Author Produced

Обнаружение спирохета Лайма, Borrelia Burgdorferi, в тактах, используя вложенные PCR

Biology
JoVE Journal
Biology
AccessviaTrial
 

Summary

Вложенные ПЦР является чувствительной, конкретные и простой метод, который может быть применен к клеща, который извлекает ДНК для Borrelia burgdorferi, возбудителя болезни Лайма. Начальный эксперимент PCR использует ген специфические праймеры для создания длинные ампликонами, который затем стать шаблоны для последующей реакции с использованием внутренней грунтовки.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Wills, M. K. B., Kirby, A. M., Lloyd, V. K. Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR. J. Vis. Exp. (132), e56471, doi:10.3791/56471 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Болезнь Лайма является серьезной трансмиссивные инфекции, вызванных семью lato sensu Borrelia burgdorferi спирохеты, которые передаются человеку через укус инфицированных клещей Ixodes . Основной этиологический агент в Северной Америке является Borrelia burgdorferi stricto sensu. Как расширить географический риск регионов, это разумно для поддержки надежного наблюдения программы, которые можно измерить клеща инфекции и сообщать результаты врачи, ветеринары и широкой общественности. Молекулярные техники вложенных полимеразной цепной реакции (nPCR) уже давно используется для этой цели, и он остается Центральный, недорогой и надежный подход в обнаружении Borrelia клещей и дикой природы.

Эта статья демонстрирует применение nPCR поставить галочку ДНК экстрактов для выявления инфицированных особей. Два независимых B. burgdorferi цели, гены кодирования Флагеллин B (FlaB) и космического поверхности белок А (OspA), широко использовались с этой техникой. Протокол включает в себя сбор клеща, экстракции ДНК, а затем первоначальный раунд ПЦР для выявления каждого из двух Borrelia-конкретных локусов. Последующей полимеразной цепной реакции (ПЦР) использует продукт первой реакции как новый шаблон для создания меньше, внутренней амплификация фрагментов. Вложенные подход улучшает специфичность и чувствительность обычных PCR. Клещ считается положительным для возбудителя, когда внутренний ампликонов от обоих Borrelia гены могут быть обнаружены электрофорезом геля агарозы.

Introduction

Болезнь Лайма (LD) является наиболее распространенными переносчиками инфекции в северном полушарии, и ее распространенность продолжает увеличиваться1. Этот изнурительной болезни вызвана spirocheteal патогены боррелиоз Лайма (LB) комплекс (часто называют lato sensu Borrelia burgdorferi , или s.l.), который исторически состоит большей частью Северной Америки патогена, б. burgdorferi stricto sensu (s.s), в дополнение к B. афцели и б. garinii, которые широко распространены по всей Европе и Азии и видов новых клиническое значение2,3. Эти бактерии передаются человеку через укус инфицированных Ixodes клещи2. Хотя основные векторы Северной Америки I. scapularis и I. pacificus, гавани и передавать бактерии4были найдены несколько видов этого рода. В организме человека б. burgdorferi может вызвать мультисистемный симптомы, затрагивающие кожи, суставов, сердца, нервной системы, эндокринных желез, желудочно-кишечного тракта и внутренних органов5,6,7, 8,9,10. Центр по контролю и профилактике заболеваний в настоящее время оценкам более 300 000 новых случаев заболевания людей ежегодно в Соединенных Штатах11,12. В то время как прогноз благоприятен, часто когда болезнь диагностируется и лечится на ранних стадиях, исследования показали, что где-то между 10% и 60% пациентов, получавших Рекомендуемые схемы антибиотикотерапии, продолжали испытывать симптомы после терапии прекращение, в явление называется синдром болезни Лайма лечение пост (PTLDS)13,14,15. Кроме того задержки в клинические вмешательства могут возникать в результате отсутствия осведомленности о укуса клеща, неспецифичный представления первоначального болезни и низкая чувствительность Традиционные серологические методы диагностики при использовании в начале инфекции. Неспособность лечения быстро и надлежащим образом позволяет прогрессирование симптомов, которые могут проявляться в более изнурительной осложнений16,17. Болезнь Лайма профилактика поэтому является краеугольным камнем управления рисками. Стратегии борьбы с этой растущей угрозы включают меры надежные наблюдения для обозначения возбудителя распространенности в тактах и определить географические регионы озабоченность.

Эта статья демонстрирует полезность вложенных полимеразной цепной реакции (nPCR) в качестве инструмента молекулярной скрининг для выявления инфицированных клещей. Для повышения специфичности, два Borrelia генов используются для параллельных амплификации. Флагеллин B (FlaB) кодирует белок основной нити накала жгутика18, и ген расположен на один линейный хромосоме, в то время как продукт липопротеинов космического поверхности белок А (OspA) опосредует клеща средняя колонизации, и кодировке плазмида19,20. Рабочий процесс состоит из коллекции клеща, экстракции ДНК, а затем первоначальный раунд ПЦР для выявления Borrelia-конкретных локусов. Последующие PCR использует продукт первой реакции как новый шаблон для создания меньше, внутренней амплификация фрагментов. Галочку считается позитивные для Borrelia burgdorferi , когда внутренний ампликонов от обоих Borrelia гены могут быть обнаружены электрофорезом геля агарозы.

NPCR технику и вялые мускулы и OspA гена цели, широко использовались для экологического наблюдения и клинических обнаружения спирохета лайма с начала 90-х годов21,,2223 ,24,25. До разработки молекулярных протоколов клещей были оценены подвергать содержимое кишки анти -Borrelia иммунофлюоресценции (если) пятнать, микробные культуры или их комбинации26. Эти подходы страдают от ограничений, присущих, включая медленный рост и привередливый характер Borrelia27, проблемы производительности антитела, и требование живут клещи для обработки если21. PCR был впоследствии принят предоставлять быстрый, чувствительной и конкретных выявление зараженных векторов. Он предложил заметные улучшения над традиционной методологии, включая прямые культуры независимое приложение для образцов различных типов, таких как мертвых и архивных клещей, которые иначе были бы непригодны для тестирования21,22 . Вложенные экспериментальных образцов далее совершенствовать специфичность и чувствительность классической ПЦР, используя два различных набора генов специфические праймеры в двух последовательных раундах, усиления25,28.

Экспериментальная успех зависит от стратегического гена отбора и amplicon дизайн. Точно оценить наличие Borrelia burgdorferi, грунтовки следует выявить соответствующие возбудители без cross-reacting с возвратным тифом спирохеты также в род Borrelia . В случае вялые мускулыЭта специфика достигается путем ориентации переменной внутренней области гена, а не относительно сохранены Фланкируя последовательности, которые являются общими для различных бактерий (рис. 1)24,29 , 30.

Figure 1
Рисунок 1: концепция nPCR, как показано с помощью Borrelia FlaB ген как цель. 5' и 3' Термини гена являются общими для организмов за пределами Borrelia burgdorferi с.л., оказание этих регионов неподобающе для конкретной оценки Лайма причиняя патогенов. Использование менее сохраняется внутренней последовательности как грунтовка целей, два раунда ПЦР выполняются обнаружить окончательный, внутренней ампликон. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

В испытание их различительную способность интерьер грунтовки FlaB были оценены с более чем 80 различных изолятов боррелий и нашел чтобы определить только те, которые связаны с болезнью Лайма24. Нижний предел обнаружения nPCR документально подтверждено в между шестью24 и десять31 бактерий из чистой культуры, хотя чувствительность можно усовершенствовать, Южный blotting amplicon и гибридизировать радиоизотопами или Хемилюминесцентный зонд. Муфта методы снижает порог обнаружения одного спирохетами31. Путем прямого сравнения обычные, unprobed один тур PCR было установлено сообщать о наличии минимум 104 спирохеты31. Следует отметить, однако, что чувствительность анализа будет меньше при работе с сложных экологических и клинических образцов, из-за подавляющее присутствие несвязанных ДНК и потенциально ингибирующих веществ. Эти проблемы во многом можно обойти с помощью nPCR.

Несмотря на успехи в молекулярных технологий в течение последних десятилетий nPCR остается основной техникой в современные наблюдения усилия. Если уход берется в разработке и осуществлении настоящего Протокола, это мощный, гибкой и относительно простой подход к захватить присутствия патогенов в тик векторов.

Protocol

1. ДНК изоляции от клещей

  1. Приобрести клещей через коллекцию полей, или пассивного наблюдения от ветеринаров и представителей общественности. Клещей следует убит путем замораживания, помещены в запечатанном мешке и по почте при комнатной температуре.
    1. Использование представления формы, соберите информацию о даты и географического местоположения встреча, статус вложений клеща, принимающей видов и недавней истории путешествия хоста.
    2. Поскольку вложенные ПЦР обуславливал загрязнения, убедитесь, что Лаборатория рабочей для минимизации Креста образцов. Это предполагает выполнение различных элементов протокола в отдельный, посвященный пространства, хорошо изолированы друг от друга, которые тщательно чистить и стерилизовать, и обеспечение того, чтобы все приборы свободны от загрязнений.
    3. По получении образца, сфотографировать клеща и определить виды, стадии развития, секс и нагрубание статус сравнения для идентификации ключа32 .
    4. В асептических условиях пополам клеща, используя стерильные лезвия бритвы или скальпелем и поместите фрагменты двух тактов в отдельные microcentrifuge трубы.
  2. Для извлечения полного ДНК, используйте любой процедуры изоляции, которая дает ПЦР совместимый шаблон; Этот протокол демонстрирует простой подход, основанный на комплексообразования.
    1. Начинается с добавления соответствующего тома (часто между 50-200 мкл) литические комплексообразования реагентов на клеща фрагмент. Конкретная сумма будет зависеть от размера и нагрубание состояния образца; руководящие принципы должны предоставляться изготовителем. Однородный, используя Микропробирка пестиком.
    2. Проинкубируйте образцы в водяной бане при 60 ° C для 45 мин и вихрь кратко.
    3. Центрифугуйте образцы на 4 мин на 16,276 x g (13 300 об/мин) в обои microcentrifuge.
    4. Передавать супернатант свежий, обозначенные Микропробирка, содержащие 50 мкл изопропиловый спирт, смесь инверсии, и повторно центрифуга как (1.2.3).
    5. Декант супернатанта и смыть ДНК лепешка с 50 мкл на 70% спирте.
    6. Удалите избыток этанола с пипеткой, а позволяют Пелле высохнуть в течение 15 минут при комнатной температуре.
    7. Ресуспензируйте ДНК, добавьте 50 мкл 1 мм трис рН 7,0 и Проинкубируйте образцы на водяной бане в течение 1 ч при температуре 60 ° C. ДНК теперь могут храниться при температуре-20 ° C для будущего молекулярного анализа.

2. вложенные ПЦР обнаружение Borrelia OspA и вялые мускулы.

Примечание: Обзор общих принципов ПЦР и практики обеспечивается Лоренц, 201233.

  1. Синтезировать или получить Borrelia ген специфического внешняя и внутренняя олигонуклеотида грунтовки. Приведена Таблица 1 грунтовка наборов, их соответствующих ампликон размеров и температуры плавления.
Грунтовка имя Джин целевой Последовательность (5' - 3') Ампликон размер Отжига температура
Вялые мускулы, Fw Вялые мускулы gcatcactttcagggtctca 503 bp 55° C
Вялые мускулы, Rv Вялые мускулы tggggaacttgattagcctg
Вялые мускулы в Fw Вялые мускулы ctttaagagttcatgttggag 447 bp 58° C
Вялые мускулы в Rv Вялые мускулы tcattgccattgcagattgt
OspA из Fw OspA cttgaagttttcaaagaagat 487 bp 55° C
OspA из Rv OspA caactgctgacccctctaat
OspA в Fw OspA acaagagcagacggaaccag 350 bp 58° C
OspA в Rv OspA ttggtgccatttgagtcgta

Таблица 1: Внутренняя и внешняя Праймеры для nPCR боррелий burgdorferiFlaB и OspA.
На практике, праймеры FlaB обнаружить, B. burgdorferi с.с. и других тесно связаны Borrelia геновидов, в то время как OspA грунтовки захватить только B. burgdorferi с.с. усиление от обоих локусов будет означать б. burgdorferi. с.с.

  1. Предварительно стерилизуют ПЦР кабинет с УФ света и 70% этанола.
    Примечание: Для сведения к минимуму потенциального загрязнения образцов, эта область должны отличаться от местоположения клеща рассечение, экстракции ДНК и электрофорез геля.
    1. Для выполнения первоначального PCR используйте внешний грунтовки в сочетании с шаблон ДНК восстановлены выше в шаге 1.0 и настроить реакционной смеси, как описано в таблице 2. Параллельно выполняют позитивного управления выполняется состоящий из проверенных Borrelia ДНК и отрицательный контроль включая реакции нет шаблон для обнаружения загрязнения реагентов и аэрозолей. В конце для сведения к минимуму потенциального загрязнения реагентов добавьте ДНК. Убедитесь, что каждая трубка закрыта на все времена когда реагенты не добавляются и закрыть трубы, сразу же после добавления ДНК, и прежде чем другие трубы открыты.
    2. Программа тепловая велосипедист следующим: 95 ° C за 5 мин; 40 циклов 95 ° c 15 s, отжига температура за 30 сек, 72 ° C для 45 s; 72 ° C за 5 мин; и удерживайте при 4 ° C.
  2. Выполните второй раунд PCR аналогична первой реакции, за исключением использования внутренней грунты с 2 мкл первого продукта PCR (производится в 2.2.2).
    Примечание: Реакции томов снова представлена в таблице 2. Необходимо позаботиться о том, чтобы избежать перекрестного загрязнения ампликонами, обеспечив Последний добавлен шаблон ДНК и что только трубы, соответствует один образец открыты одновременно.
     
    Компонент ПЦР # 1 тома ПЦР # 2 томов
    Taq-полимеразы Мастер микс 2 X 12.5 МКЛ 12.5 МКЛ
    Нуклеаза свободной воды 8.5 МКЛ 8.5 МКЛ
    10 мкм вперед и реверс праймеры Внешняя грунтовка 1.0 мкл Внутренний грунтовки 1.0 мкл
    Шаблон ДНК 2,0 мкл, от образца добычи (1.2.7) 2,0 мкл, от 1 раунд ПЦР (2.2.2)
    Таблица 2: ПЦР реакция смеси для первого и второго уточнениями.
     
    1. Программа тепловая велосипедист, как и раньше, но регулировки температуры отжига для размещения внутренней грунтовки (см. таблицу 1).

3. электрофорез геля агарозы и изображений

Примечание: Основные инструкции по разделение ДНК методом электрофореза, см ли и др., 201234.

  1. Подготовить 1,2% агарозном геле с использованием 20 X SB буфера (0,2 М NaOH, борная кислота 0,8 М рН 8), разбавляют до 1 X и добавить примерно 5 мкл ДНК пятно, перед заливкой, если предварительно Пятнать геля.
  2. Загрузка 10 мкл продукта от второго (внутренний) реакции PCR от каждой экспериментальной и образец элемента управления, наряду с 100 bp лестница (5 мкл).
    1. Electrophorese за 1 ч 107 V (5V/см).
  3. Просмотр и документировать гель с помощью transilluminator и связанные камеры и программного обеспечения.

Representative Results

nPCR представляет собой элегантный подход для увеличения специфичность и чувствительность обнаружения возбудителя, особенно когда сложные экологические пробы находятся под следствием. Как показано на рисунке 1, два раунда ПЦР ориентации стратегического региона Borrelia FlaB локус (и OspA, не показан) могут сообщать о наличии Borrelia burgdorferi бактерий через поколение короткий внутренний ампликонами. При разрешении электрофорезом геля, вялые мускулы и OspA продукты реакции от каждого тика может визуально забил и сравнивается элементов управления. На рисунке 2уникальный образец идентификаторы предоставляются в верхней части каждого геля, и аэрозолей и без шаблон элементов управления представлены в дальнем левом и правом, соответственно, рядом с лестницы.

Надежные ампликон полосы хорошо видны в некоторых экспериментальных образцов, и они легко отличить от излишков грунтовки и остаточной ДНК (рис. 2). Основываясь на экспериментальных дизайн принципы, изложенные, галочку считается позитивным для Borrelia при параллельной негативный контроль продемонстрировать не амплификация, и внутренний ампликонов изготавливаются из вялые мускулы и OspA грунтовки. В этом случае образцы, T907, T604 и T606 критериям наблюдения для Лайма возбудителя (рис. 2). Неуниверсальный, T923 был только положительным для OspA, результат, для которого существует несколько возможных объяснений: A) клеща происхождения был отрицательным для Borrelia, но внешней или внутренней подготовки OspA PCR был ложный загрязненных шаблон ДНК (Обратите внимание, что системных загрязнения реагентов исключено через негативный контроль), B) осуществляется tick Лайма Borrelia, но низкой шаблон суммы или экспериментальной ошибки предотвратить усиление вялые мускулы, или C) организм присутствовал что содержится сохранены OspA последовательности, но не хватало Флагеллин или были недостаточно самобытности в регионе целевых FlaB для отжига для грунтовки. Действительно OspA последовательность сходства были отмечены в различных организмов, в том числе28растений и животных. Противоположной ситуации, амплификации больше сохраняется Флагеллин гена, но не OspA гена, может указывать на смежных видов Borrelia . На практике этот протокол дает больше OspA сингл положительные результаты, чем FlaB грунтовки, предполагая, что сценарий «A» является наименее вероятным объяснением. Без дальнейшего экспериментальный анализ спорных образца однако, это не возможно определить источник сингл положительный результат. Увеличение числа технических реплицирует на двусмысленные образцы может помочь согласовать их истинный статус, поскольку любых загрязнений, которые ложный были введены предыдущим реакции не будет присутствовать в архивные ДНК. Однако если последующие реакции с этими праймеры не предоставлять убедительных результатов, другие Borrelia локусов могут расследоваться ПЦР. Ампликонами, созданный из этих реакций можно также виртуализировать и сравнении среди изолятов помочь назначить удостоверение и оценить степень деформации расхождения. SAPI и коллеги являют собой пример рабочего процесса с использованием клинических образцах35.

Рассмотрены все факторы, изложенные протокол и интерпретации критериев были оценены давать ложные положительные, так и отрицательными показателями 0,17% и 0.0063%, соответственно.

Figure 2
Рисунок 2 : Обнаружение Borrelia burgdorferi в отдельных тиков по nPCR по FlaB и OspA. Коды на каждом тике представлены в верхней части гели, и тождества выравнивание по вертикали для сообщать об обнаружении OspA и вялые мускулы в каждом образце. Полосы под названием B в левой части изображения представляют без шаблона элементов управления, в то время как (правая рука полос) являются элементами управления аэрозоля для захвата загрязнение окружающей среды лаборатории. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Discussion

На протяжении десятилетий использования методы на основе ПЦР последовательно доказали их значение в деле обнаружения Borrelia от членистоногих и млекопитающих образцов, ли Borrelia приходят из окружающей среды или клинических происхождение. ПЦР предлагает множество улучшений существующих подходов к наблюдения. Особенно это не зависит от развития и производительности антитела реагентов и вместо этого может быть легко адаптирована для выявления новых целей интерес просто изменяя последовательностей праймера. PCR также вмещает оценки нескольких локусов параллельно, либо самостоятельно, либо через мультиплекс реакции. Он может применяться для различных образцов материалов, включая свежие и архивных клещей22, животного или человека жидкостями и резекции тканей25. PCR также дает ампликонами, который может быть дополнительно обработаны, например, пищеварение энзима ограничения, гибридизация зонда или последовательности, чтобы обеспечить увеличение понимание микробного идентификации21.

Как клинический инструмент ПЦР концептуально предпочтительнее стандартного серологической диагностики, как она обеспечивает прямое указание бактериальное присутствие, а не полагаться на иммунного ответа как мера вторичной инфекции. Однако, боррелиоз Лайма связано с относительно скромными микробной нагрузки (< 50 организмов/мл мочи или плазмы) и переходных spirochetemia, который может породить ложноотрицательные результаты25. Чувствительность этого метода в клинике значительно варьируется в зависимости от типа ткани, стадии инфекции, и состояния образцов, падение между 12,5% и 62% в существующих исследованиях крови, спинномозговой жидкости и биопсию тканей36. Молекулярные чувствительность ограничения не интересуют если ПЦР проводится после бактериальной культуры, однако восстановление жизнеспособных спирохеты из клинических образцов оказался аналогичным сложным. Только недавно протоколы были оптимизированы для более высокой доходности35. Тем временем кишки инфицированного взрослого клеща может гавани в среднем везде от 2000 до более чем 50000 Borrelia37,38,39, который прочно находится в пределах диапазона обнаружения nPCR. Таким образом протокол хорошо подходит для деления эпиднадзора.

Несмотря на свои многочисленные преимущества nPCR создают определенные проблемы и этот метод способность точно сообщить что клеща инфекции, таким образом, зависит от стратегического выбора генов и ампликонами, дотошный экспериментальных рабочих процессов, которые восстановить качество ДНК от образцов при сведении к минимуму кросс экспозиции образцов и использование соответствующих механизмов контроля, которые могут сообщать загрязнителей в лабораторной среде и реагенты. До каких-либо экспериментов должны четко определены масштабы и намерения расследования таким образом, чтобы соответствующие генетических локусов и регионов, могут быть выбраны. Если цель заключается в обеспечении беспристрастной экран вызывая Лайма Borrelia burgdorferi с.л. комплекс, грунтовки должны быть созданы для обнаружения всех штаммов связанные с подобного сродства и усиления эффективности, без захвата не связаны 25организмов. Могут быть разработаны новые грунты и начисленных в silico с помощью программных средств, таких как праймер-взрыв40, хотя они должны также проверяться экспериментально стандартных изолирует перед применением uncharacterized образцов. Процедура извлечения ДНК стремится восстановить нетронутыми микробной шаблон из смешанных экологической образца (тик огневки). Необязательный шаг перед переходом с ПЦР является для оценки целостности ДНК. Кроме того параллельные реакции можно было настроить для уборки гена в тик. Последний метод может также указывать на наличие ингибиторов в реакционной смеси, обеспечивая увеличение уверенность, что негативные реакции Borrelia являются из-за отсутствия организма, а не наличие ингибирующее загрязнителем.

Повышенная чувствительность вложенных ПЦР подхода происходит за счет возможного загрязнения, который генерирует ложно положительных результатов. Экзогенные шаблон может быть введен образец во время восстановления ДНК и dissection клеща, или в процессе создания внешнее и внутреннее усиление реакции. Поэтому особенно важно следовать лучшие практики протоколы для ПЦР избежать шаблон или ампликон перекрестное загрязнение. К ним относятся использование отдельных рабочих станций с независимой циркуляции воздуха, сдерживания в PCR и шкафы биологической безопасности там, где это уместно, тщательного химического и физического очистки и стерилизации поверхностей и реагентов и осторожного обращения ДНК 41. No шаблон элементов управления также имеют жизненно важное значение в определении загрязнения запасов реагентов. Особая уязвимость nPCR является ампликонами, обработки, что происходит при передаче продуктов первой реакции в второй ПЦР судна. Поскольку целевой ДНК уже прошел экспоненциального обогащения в положительных образцов, этот шаг особенно подвержен перекрестного загрязнения и однотрубных nPCR протокол был разработан чтобы обойти это ограничение. В этом подходе оба набора праймеров для данного гена добавляются вместе реакции трубка, которая остается закрытой для обоих раундов ПЦР31. Внешняя и внутренняя грунтовка пары должны различаться термодинамически, таким образом, что наружная пара усиливает шаблон при высокой температуре отжига, непосильными для внутренней грунтовки. Во втором туре отжига температура опускается до размещения внутренней пары. Не только делает это обойти потенциально накладывающееся шаг, он также позволяет использовать дополнительные меры борьбы с загрязнением31,42. Однако эта модификация может пожертвовать некоторые анализа чувствительности. Независимо от подхода увеличивая количество технических реплицирует выполняются независимо друг от друга на образце поможет определить ложные загрязнения.

Молекулярные методы продолжали развиваться после введения nPCR, и эти новые подходы предлагают выбрать преимущества над оригинальный дизайн, хотя и на увеличение финансовых расходов. Как подсказывает название, количественного PCR (ПЦР или реального времени (RT)-PCR) позволяет для перечисления патогенов в образце, в то время как обычные методы качественной в природе-43. Чувствительность ПЦР якобы похож на nPCR38, хотя она может колебаться в зависимости от характеристики грунтовки28. Разновидность ПЦР, который использует молекулярные маяки (МБ) вместо обычных TaqMan зонды также показал обещание в обнаружении Borrelia в клинических образцах44,45,46. Благодаря их уникальной вторичной структуры молекулярные маяки сообщениям производят Нижняя фон флуоресценции и выше законных сигналов, обеспечивая тем самым превосходная чувствительность47. Доклинические оценки показывают, потенциал обнаружения порога между одной и десять спирохеты44,45. Кроме того метод успешно применяется в мультиплекс реакции одновременно обнаруживать млекопитающих принимающей гена44 и других возбудителей клещевого45, который не так легко достижимы с nPCR. Другие изменения дизайна включают капелька цифровой ПЦР (ddPCR) технологии, которая может определить ДНК без использования стандартной кривой39,48. Нижний предел обнаружения этой техники для Borrelia является также около десяти спирохеты/образца39. По сравнению с nPCR, эти подходы также имеют преимущество снижение потенциал для загрязнения, как они требуют только один амплификации протокол.

Если цель наблюдения вместо профилирование разнообразный бактериальных содержимое галочку, 16S рРНК метагеномных скрининга является привлекательным вариантом49. Хотя этот подход более дорогостоящим, требует специализированных секвенаторы ДНК не найден во всех лабораториях молекулярной биологии и требует более сложных толкование на основе биоинформатики, он может захватить широкий спектр микробов более точно представляют собой возбудителя нагрузки вектора.

Хотя ПЦР и его производные являются методы выбора для количественных приложений и метагеномики экраны обеспечивают широкий кадастров клеща микрофлора, целенаправленные наблюдения усилия часто связаны с двоичного представления наличия или отсутствия один или несколько патогенов в объекте vector. При таких обстоятельствах эти новые, более сложные подходы могут ввести ненужные сложности и финансовое бремя в этот процесс. По этим причинам nPCR выдержала испытание временем, как ключевой метод в тестирования тики.

Disclosures

Авторы не имеют ничего сообщать.

Acknowledgments

Авторы хочу поблагодарить Харрис Kami для конструкции праймера, Эшли McKibbon и Джессика Томас-Ebbett для съемок и Джон Блейкли, Alexandra Фоли-Эби, Крис Лэнгли, Джули Льюис, Kelsey Макинтайр, Эшли McKibbon, Крис Zinck и Рози собака для появления в видео. А. м. к. был поддержан Канадского фонда исследований болезни Лайма, и финансирование проектов осуществлялось естественных наук и инженерных исследований Совет Канады (СЕНТИ). M. W. K. б. получил зарплату финансирование из Нью-Брансуик инновационный фонд (NBIF).

Materials

Name Company Catalog Number Comments
LabGard Class II, Type A2 biological safety cabinet Nuaire ES AIR NU-543 
Razor blades VWR 55411-050 0.22 mm thickness
Microfuge Tubes (Microtubes 1.5 mL) Axygen 311-08-051
AquaGenomic  MultiTarget Pharmaceuticals 2030 DNA extraction reagent
Microtube Pestle Diamed DIATEC610-1551 Designed for 1.5 ml tubes
Water bath - Isotemp 202 Fishse Scientific 15-462-2
Vortex Labnet S0100 CAN
Spectrafuge 24D Digital Microcentrifuge Labnet C2400
Isopropanol Sigma-Aldrich 190764
BIS-TRIS Sigma-Aldrich B9754
Primer Synthesis Sigma-Aldrich OLIGO
PCR Cabinet Misonix PCR6-482
PCR tube with attached flat caps 0.2mL VWR 20170-012
GoTaq Green Master Mix 2x Promega M7123
Nuclease-free water Promega M7123 The water comes with the GTG
Spectrafuge Mini Labnet C1301
SYBR Safe DNA Stain 10,000X Concentration EDVOTEK 608
Froggarose LE (Molecular Biology Grade Agarose) FroggaBio A87-500G
GD 100 bp DNA Ladder FroggaBio DM001-R500 
Electrophoresis power pack  VWR VWR 105 EC Apparatus Corporation
Fluor-S MultiImager  BioRad 170-7700 (Serial number 433B0154)
Quantity One 1-D Analysis Software (V. 4.5.2) BioRad 1709600

DOWNLOAD MATERIALS LIST

References

  1. Schotthoefer, A. M., Frost, H. M. Ecology and epidemiology of Lyme borreliosis. Clin. Lab. Med. 35, (4), 723-743 (2015).
  2. Franke, J., Hildebrandt, A., Dorn, W. Exploring gaps in our knowledge on Lyme borreliosis spirochaetes - Updates on complex heterogeneity, ecology, and pathogenicity. Ticks Tick Borne Dis. 4, (1-2), 11-25 (2013).
  3. Rudenko, N., Golovchenko, M., Vancova, M., Clark, K., Grubhoffer, L., Oliver, J. H. Jr Isolation of live Borrelia burgdorferi sensu lato spirochaetes from patients with undefined disorders and symptoms not typical for Lyme borreliosis. Clin. Microbiol. Infect. 22, (3), 267.e9-267.e15 (2016).
  4. Scott, J. D., Clark, K. L., Anderson, J. F., Foley, J. E., Young, M. R., Durden, L. A. Lyme Disease Bacterium, Borrelia burgdorferi Sensu Lato, Detected in Multiple Tick Species at Species at Kenora, Ontario, Canada. J Bacteriol Parasitol. 08, (01), 1-10 (2017).
  5. Sperling, J., Middelveen, M., Klein, D., Sperling, F. Evolving perspectives on lyme borreliosis in Canada. Open Neurol J. 6, 94-103 (2012).
  6. Pachner, A. R. Early disseminated Lyme disease: Lyme meningitis. Am. J. Med. 98, (Supplement 1), 30S-43S (1995).
  7. Mikkilä, H. O., Seppälä, I. J., Viljanen, M. K., Peltomaa, M. P., Karma, A. The expanding clinical spectrum of ocular lyme borreliosis. Ophthalmology. 107, (3), 581-587 (2000).
  8. Mc Causland, F. R., Niedermaier, S., Bijol, V., Rennke, H. G., Choi, M. E., Forman, J. P. Lyme disease-associated glomerulonephritis. Nephrol. Dial. Transplant. 26, (9), 3054-3056 (2011).
  9. Tunev, S. S., Hastey, C. J., Hodzic, E., Feng, S., Barthold, S. W., Baumgarth, N. Lymphoadenopathy during Lyme Borreliosis Is Caused by Spirochete Migration-Induced Specific B Cell Activation. PLoS Pathog. 7, (5), e1002066-e1002014 (2011).
  10. Kostić, T., et al. Manifestations of Lyme carditis. Int. J. Cardiol. 232, 24-32 (2017).
  11. Hinckley, A. F., et al. Lyme Disease Testing by Large Commercial Laboratories in the United States. Clin. Infect. Dis. 59, (5), 676-681 (2014).
  12. Nelson, C. A., et al. Incidence of Clinician-Diagnosed Lyme Disease, United States 2005-2010. Emerg. Infect. Dis. 21, (9), 1625-1631 (2015).
  13. Aucott, J. N., Rebman, A. W., Crowder, L. A., Kortte, K. B. Post-treatment Lyme disease syndrome symptomatology and the impact on life functioning: is there something here? Qual Life Res. 22, (1), 75-84 (2012).
  14. Aucott, J. N., Crowder, L. A., Kortte, K. B. Development of a foundation for a case definition of post-treatment Lyme disease syndrome. Int. J. Infect. Dis. 17, (6), e443-e449 (2013).
  15. Adrion, E. R., Aucott, J., Lemke, K. W., Weiner, J. P. Health care costs, utilization and patterns of care following Lyme disease. PLoS ONE. (2015).
  16. Cameron, D. J. Consequences of treatment delay in Lyme disease. Journal of Evaluation in Clinical Practice. 13, (3), 470-472 (2007).
  17. Johnson, L., Aylward, A., Stricker, R. B. Healthcare access and burden of care for patients with Lyme disease: a large United States survey. Health policy. 102, (1), 64-71 (2011).
  18. Motaleb, M. A., et al. Borrelia burgdorferi periplasmic flagella have both skeletal and motility functions. Proc. Natl. Acad. Sci. U.S.A. 97, (20), 10899-10904 (2000).
  19. Rosa, P. A., Tilly, K., Stewart, P. E. The burgeoning molecular genetics of the Lyme disease spirochaete. Nat. Rev. Microbiol. 3, (2), 129-143 (2005).
  20. Kenedy, M. R., Lenhart, T. R., Akins, D. R. The role of Borrelia burgdorferi outer surface proteins. FEMS Immunol. Med. Microbiol. 66, (1), 1-19 (2012).
  21. Persing, D. H., Telford, S. R., Spielman, A., Barthold, S. W. Detection of Borrelia burgdorferi infection in Ixodes dammini ticks with the polymerase chain reaction. J. Clin. Microbiol. 28, (3), 566-572 (1990).
  22. Persing, D. H., et al. Detection of Borrelia burgdorferi DNA in museum specimens of Ixodes dammini ticks. Science. 249, (4975), 1420-1423 (1990).
  23. Wise, D. J., Weaver, T. L. Detection of the Lyme disease bacterium, Borrelia burgdorferi, by using the polymerase chain reaction and a nonradioisotopic gene probe. J. Clin. Microbiol. 29, (7), 1523-1526 (1991).
  24. Johnson, B. J., Happ, C. M., Mayer, L. W., Piesman, J. Detection of Borrelia burgdorferi in ticks by species-specific amplification of the flagellin gene. Am. J. Trop. Med. Hyg. 47, (6), 730-741 (1992).
  25. Schmidt, B. L. PCR in laboratory diagnosis of human Borrelia burgdorferi infections. Clin. Microbiol. Rev. 10, (1), 185-201 (1997).
  26. Ogden, N. H., et al. Ixodes scapularis ticks collected by passive surveillance in Canada: analysis of geographic distribution and infection with Lyme borreliosis agent Borrelia burgdorferi. J. Med. Entomol. 43, (3), 600-609 (2006).
  27. Doern, G. V. Detection of selected fastidious bacteria. Clin. Infect. Dis. 30, (1), 166-173 (2000).
  28. Nolte, O. Nucleic Acid Amplification Based Diagnostic of Lyme (Neuro-)borreliosis - Lost in the Jungle of Methods, Targets, and Assays? Open Neurol J. 6, (1), 129-139 (2012).
  29. Wallich, R., Moter, S. E., Simon, M. M., Ebnet, K., Heiberger, A., Kramer, M. D. The Borrelia burgdorferi flagellum-associated 41-kilodalton antigen (flagellin): molecular cloning, expression, and amplification of the gene. Infect. Immun. 58, (6), 1711-1719 (1990).
  30. Picken, R. N. Polymerase chain reaction primers and probes derived from flagellin gene sequences for specific detection of the agents of Lyme disease and North American relapsing fever. J. Clin. Microbiol. 30, (1), 99-114 (1992).
  31. Picken, M. M., Picken, R. N., Han, D., Cheng, Y., Strle, F. Single-tube nested polymerase chain reaction assay based on flagellin gene sequences for detection ofBorrelia burgdorferi sensu lato. Eur. J. Clin. Microbiol. Infect. Dis. 15, (6), 489-498 (1996).
  32. Keirans, J. E., Litwak, T. R. Pictorial key to the adults of hard ticks, family Ixodidae (Ixodida: Ixodoidea), east of the Mississippi River. J. Med. Entomol. 26, (5), 435-448 (1989).
  33. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J Vis Exp. (63), e3998 (2012).
  34. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose Gel Electrophoresis for the Separation of DNA Fragments. J Vis Exp. (62), e3923 (2012).
  35. Sapi, E., Pabbati, N., Datar, A., Davies, E. M., Rattelle, A., Kuo, B. A. Improved culture conditions for the growth and detection of Borrelia from human serum. Int J Med Sci. 10, (4), 362-376 (2013).
  36. Waddell, L. A., Greig, J., Mascarenhas, M., Harding, S., Lindsay, R., Ogden, N. The Accuracy of Diagnostic Tests for Lyme Disease in Humans, A Systematic Review and Meta-Analysis of North American Research. PLoS ONE. 11, (12), e0168613-e0168623 (2016).
  37. Brunet, L. R., Spielman, A., Telford, S. R. III Density of Lyme disease spirochetes within deer ticks collected from zoonotic sites. Am. J. Trop. Med. Hyg. 53, (3), 300-302 (1995).
  38. Wang, G., et al. Real-time PCR for simultaneous detection and quantification of Borrelia burgdorferi in field-collected Ixodes scapularis ticks from the Northeastern United States. Appl. Environ. Microbiol. 69, (8), 4561-4565 (2003).
  39. King, J. L., Smith, A. D., Mitchell, E. A., Allen, M. S. Validation of droplet digital PCR for the detection and absolute quantification of Borrelia DNA in Ixodes scapularis ticks. Parasitology. 144, (4), 359-367 (2017).
  40. Ye, J., Coulouris, G., Zaretskaya, I., Cutcutache, I., Rozen, S., Madden, T. L. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 13, (1), 134 (2012).
  41. Kwok, S., Higuchi, R. Avoiding false positives with PCR. Nature. 339, (6221), 237-238 (1989).
  42. Rys, P. N., Persing, D. H. Preventing false positives: quantitative evaluation of three protocols for inactivation of polymerase chain reaction amplification products. J. Clin. Microbiol. 31, (9), 2356-2360 (1993).
  43. Pahl, A., Kühlbrandt, U., Brune, K., Röllinghoff, M., Gessner, A. Quantitative detection of Borrelia burgdorferi by real-time PCR. J. Clin. Microbiol. 37, (6), 1958-1963 (1999).
  44. Saidac, D. S., Marras, S. A. E., Parveen, N. Detection and quantification of Lyme spirochetes using sensitive and specific molecular beacon probes. BMC Microbiol. 9, (1), 43 (2009).
  45. Chan, K., Marras, S. A. E., Parveen, N. Sensitive multiplex PCR assay to differentiate Lyme spirochetes and emerging pathogens Anaplasma phagocytophilum and Babesia microti. BMC Microbiol. 13, (1), 295 (2013).
  46. Schlachter, S., Chan, K., Marras, S. A. E., Parveen, N. Detection and Differentiation of Lyme Spirochetes and Other Tick-Borne Pathogens from Blood Using Real-Time PCR with Molecular Beacons. Methods Mol. Biol. 1616, 155-170 (2017).
  47. Wang, L., Blasic, J. R. Jr, Holden, M. J., Pires, R. Sensitivity comparison of real-time PCR probe designs on a model DNA plasmid. Anal. Biochem. 344, (2), 257-265 (2005).
  48. Sze, M. A., Abbasi, M., Hogg, J. C., Sin, D. D. A Comparison between Droplet Digital and Quantitative PCR in the Analysis of Bacterial 16S Load in Lung Tissue Samples from Control and COPD GOLD 2. PLos ONE. 9, (10), e110351-e110356 (2014).
  49. Sperling, J. L., et al. Comparison of bacterial 16S rRNA variable regions for microbiome surveys of ticks. Ticks Tick Borne Dis. 1-9 (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics