זה, דגימות T907, T604 ו- T606 פגש מעקב לקריטריונים המחלה ליים (איור 2). . By contrast, T923 היה רק חיובי עבור OspA, תוצאה אשר ישנם מספר הסברים אפשריים: א) תקתוק ממוצא יצא שלילי Borrelia, אך ההכנה OspA PCR החיצוני או הפנימי spuriously היה נגוע תבנית ה-DNA (שים לב זיהום מערכתי של ריאגנטים היה לשלול באמצעות פקדי שלילי), B) תקתוק נשא ליים Borrelia, אבל כמויות נמוכות תבנית או שגיאה ניסיוני מנעה הגברה של FlaBאו C) אורגניזם היה נוכח זה הכיל את רצף OspA שנשמרת, אבל חסרה Flagellin או היה אין די זהות באזור ממוקד FlaB כדי anneal כדי תחל. ואכן, כבר ציינו דמיון רצף OspA במגוון רחב של אורגניזמים, כולל צמחים ובעלי חיים28. המצב הנגד, הגברה של יותר והתפאורה ג'ין Flagellin , אבל לא את הגן OspA , יכול להצביע על זן Borrelia קשורים. בפועל, פרוטוקול זה מניב תוצאות יחיד-חיוביות יותר OspA מאשר תחל FlaB , רומז תרחיש 'A' הוא ההסבר שהכי פחות סביר. ללא ניתוח ניסיוני נוסף של הדגימה במחלוקת, זאת, לא ניתן לקבוע את המקור של התוצאה יחיד-חיובית. הגדלת מספר טכני משכפל המבוצעת על דגימות דו-משמעית עשוי לעזור ליישב את מעמדם האמיתי, מאז כל מזהמים שהוצגו spuriously על תגובות קודמות לא יהיה נוכח ב- DNA בארכיון. עם זאת, אם הבאים המגיבה תחל אלה ייכשלו לספק תוצאות חותכות, לוקוסים Borrelia אחרים יכול תיחקר על-ידי ה-PCR. Amplicons שנוצר מתוך תגובות אלו יכול להיות גם רציף, בהשוואה בין מבודד כדי לסייע להקצות זהות, להעריך את מידת המתח גאוס. Sapi ועמיתיו לספק דוגמה של זרימת עבודה זו באמצעות דגימות קליניות האנושי35.

כל הגורמים בחשבון, יש כבר מוערך הקריטריונים פרוטוקול ופרשנות מחולקת לרמות להניב כוזב חיובי ו- false שלילי המחירים של 0.17% ל- 0.0063%, בהתאמה.

Figure 2
איור 2 : זיהוי של Borrelia burgdorferi בשנתות בודדים על-ידי nPCR של FlaB ו OspA. קודי המוקצים לכל שנתות מיוצגים לרוחב החלק העליון היחסי של ג'ל, זהויות יישור אנכי לדווח הזיהוי של OspA ושל FlaB כל הדגימה. מסלולים זכאי B בחלק השמאלי של הפקדים מתבנית לא לייצג תמונה, אמנם תרסיס פקדים כדי ללכוד של מעבדה זיהום (סמטאות ימין). אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Discussion

במשך עשרות שנים של שימוש, טכניקות מבוססות PCR בעקביות הוכיחו את ערכם זיהוי Borrelia של דגימות arthropod, יונקים, אם Borrelia לבוא ממקורות סביבתיים או קליניים. PCR מציע שיפורים רבים קיימות גישות מעקב. ראוי לציין, שזה לא מסתמך על פיתוח, הביצועים של נוגדן ריאגנטים, במקום זאת ניתן להתאים בקלות לזהות מטרות חדשות עניין פשוט על ידי שינוי רצף פריימר. PCR להכיל גם הערכת לוקוסים מרובות במקביל, או באופן עצמאי או באמצעות תגובת מולטיפלקס. ניתן להחיל אותה על תשומות הדגימה מגוונים, כולל קרציות בארכיון ורענן22, חיה או בנוזלי הגוף האנושי של רקמת resected25. PCR גם התשואות amplicons זה יכול להיות מעובד יותר, לדוגמה על-ידי אנזים הגבלה עיכול, בדיקה הכלאה או רצף, כדי לספק תובנות זהות מיקרוביאלי21מוגברת.

ככלי קליני, PCR עדיפה מבחינה מושגית על האבחון סרולוגית רגיל, כפי שהיא מספקת מהווה אינדיקציה ישירה של נוכחות חיידקית, במקום להסתמך על התגובה החיסונית מארח כאמצעי משני לזיהום. לעומת זאת, ליים borreliosis מזוהה עם עומס מיקרוביאלי צנוע יחסית (< אורגניזמים 50/mL של שתן או פלזמה) ותוצאות spirochetemia ארעי, אשר יכולים להצמיח שלילית25. הרגישות של טכניקה זו במרפאה משתנה במידה ניכרת בהתאם לסוג הרקמה, שלב של זיהום, ובכל תנאי לדוגמה, נופל בין 12.5% ל- 62% במחקרים קיימים של דם, נוזל מוחי שדרתי הרקמה ביופסיה36. רגישות מולקולרית מגבלות אינם מעניינו של אם PCR נעשית לאחר התרבות חיידקי, אולם התאוששות של קיימא והחיידקים דגימות קליני הוכיח באופן דומה מאתגר. רק לאחרונה יש פרוטוקולים כבר אופטימיזציה עבור תשואה גבוהה יותר35. בינתיים, הכרס קרצייה נגועה למבוגרים יכול הנמל בממוצע בכל מקום מ- 2,000 ל מעל 50,000 Borrelia37,38,39, אשר באופן יציב בטווח זיהוי של nPCR. לפיכך, הפרוטוקול הוא גם מתאים למאמצים מעקב שנתות.

למרות יתרונותיה הרבים, nPCR מציבים אתגרים מסוימים, והיכולת של טכניקה זו לדווח במדויק שנתות זיהום ולכן תלויה הבחירה האסטרטגית של הגנים ושל amplicons, מוקפד זרימות עבודה ניסויית לשחזר איכות דנ א מ דגימות תוך מזעור קרוס-חשיפה של דגימות, ושימוש של הפקדים המתאימים ידווח מזהמים סביבת מעבדה, ריאגנטים. לפני כל ניסוי, והיקפה, הכוונות של החקירה צריכה כל כך ברור כך אתרים המקודדים גנטי המתאים ואזורים, ניתן לבחור אם המטרה היא לספק ומציג מסך לא משוחדת ס גורמי ליים Borrelia burgdorferi מורכבים, תחל ליצור כדי לזהות את כל של זנים הקשורים עם זיקה דומה, הגברה יעילות, ללא לכידת בלא אורגניזמים25. יכול להיות מעוצב חדשה תחל ועל המוערך סיליקו באמצעות כלי תוכנה כמו פריימר-הפיצוץ40, למרות שהם גם לאמת השפעול נגד הפניה רגיל מבודד לפני שחל דגימות uncharacterized. המטרה של ההליך מיצוי הדנ א היא להתאושש תבנית חיידקים שלמים מדגם הסביבה מעורב (שנתות homogenate). שלב אופציונלי לפני שתמשיך עם ה-PCR היא להעריך את תקינות ה-DNA שחולץ. בנוסף, ריאקציות מקבילות יכול להגדיר את היעד גנים משק הבית ב תקתוק. השיטה השנייה יכול גם להצביע על קיומו של מעכבי בתערובת התגובה, מתן ביטחון מוגבר כי Borrelia תגובות שליליות הן בשל העדר של האורגניזם, ולא על נוכחות מזהם מעכבות.

רגישות מוגברת של הגישה PCR מקוננים בא על חשבון זיהום פוטנציאליים שיוצר תוצאות חיוביות שגויות. יכול להיות מוצג תבנית אקסוגני מדגם במהלך שנתות ניתוח ושחזור DNA, או בתהליך של הגדרת את התגובות הגברה חיצוניות ופנימיות. לכן חשוב במיוחד לעקוב אחר פרוטוקולים האימון הטוב ביותר עבור PCR להימנע תבנית או אמפליקון זיהום צולב. אלה כוללים את השימוש תחנות עבודה נפרד עם ליאורה פרידמן עצמאית, בלימה ב- PCR וארונות בטיחות ביולוגית, ובמידת יסודית כימית פיזית ומנקה עיקור של משטחים, ריאגנטים, וטיפול זהיר של דנ א 41. הפקדים מתבנית לא חיוניים גם בזיהוי של ריאגנטים מניות זיהום. פגיעות מסוג מסוים של nPCR הוא אמפליקון טיפול זה מתרחשת בעת העברת המוצרים של התגובה הראשונה לתוך כלי ה-PCR שני. מאז המטרה DNA כבר עברה העשרה מעריכי הדגימות החיוביות, השלב זה נוטה במיוחד כדי זיהום צולב, נוהל בודדת-הצינור nPCR פותחה כדי לעקוף מגבלה זו. בגישה זו, שתי קבוצות של צבעי יסוד גן נתון יתווספו יחד צינור התגובה נשאר אטום עבור שני סיבובים של PCR31. זוגות תחל החיצוני והפנימי חייב להיות ברור למה, כזה כי הזוג החיצוני מגביר את תבנית בטמפרטורה מחזק גבוהה זה אוסרני עבור תחל הפנימית. בסיבוב השני, הטמפרטורה מחזק הוא הוריד כדי להכיל את זוג פנימי. לא רק האם זה לעקוף את צעד שעשוי להיות מבלבלים, הוא גם מאפשר שימוש נוסף נגד זיהום מודד31,42. עם זאת, שינוי זה עשוי להקריב רגישות וזמינותו. ללא קשר הגישה, הגדלת מספר משכפל הטכנית לבצע באופן עצמאי על מדגם תסייע לזהות זיהום כדין.

טכניקות מולקולריות המשיכו להתפתח מאז כניסתה של nPCR, גישות חדשות אלה מציעים יתרונות בחר העיצובים המקוריים, אמנם על הגדילה בהוצאה כספית. כפי שהשם מרמז, ה-PCR כמותי (qPCR או אמת זמן (RT)-PCR) מאפשר הספירה של פתוגנים במדגם, ואילו טכניקות שגרתיות איכותי בטבע43. הרגישות של qPCR אמנם הדיווחים דומה לזה של nPCR38, זה יכול להשתנות בהתאם פריימר מאפיינים28. וריאציה של qPCR המשתמשת משואות מולקולרית (MB) במקום קונבנציונאלי הגששים TaqMan הראו גם מבטיחה זיהוי Borrelia ב דגימות קליניות-44,-45,-46. בשל מבנה שניוני הייחודי שלהם, משואות מולקולרית לייצר הדיווחים התחתון רקע זריחה, אותות לגיטימי גבוה יותר, ובכך מספק רגישות מעולה47. הערכות קליניים מראים את הסף זיהוי פוטנציאל של בין עשרה ואחד והחיידקים44,45. יתר על כן, הטכניקה יושם בהצלחה בתגובות מולטיפלקס בו-זמנית לזהות גנים המארח בתרבית של44 ו אחרים שנוטלים פתוגנים45, אשר אינו בר השגה בחפץ-לב עם nPCR. שינויים עיצוב אחרים כוללים טכנולוגיה PCR (ddPCR) דיגיטלי רביב, אשר יכולים לכמת DNA ללא שימוש עיקול רגיל39,48. הגבול התחתון זיהוי של טכניקה זו עבור Borrelia הוא גם שמרכז/לדוגמה בערך עשרה39. בהשוואה nPCR, גישות אלה יש גם את היתרון של צמצום פוטנציאל זיהום, כפי שהם דורשים רק נוהל בודדת הגברה.

אם מטרת המעקב במקום לעשות פרופיל תכולת חיידקי מגוונת קרצייה, מטוסי אף-16 rRNA metagenomic ההקרנה היא אפשרות אטרקטיבית49. אף על פי גישה זו היא costlier, דורש מיוחדים סקוונסרים דנ א לא נמצאו כל מעבדות ביולוגיה מולקולרית, מחייבת פרשנות המבוססת על ביואינפורמטיקה מתוחכמים יותר, הוא יכול ללכוד קשת רחבה של חיידקים יותר במדויק מייצגים את העומס הפתוגן של וקטור.

בעוד qPCR ונגזרותיו הן שיטות של בחירה עבור יישומים כמותית, metagenomics מספקים מלאי רחב של microbiome שנתות, מאמצי המעקב יישוב מודאגים לעתים קרובות עם דיווח בינארי של נוכחות או היעדרות של פתוגנים אחד או כמה בוקטור. בנסיבות כאלה, גישות אלה חדשה יותר, משוכלל יותר עשויים להציג המורכבות מיותר ואת הנטל הכלכלי לתוך התהליך. מסיבות אלו, nPCR יש מהתעמולה במבחן הזמן כמו טכניקה מרכזית ב שנתות בדיקות.

Disclosures

המחברים אין לחשוף.

Acknowledgments

המחברים רוצים להודות Kami האריס לעיצוב פריימר, אשלי McKibbon, ג'סיקה תומאס-Ebbett עבור הצילומים, ג'ון בלייקלי, אלכסנדרה פולי-Eby, כריס לאנגלי, ג'ולי לואיס, קלסי מקנטייר, אשלי McKibbon, כריס אלוהים ואני רוזי את הכלב על הופעה וידאו. א צברי נתמכה על ידי קרן המחקר הקנדי של מחלת ליים, מימון הפרויקט נמסר על-ידי מדעי הטבע, הנדסה מחקר המועצה של קנדה (NSERC). M. K. B. W קיבל משכורת המימון של קרן חדשנות ניו ברנזוויק (NBIF).

Materials

Name Company Catalog Number Comments
LabGard Class II, Type A2 biological safety cabinet Nuaire ES AIR NU-543 
Razor blades VWR 55411-050 0.22 mm thickness
Microfuge Tubes (Microtubes 1.5 mL) Axygen 311-08-051
AquaGenomic  MultiTarget Pharmaceuticals 2030 DNA extraction reagent
Microtube Pestle Diamed DIATEC610-1551 Designed for 1.5 ml tubes
Water bath - Isotemp 202 Fishse Scientific 15-462-2
Vortex Labnet S0100 CAN
Spectrafuge 24D Digital Microcentrifuge Labnet C2400
Isopropanol Sigma-Aldrich 190764
BIS-TRIS Sigma-Aldrich B9754
Primer Synthesis Sigma-Aldrich OLIGO
PCR Cabinet Misonix PCR6-482
PCR tube with attached flat caps 0.2mL VWR 20170-012
GoTaq Green Master Mix 2x Promega M7123
Nuclease-free water Promega M7123 The water comes with the GTG
Spectrafuge Mini Labnet C1301
SYBR Safe DNA Stain 10,000X Concentration EDVOTEK 608
Froggarose LE (Molecular Biology Grade Agarose) FroggaBio A87-500G
GD 100 bp DNA Ladder FroggaBio DM001-R500 
Electrophoresis power pack  VWR VWR 105 EC Apparatus Corporation
Fluor-S MultiImager  BioRad 170-7700 (Serial number 433B0154)
Quantity One 1-D Analysis Software (V. 4.5.2) BioRad 1709600

DOWNLOAD MATERIALS LIST

References

  1. Schotthoefer, A. M., Frost, H. M. Ecology and epidemiology of Lyme borreliosis. Clin. Lab. Med. 35, (4), 723-743 (2015).
  2. Franke, J., Hildebrandt, A., Dorn, W. Exploring gaps in our knowledge on Lyme borreliosis spirochaetes - Updates on complex heterogeneity, ecology, and pathogenicity. Ticks Tick Borne Dis. 4, (1-2), 11-25 (2013).
  3. Rudenko, N., Golovchenko, M., Vancova, M., Clark, K., Grubhoffer, L., Oliver, J. H. Jr Isolation of live Borrelia burgdorferi sensu lato spirochaetes from patients with undefined disorders and symptoms not typical for Lyme borreliosis. Clin. Microbiol. Infect. 22, (3), 267.e9-267.e15 (2016).
  4. Scott, J. D., Clark, K. L., Anderson, J. F., Foley, J. E., Young, M. R., Durden, L. A. Lyme Disease Bacterium, Borrelia burgdorferi Sensu Lato, Detected in Multiple Tick Species at Species at Kenora, Ontario, Canada. J Bacteriol Parasitol. 08, (01), 1-10 (2017).
  5. Sperling, J., Middelveen, M., Klein, D., Sperling, F. Evolving perspectives on lyme borreliosis in Canada. Open Neurol J. 6, 94-103 (2012).
  6. Pachner, A. R. Early disseminated Lyme disease: Lyme meningitis. Am. J. Med. 98, (Supplement 1), 30S-43S (1995).
  7. Mikkilä, H. O., Seppälä, I. J., Viljanen, M. K., Peltomaa, M. P., Karma, A. The expanding clinical spectrum of ocular lyme borreliosis. Ophthalmology. 107, (3), 581-587 (2000).
  8. Mc Causland, F. R., Niedermaier, S., Bijol, V., Rennke, H. G., Choi, M. E., Forman, J. P. Lyme disease-associated glomerulonephritis. Nephrol. Dial. Transplant. 26, (9), 3054-3056 (2011).
  9. Tunev, S. S., Hastey, C. J., Hodzic, E., Feng, S., Barthold, S. W., Baumgarth, N. Lymphoadenopathy during Lyme Borreliosis Is Caused by Spirochete Migration-Induced Specific B Cell Activation. PLoS Pathog. 7, (5), e1002066-e1002014 (2011).
  10. Kostić, T., et al. Manifestations of Lyme carditis. Int. J. Cardiol. 232, 24-32 (2017).
  11. Hinckley, A. F., et al. Lyme Disease Testing by Large Commercial Laboratories in the United States. Clin. Infect. Dis. 59, (5), 676-681 (2014).
  12. Nelson, C. A., et al. Incidence of Clinician-Diagnosed Lyme Disease, United States 2005-2010. Emerg. Infect. Dis. 21, (9), 1625-1631 (2015).
  13. Aucott, J. N., Rebman, A. W., Crowder, L. A., Kortte, K. B. Post-treatment Lyme disease syndrome symptomatology and the impact on life functioning: is there something here? Qual Life Res. 22, (1), 75-84 (2012).
  14. Aucott, J. N., Crowder, L. A., Kortte, K. B. Development of a foundation for a case definition of post-treatment Lyme disease syndrome. Int. J. Infect. Dis. 17, (6), e443-e449 (2013).
  15. Adrion, E. R., Aucott, J., Lemke, K. W., Weiner, J. P. Health care costs, utilization and patterns of care following Lyme disease. PLoS ONE. (2015).
  16. Cameron, D. J. Consequences of treatment delay in Lyme disease. Journal of Evaluation in Clinical Practice. 13, (3), 470-472 (2007).
  17. Johnson, L., Aylward, A., Stricker, R. B. Healthcare access and burden of care for patients with Lyme disease: a large United States survey. Health policy. 102, (1), 64-71 (2011).
  18. Motaleb, M. A., et al. Borrelia burgdorferi periplasmic flagella have both skeletal and motility functions. Proc. Natl. Acad. Sci. U.S.A. 97, (20), 10899-10904 (2000).
  19. Rosa, P. A., Tilly, K., Stewart, P. E. The burgeoning molecular genetics of the Lyme disease spirochaete. Nat. Rev. Microbiol. 3, (2), 129-143 (2005).
  20. Kenedy, M. R., Lenhart, T. R., Akins, D. R. The role of Borrelia burgdorferi outer surface proteins. FEMS Immunol. Med. Microbiol. 66, (1), 1-19 (2012).
  21. Persing, D. H., Telford, S. R., Spielman, A., Barthold, S. W. Detection of Borrelia burgdorferi infection in Ixodes dammini ticks with the polymerase chain reaction. J. Clin. Microbiol. 28, (3), 566-572 (1990).
  22. Persing, D. H., et al. Detection of Borrelia burgdorferi DNA in museum specimens of Ixodes dammini ticks. Science. 249, (4975), 1420-1423 (1990).
  23. Wise, D. J., Weaver, T. L. Detection of the Lyme disease bacterium, Borrelia burgdorferi, by using the polymerase chain reaction and a nonradioisotopic gene probe. J. Clin. Microbiol. 29, (7), 1523-1526 (1991).
  24. Johnson, B. J., Happ, C. M., Mayer, L. W., Piesman, J. Detection of Borrelia burgdorferi in ticks by species-specific amplification of the flagellin gene. Am. J. Trop. Med. Hyg. 47, (6), 730-741 (1992).
  25. Schmidt, B. L. PCR in laboratory diagnosis of human Borrelia burgdorferi infections. Clin. Microbiol. Rev. 10, (1), 185-201 (1997).
  26. Ogden, N. H., et al. Ixodes scapularis ticks collected by passive surveillance in Canada: analysis of geographic distribution and infection with Lyme borreliosis agent Borrelia burgdorferi. J. Med. Entomol. 43, (3), 600-609 (2006).
  27. Doern, G. V. Detection of selected fastidious bacteria. Clin. Infect. Dis. 30, (1), 166-173 (2000).
  28. Nolte, O. Nucleic Acid Amplification Based Diagnostic of Lyme (Neuro-)borreliosis - Lost in the Jungle of Methods, Targets, and Assays? Open Neurol J. 6, (1), 129-139 (2012).
  29. Wallich, R., Moter, S. E., Simon, M. M., Ebnet, K., Heiberger, A., Kramer, M. D. The Borrelia burgdorferi flagellum-associated 41-kilodalton antigen (flagellin): molecular cloning, expression, and amplification of the gene. Infect. Immun. 58, (6), 1711-1719 (1990).
  30. Picken, R. N. Polymerase chain reaction primers and probes derived from flagellin gene sequences for specific detection of the agents of Lyme disease and North American relapsing fever. J. Clin. Microbiol. 30, (1), 99-114 (1992).
  31. Picken, M. M., Picken, R. N., Han, D., Cheng, Y., Strle, F. Single-tube nested polymerase chain reaction assay based on flagellin gene sequences for detection ofBorrelia burgdorferi sensu lato. Eur. J. Clin. Microbiol. Infect. Dis. 15, (6), 489-498 (1996).
  32. Keirans, J. E., Litwak, T. R. Pictorial key to the adults of hard ticks, family Ixodidae (Ixodida: Ixodoidea), east of the Mississippi River. J. Med. Entomol. 26, (5), 435-448 (1989).
  33. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J Vis Exp. (63), e3998 (2012).
  34. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose Gel Electrophoresis for the Separation of DNA Fragments. J Vis Exp. (62), e3923 (2012).
  35. Sapi, E., Pabbati, N., Datar, A., Davies, E. M., Rattelle, A., Kuo, B. A. Improved culture conditions for the growth and detection of Borrelia from human serum. Int J Med Sci. 10, (4), 362-376 (2013).
  36. Waddell, L. A., Greig, J., Mascarenhas, M., Harding, S., Lindsay, R., Ogden, N. The Accuracy of Diagnostic Tests for Lyme Disease in Humans, A Systematic Review and Meta-Analysis of North American Research. PLoS ONE. 11, (12), e0168613-e0168623 (2016).
  37. Brunet, L. R., Spielman, A., Telford, S. R. III Density of Lyme disease spirochetes within deer ticks collected from zoonotic sites. Am. J. Trop. Med. Hyg. 53, (3), 300-302 (1995).
  38. Wang, G., et al. Real-time PCR for simultaneous detection and quantification of Borrelia burgdorferi in field-collected Ixodes scapularis ticks from the Northeastern United States. Appl. Environ. Microbiol. 69, (8), 4561-4565 (2003).
  39. King, J. L., Smith, A. D., Mitchell, E. A., Allen, M. S. Validation of droplet digital PCR for the detection and absolute quantification of Borrelia DNA in Ixodes scapularis ticks. Parasitology. 144, (4), 359-367 (2017).
  40. Ye, J., Coulouris, G., Zaretskaya, I., Cutcutache, I., Rozen, S., Madden, T. L. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 13, (1), 134 (2012).
  41. Kwok, S., Higuchi, R. Avoiding false positives with PCR. Nature. 339, (6221), 237-238 (1989).
  42. Rys, P. N., Persing, D. H. Preventing false positives: quantitative evaluation of three protocols for inactivation of polymerase chain reaction amplification products. J. Clin. Microbiol. 31, (9), 2356-2360 (1993).
  43. Pahl, A., Kühlbrandt, U., Brune, K., Röllinghoff, M., Gessner, A. Quantitative detection of Borrelia burgdorferi by real-time PCR. J. Clin. Microbiol. 37, (6), 1958-1963 (1999).
  44. Saidac, D. S., Marras, S. A. E., Parveen, N. Detection and quantification of Lyme spirochetes using sensitive and specific molecular beacon probes. BMC Microbiol. 9, (1), 43 (2009).
  45. Chan, K., Marras, S. A. E., Parveen, N. Sensitive multiplex PCR assay to differentiate Lyme spirochetes and emerging pathogens Anaplasma phagocytophilum and Babesia microti. BMC Microbiol. 13, (1), 295 (2013).
  46. Schlachter, S., Chan, K., Marras, S. A. E., Parveen, N. Detection and Differentiation of Lyme Spirochetes and Other Tick-Borne Pathogens from Blood Using Real-Time PCR with Molecular Beacons. Methods Mol. Biol. 1616, 155-170 (2017).
  47. Wang, L., Blasic, J. R. Jr, Holden, M. J., Pires, R. Sensitivity comparison of real-time PCR probe designs on a model DNA plasmid. Anal. Biochem. 344, (2), 257-265 (2005).
  48. Sze, M. A., Abbasi, M., Hogg, J. C., Sin, D. D. A Comparison between Droplet Digital and Quantitative PCR in the Analysis of Bacterial 16S Load in Lung Tissue Samples from Control and COPD GOLD 2. PLos ONE. 9, (10), e110351-e110356 (2014).
  49. Sperling, J. L., et al. Comparison of bacterial 16S rRNA variable regions for microbiome surveys of ticks. Ticks Tick Borne Dis. 1-9 (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics