Author Produced

İç içe geçmiş PCR kullanarak keneler Lyme hastalığı Sfilis, Borrelia Burgdorferi, algılama

Biology
JoVE Journal
Biology
AccessviaTrial
 

Summary

İç içe geçmiş PCR DNA Borrelia burgdorferiiçin hastalığının Lyme hastalığı araştırma ayıklar kene için uygulanan hassas, belirli ve basit bir tekniktir. İlk PCR deney gene özgü astar iç primerler kullanılarak bir sonraki tepki için şablonlar haline uzun amplicons oluşturmak için kullanılır.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Wills, M. K. B., Kirby, A. M., Lloyd, V. K. Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR. J. Vis. Exp. (132), e56471, doi:10.3791/56471 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Lyme hastalığı Borrelia burgdorferi sensu lato ailesinin insana enfekte Ixodes kene ısırması ile bulaşan spirochetes neden olduğu ciddi bir vektör kaynaklı enfeksiyondur. Kuzey Amerika'da birincil etyolojik Ajan Borrelia burgdorferi sensu stricto değil. Gibi coğrafi risk bölgeleri genişler, kene enfeksiyon oranları ölçmek ve bulgular klinisyenler, veterinerler ve halkın geneli için iletişim sağlam gözetim programları desteklemek ihtiyatlı olduğunu. İç içe geçmiş Polimeraz zincir reaksiyonu (nPCR) moleküler tekniğin uzun bu amaç için kullanılan ve algılama Borrelia keneler ve yabani hayvanlar ve bitkiler Merkezi, ucuz ve sağlam bir yaklaşımda kalır.

Bu makalede virüslü numuneler tanımlamak için DNA özleri kene için nPCR uygulanması gösterilmektedir. İki bağımsız B. burgdorferi hedefler, genlerin kodlama Flagellin B (FlaB) ve dış yüzey protein A (OspA), kullanılan kapsamlı bu tekniği ile. Kene koleksiyonu, DNA ekstraksiyon ve sonra her iki Borreliaalgılamak için PCR ilk turunda protokol içerir-belirli loci. Sonraki Polimeraz zincir tepkimesi (PCR) ilk tepki ürün daha küçük, iç amplifikasyon parçaları oluşturmak için yeni bir şablon olarak kullanılır. İç içe geçmiş yaklaşım özgüllük ve geleneksel PCR hassasiyeti geliştirir. Her iki Borrelia genler üzerinden iç amplicons özel Jel Elektroforez tarafından tespit edilebilir bir kene için patojen pozitif kabul edilir.

Introduction

Lyme hastalığı (LD) kuzey yarımkürede en yaygın vektör kaynaklı enfeksiyon, ve onun insidansı1artmaya devam ediyor. Bu zayıflatıcı hastalığı tarihsel baskın Kuzey Amerika patojen, B. kapsamaktadır (genellikle Borrelia burgdorferi sensu lato veya s.l. olarak adlandırılır), Lyme borreliosis (LB) karmaşık spirocheteal patojenlerin neden olduğu burgdorferi sensu stricto (s.s), B. afzelii ve B. garinii, Avrupa ve Asya yaygın ve klinik önemi2,3gelişen türlerin vardır ek olarak. Bu bakterilerin insanlara virüslü Ixodes keneler2. ısırık aracılığıyla aktarılır Ana Kuzey Amerika vektörel çizimler ı. scapularis ve ı. pacificusolmakla birlikte, bu cins içinde birden çok tür liman ve bakteri4iletmek için bulundu. İnsanlarda, B. burgdorferi cilt, eklemler, kalp, sinir sistemi, endokrin bezleri, gastrointestinal sistem ve iç organlar5,6,7etkileyen çoklu sistem semptomlara yol açabilir, 8,9,10. Hastalık kontrol ve Önleme Merkezi şu anda 300.000'den fazla yeni insan durumlarda her yıl Amerika Birleşik Devletleri11,12tahmin ediyor. Hastalık tanısı ve erken aşamalarında tedavi prognoz genellikle olumlu olsa da, çalışmalar bu yerde arasında % 10 ve tedavi sonrası farklı belirtilerle devam önerilen antibiyotik rejimi alınan hastaların % 60'ı tavsiye ettiler bırakma, bir fenomen olarak sonrası tedavi Lyme hastalığı Sendromu (PTLDS)13,14,15olarak adlandırdığı. Ayrıca, klinik müdahale gecikmeler kene ısırması bilincini, non-spesifik sunuyu ilk hastalık ve enfeksiyon başlangıcında kullanılan geleneksel seroloji tabanlı tanılama düşük duyarlılık eksikliği sonucu olarak ortaya çıkabilir. Hızlı ve uygun bir şekilde tedavi etmek için başarısızlık giderek komplikasyonlar16,17zayıflatıcı, meydana gelen belirti ilerleme sağlar. Lyme hastalığı önleme bu nedenle risk yönetimi taşıdır. Büyüyen bu tehdidi ile savaşmak için stratejiler patojen yaygınlık dilimleri belirtmek için sağlam gözetim önlemler ve endişe coğrafi bölgeleri tanımlar.

Bu makalede iç içe Polimeraz zincir reaksiyonu (nPCR) yardımcı programı enfekte keneler tanımlamak kullanılacak bir moleküler tarama aracı olarak gösterilmektedir. Özgüllüğü artırmak için iki Borrelia gen paralel amplifikasyon için kullanılır. Flagellin B (FlaB) kamçı18büyük filaman protein kodlar ve lipoprotein ürün dış yüzey protein A (OspA) kene midgut aracılık eder iken gen tek doğrusal kromozom üzerinde bulunan kolonizasyon, ve plazmid kodlanmış19,20' dir. İş akışı kene koleksiyonu, DNA ekstraksiyon ve o zaman PCR Borreliaalgılamak için ilk turunda oluşur-belirli loci. Sonraki PCR ürünü ilk tepki olan daha küçük, iç amplifikasyon parçaları oluşturmak için yeni bir şablon olarak kullanır. Her iki Borrelia genler üzerinden iç amplicons özel Jel Elektroforez tarafından tespit edilebilir bir kene Borrelia burgdorferi için pozitif kabul edilir.

Hem nPCR tekniği ve FlaB ve OspA gen hedefleri, yaygın olarak ekolojik gözetim ve Lyme Sfilis klinik algılama erken 1990'larda21,22,23 beri için kullanılmıştır ,24,25. Moleküler protokoller geliştirme önce keneler bağırsak içeriği boyama anti -Borrelia ayirt (Eğer), mikrobiyal kültür veya bunların bir kombinasyonu26subjecting tarafından değerlendirildi. Bu yaklaşımlar yavaş büyüme ve titiz doğa Borrelia27, antikor performans sorunları ve eğer işleme21canlı keneler şartı da dahil olmak üzere içerdiği sınırlamaları muzdarip. PCR daha sonra virüslü vektörler hızlı, hassas ve belirli kimlik sağlamak için kabul edilmiştir. Kültür bağımsız direkt uygulama için başka21,22 test etmek için uygun olacağını ölü ve arşivlenmiş kene gibi çeşitli örnek türleri de dahil olmak üzere geleneksel yöntemler üzerinde işaretli gelişmeler teklif . İç içe geçmiş deneysel tasarımlar daha fazla özgüllük ve klasik PCR hassasiyeti gene özgü astar amplifikasyon25,28iki ardışık tur iki ayrı takım istihdam ederek geliştirmek.

Deneysel başarısı stratejik gen seçimi ve amplicon tasarım üzerinde eleştirel bağlıdır. Borrelia burgdorferivarlığı doğru bir şekilde tahmin etmek için astar ilgili patojenler depreşen spirochetes da Borrelia Sylviidae ile cross-reacting olmadan algılaması gerekir. FlaBsöz konusu olduğunda, bir değişken iç bölge çeşitli bakteri (şekil 1)24,29 tarafından paylaşılır nispeten korunmuş kanat dizileri yerine gen hedefleyerek bu özgüllüğü elde edilir , 30.

Figure 1
Şekil 1: kullanma gösterildiği gibi nPCR, kavramı Borrelia FlaB bir hedef olarak gen. Gen 5' ve 3' termini organizmalar bu bölgelerini Lyme neden olan patojen belirli değerlendirilmesi için uygun olmayan işleme Borrelia burgdorferi s.l. ötesinde yaygındır. Daha az korunmuş iç dizileri astar hedef olarak kullanılarak, PCR iki tur final, iç amplicon algılamak için yürütülür. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Ayrımcı kapasitelerini test, iç FlaB astar 80'den fazla farklı Borrelia yalıtır ile değerlendirildi ve sadece o Lyme hastalığı24ile ilişkili tanımlamak için bulundu. Duyarlılığı daha da Güney amplicon kurutma ve radiolabelled bir hybridizing tarafından geliştirilmiş rağmen nPCR alt algılama sınırı, altı24 ve saf kültür, on31 bakterilerden arasında belgelenmiş oldu veya chemiluminescent sonda. Teknikleri kaplin algılama eşiği tek Sfilis31azaltır. Doğrudan karşılaştırma tarafından geleneksel, unprobed tek yönlü PCR en az 104 spirochetes31varlığı rapor bulundu. Bu, ancak, tahlil duyarlılık ilgisiz DNA ve potansiyel inhibitör maddeler ezici varlığı nedeniyle karmaşık çevre ve klinik örnekleri ile çalışırken düşük olacağı unutulmamalıdır. Bu sorunlar büyük ölçüde nPCR kullanımı ile atlatılabilir.

Son on yıl içinde moleküler teknoloji gelişmeler rağmen nPCR modern gözetim çabalarında bir zımba teknik kalır. Tasarım ve yürütme bu protokol özen, kene vektörel çizimler patojenler varlığı yakalamak için güçlü, uyarlanabilir ve nispeten basit bir yaklaşım tek.

Protocol

1. keneler DNA izolasyonu

  1. Keneler alan koleksiyonu veya pasif güvenlik kayıtlarından veterinerler ve kamu üyeleri aracılığıyla elde etmek. Keneler dondurarak öldüren, mühürlü bir çantaya yerleştirilir ve oda sıcaklığında gönderilecek gerekir.
    1. Gönderme formu kullanarak, karşılaşma, kene eki durumu, ana türler ve son seyahat tarihi konağın coğrafi konumu ve tarihi hakkında bilgi toplayabilir.
    2. İç içe geçmiş PCR için kirlenme doğal olarak savunmasız olduğu için laboratuvar çalışma alanı çapraz-pozlama örneklerin en aza indirmek için ayarlandığından emin olun. Bu protokol farklı unsurları iyice temizlenmeli ve sterilize de birbirinden izole ayrı, özel alanlarda içinde yürütme içerir ve tüm aletleri sağlanması kirleticiler ücretsiz.
    3. Numune alınması, üzerine kene fotoğrafını çekip türler, gelişim aşamasını, seks ve şişkinliği durumunu bir kimlik anahtar32 ' ye kıyasla belirlemek.
    4. Aseptik şartlarda bir steril jilet veya skalpel kullanarak kene bisect ve iki kene parçaları ayrı microcentrifuge tüpler içine yerleştirin.
  2. Toplam DNA ayıklamak için PCR uyumlu şablon verir herhangi bir yalıtım yordamı kullanın; Bu iletişim kuralı basit bir şelasyon tabanlı yaklaşım gösteriyor.
    1. Kene parçası litik şelasyon reaktif (genellikle 50-200 µL arasında) uygun bir ses ekleyerek başlayın. Tutarı örnek boyutu ve şişkinliği durumuna bağlıdır; yönergeleri üretici tarafından sağlanmalıdır. Microtube havaneli kullanarak lunaparkçı.
    2. Bir su banyosunda 45 dk ve girdap için 60 ° C'de örnekleri kısaca kuluçkaya.
    3. Örnekleri için 16,276 x g (13,300 devir/dakika), 4 dk santrifüj kapasitesi bir masaüstü microcentrifuge.
    4. Süpernatant 50 µL isopropanol, mix inversiyon ve yeniden santrifüj kapasitesi olduğu gibi (1.2.3) içeren bir taze, etiketli microtube aktarın.
    5. Süpernatant dikkatle boşaltmak ve DNA Pelet 50 µL % 70 etanol ile durulayın.
    6. Bir pipet ile aşırı etanol kaldırmak ve Pelet oda sıcaklığında 15 dakika kurumasını bekleyin.
    7. DNA resuspend için 1 mM Tris pH 7,0 50 µL ekleyin ve bir su banyosu 60 ° C'de 1 h için örnekleri kuluçkaya DNA şimdi gelecekteki moleküler analiz için-20 ° C'de muhafaza edilebilir.

2. iç içe PCR algılanması Borrelia OspA ve FlaB.

Not: Lorenz, 201233genel PCR ilkeleri ve uygulamaları genel bir bakış sağlanır.

  1. Sentez veya Borrelia gene özgü dış ve iç Oligonükleotid astar alın. Astar setleri, onların anılan sıraya göre amplicon boyut ve erime sıcaklıkları için bkz: Tablo 1 .
Astar adı Gene hedef Sıra (5' - 3') Amplicon boyutu Tavlama sıcaklığı
FlaB Fw dışarı FlaB gcatcactttcagggtctca 503 bp 55° C
FlaB Rv dışarı FlaB tggggaacttgattagcctg
Fw flaB FlaB ctttaagagttcatgttggag 447 bp 58° C
FlaB Rv içinde FlaB tcattgccattgcagattgt
OspA Out Fw OspA cttgaagttttcaaagaagat 487 bp 55° C
OspA Out Rv OspA caactgctgacccctctaat
OspA Fw içinde OspA acaagagcagacggaaccag 350 bp 58° C
Rv içinde OspA OspA ttggtgccatttgagtcgta

Tablo 1: Astar Borrelia burgdorferiFlaB ve OspA nPCR için iç ve dış.
Uygulamada, B. burgdorferi s.s. ve diğer yakından ilgili Borrelia genospecies, sadece B. burgdorferi s.s. OspA astar yakalamak iken FlaB astar algılamak amplifikasyon her iki loci üzerinden B. göstermek burgdorferi. s.s.

  1. UV ışık ve % 70 etanol PCR dolapla önceden sterilize.
    Not: potansiyel örnek kirlenme en aza indirmek için bu çalışma alanı kene diseksiyon, DNA ekstraksiyon, konumdan farklı olmalı ve Elektroforez jel.
    1. İlk PCR koşmak için dış astar DNA yukarıdaki 1,0 iyileşti ve Tablo 2' de açıklandığı gibi tepki karışımı ayarlayın şablonuyla birlikte kullanın. Buna paralel olarak, doğrulanmış Borrelia DNA oluşan denetim çalışır ve no-şablonu reaksiyonlar reaktif ve aerosol kirlenme tespit etmek de dahil olmak üzere negatif kontrol çalışan olumlu gerçekleştirin. DNA reaktifler olası bulaşma en aza indirmek için sona ekleyiniz. Her tüpün hiç otelde reaktifler değil eklenmektedir ve tüpler yakın hemen sonra DNA toplama ve diğer tüpler açılmadan önce kez kapalı olduğunu emin olun.
    2. Aşağıdaki gibi bir termal cycler programı: 95 ° C 5 dakika; 40 devredir 15 95 ° c sıcaklık 30 tavlama s, s, 45 72 ° C s; 72 ° C 5 min için; 4 ° C'de tutun
  2. PCR (2.2.2 içinde üretilen) ilk PCR ürününün 2 µL ile iç astar kullanmak dışında ilk tepki benzer ikinci tur gerçekleştirmek.
    Not: Tepki birimleri yeniden Tablo 2' de verilmektedir. Şablon DNA son eklenen ve tek tüpler bir örneğe karşılık gelen bir zaman açıktır sağlayarak amplicons Çapraz bulaşma kaçınmak için özen göstermelidir.
     
    Bileşen PCR # 1 birimleri PCR # 2 birimleri
    Taq polimeraz Master Mix 2 X 12.5 ΜL 12.5 ΜL
    Nükleaz ücretsiz su 8,5 ΜL 8,5 ΜL
    10 µM ileri ve geri astar 1.0 µL dış astar 1.0 µL iç astar
    DNA şablonu Örnek çıkarma (1.2.7) üzerinden 2.0 µL 2.0 µL PCR (2.2.2) yuvarlak 1
    Tablo 2: PCR reaksiyon karışımları için birinci ve ikinci Arttırımlar.
     
    1. Daha önce olduğu gibi termal cycler programı ama (tablo 1'e bakınız) iç astar karşılamak için tavlama sıcaklığı ayarlayın.

3. özel Jel Elektroforez ve görüntüleme

Not: DNA tarafından Elektroforez ayıran temel yönergeleri için bkz: Lee ve ark., 201234.

  1. 1 X seyreltilmiş 20 X SB tampon (0.2 M NaOH, 0, 8 M Borik asit pH 8) kullanarak bir % 1.2 özel jel hazırlamak ve jöleyi ön boyama isteniyorsa dökülmeden önce yaklaşık 5 µL DNA leke ekleyin.
  2. 10 µL ikinci (iç) PCR reaksiyon gelen her deneysel ürün ve yanı sıra 100 bp merdiven (5 µL) denetimi örneğini yükleyin.
    1. 107, 1 h için electrophorese V (5V/cm).
  3. Görüntülemek ve bir transilluminator ve ilişkili kamera ve yazılım kullanarak jel belge.

Representative Results

nPCR özellikle karmaşık çevre örnekleri soruşturma altında olduğunda özgüllük ve patojen algılama, duyarlılığını artırmak için zarif bir yaklaşımdır. Şekil 1' de gösterildiği gibi iki tur Borrelia FlaB odağı (ve OspAresimde değil,) stratejik bir bölgede hedefleyen PCR kısa iç nesil aracılığıyla Borrelia burgdorferi bakteri varlığı bildirebilirsiniz amplicons. Jel Elektroforez tarafından çözüldü zaman her kene FlaB ve OspA reaksiyon Urun olabilir görsel olarak attı ve denetimleri karşı karşılaştırıldığında. Şekil 2, benzersiz numune tanımlayıcıları her jel üst kısmında sağlanır ve no-şablonu ve aerosol denetimleri, sol ve sağ, sırasıyla, merdivenler için bitişik temsil edilir.

Sağlam amplicon bantları select deneysel örnekleri açıkça görülebilir ve ihtiyaç fazlası astar ve kalan DNA (Şekil 2) kolayca ayırt edilirler. Belirtilen deneysel tasarım ilkelerine dayanan, bir kene için Borrelia paralel zaman negatif denetimler hiçbir amplifikasyon gösterir ve iç amplicons FlaB ve OspA astar üretilen pozitif olarak kabul edilir. Bu durumda, örnek T907, T604 ve T606 için Lyme patojen (Şekil 2) gözetim kriterlerini karşıladı. By Contrast, T923 sadece OspAiçin birden çok olası açıklaması vardır bir sonuç pozitif: A) kökenli kene Borreliaiçin negatif çıktı, ama dış veya iç OspA PCR hazırlık spuriously ile kontamine yapıldı. Şablon DNA (reaktifler sistemik bulaşma yolu ile negatif denetimleri ekarte Not), B) BorreliaLyme kene taşıdı, ancak düşük şablon tutarlar veya deneysel hata engelledi amplifikasyon FlaBveya C) bir organizma mevcuttu Bu korunmuş OspA sıra yer alan ama Flagellin yoksun veya astar için tavlamak için FlaB hedeflenen bölgede yetersiz kimlik vardı. Gerçekten de, OspA sıra benzerlikler bitki ve hayvan28da dahil çeşitli gözlemlemekteyiz. Converse durum, daha fazla amplifikasyon Flagellin gen, ama OspA gene korunmuş, ilişkili bir Borrelia tür olduğunu gösterebilir. Uygulamada, bu iletişim kuralını senaryo 'A' en muhtemel açıklama olduğunu düşündüren FlaB astar yapmak daha fazla OspA tek pozitif sonuç verir. Çekişmeli numune deneysel analizi daha fazla, ancak, bu tek pozitif sonuç kaynağını belirlemek mümkün değildir. Belirsiz örnekleri üzerinde gerçekleştirilen teknik çoğaltır sayısını artırarak spuriously önceki tepkiler sunulan herhangi bir kirletici arşivlenmiş DNA'mevcut olmaz bu yana doğru onların durumu, uzlaştırmak için yardımcı olabilir. Ancak, bu astar sonraki reaksiyon kesin sonuçlar sağlamak için başarısız olursa, diğer Borrelia loci PCR tarafından soruşturma. Bu tepkiler oluşturulan Amplicons Ayrıca sıralı ve yalıtır arasında kimlik atamak ve gerilme sapma derecesini tahmin etmek için karşılaştırıldığında. Sapı ve arkadaşları insan klinik örnekler35kullanarak bu iş akışı için bir örnek sağlar.

Tüm faktörler olarak kabul, anahatları belirlenmiş iletişim kuralı ve yorumu kriterleri %0.17, %0.0063, yanlış pozitif ve yanlış negatif oranları sırasıyla verim için tahmin edilmiştir.

Figure 2
Resim 2 : Hafiye-in Borrelia burgdorferi nPCR tarafından tek tek dilimleri FlaB ve OspA. Her kene için atanan kodları jelleri üst kısmında gösterilir ve kimlik tespiti OspA ve FlaB her örnek içinde bildirmek için dikey olarak hizalama. Şerit B sol tarafındaki görüntü temsil no-şablonu denetimler biletlerinde (sağ şerit) laboratuar ortamında kirlenme yakalamak için aerosol denetimleridir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Discussion

Kullanım on yıl içinde PCR tabanlı teknikleri sürekli Eklem bacaklılar ve memeli örnekleri Borrelia tespiti onların değeri kanıtlamıştır Borrelia çevresel veya klinik kökenli gelir. PCR gözetim önceden varolan yaklaşımlar üzerinde birçok yenilik sunuyor. Özellikle, geliştirme ve Antikor Reaktif performansını üzerinde bağımlı değildir ve bunun yerine kolayca sadece astar sıralarını değiştirerek ilgi yeni hedefler tespit etmek için uyarlanabilir. PCR da tek başına veya bir multiplex tepki ile paralel, birden çok loci değerlendirilmesi barındırır. Taze ve arşivlenmiş keneler22, hayvan veya insan vücut sıvıları ve rezeke doku25de dahil olmak üzere çeşitli numune girişleri için uygulanabilir. PCR da daha fazla, restriksiyon enzimi sindirim, sonda hibridizasyon veya sıralama artan mikrobiyal kimlik21içgörü sağlamak için örneğin işlenebilir amplicons verir.

Konak immün yanıt üzerinde enfeksiyon ikincil bir ölçüsü olarak güvenmek yerine, bakteriyel varlığı hakkında doğrudan bir bilgi vermez gibi klinik bir araç olarak PCR standart serolojik teşhis için kavramsal olarak tercih edilir. Ancak, Lyme borreliosis nispeten mütevazı bir mikrobiyal yükü ile ilişkilidir (< idrar veya plazma 50 organizmalar/mL) ve25için yanlış negatif çıkmasına neden olabilir geçici spirochetemia neden olur. Bu teknik klinikte duyarlılığını önemli ölçüde doku türü, enfeksiyon ve örnek durum, aşamada % 12,5 ve kan, beyin omurilik sıvısı ve biyopsi doku36varolan çalışmalarda % 62 arasında düşülüyor bağlı olarak değişir. PCR bakteri kültürü ardından üstlenilen uygun spirochetes kurtarma klinik örneklerin en benzer şekilde zor kanıtlamıştır ancak moleküler duyarlılık sınırlamalar bir endişe değildir. Ancak son zamanlarda iletişim kuralları daha yüksek verim35için optimize edilmiştir. Bu arada, virüslü yetişkin kene gut ortalama olarak her yerde 2.000 nPCR algılama aralığı içinde sağlam olan 50.000'i aşkın Borrelia37,38,39, liman. Böylece, protokol kene gözetim çabalar için uygundur.

Birçok avantajları rağmen nPCR belli sorunlarla ve doğru bir şekilde kene enfeksiyon bu nedenle genler ve amplicons, kalite DNA kurtarmak titiz deneysel iş akışları stratejik seçime bağlıdır bildirmek için bu teknik kapasitesini teşkil etmez çapraz-pozlama örnekleri ve laboratuar ortamında ve reaktifler kirletici bildirmek uygun kontrollerin kullanımı en aza indirirken örnekler. Böylece uygun genetik loci ve bölgeler, seçilebilir herhangi bir deneme önce kapsam ve soruşturma niyetlerini açıkça tanımlanmalıdır. Amaç karmaşık Lyme neden Borrelia burgdorferi s.l. için tarafsız bir ekran sağlamak için ise, astar tüm benzer ilgi ile ilişkili suşlar algılamak için oluşturulacak ve yakalama olmadan amplifikasyon verimlilik, ilgisiz organizmalar25. Yeni astar tasarlanabilir ve uncharacterized örnekler için uygulanan önce biçilen silico her ne kadar onlar da deneysel olarak karşı standart referans doğrulanması gerektiğini astar-BLAST40gibi yazılım araçları kullanılarak izole ediyor. Sağlam mikrobiyal şablon bir karışık çevresel örnek (kene homogenate) kurtarmak için DNA ekstraksiyon yordamı hedefidir. İsteğe bağlı PCR ile devam etmeden önce ayıklanan DNA bütünlüğünü değerlendirmek için bir adımdır. Ayrıca, paralel reaksiyonlar kene bir temizlik gen hedeflemek için kurmak olabilir. İkinci yöntem da olumsuz Borrelia tepkiler organizmanın ve değil bir inhibitör kirletici varlığı nedeniyle olduğunu artan güven sağlayan tepki karışımı inhibitörleri varlığını gösterebilir.

İç içe geçmiş PCR yaklaşım duyarlılık arttı yanlış pozitif sonuçlar üretir potansiyel kirlilik pahasına geliyor. Eksojen şablonu bir örnek için kene diseksiyon ve DNA kurtarma sırasında veya kadar dış ve iç amplifikasyon tepkiler kurma sürecinde tanıttı. Bu nedenle özellikle PCR şablonu veya amplicon önlemek için en iyi uygulama protokolleri takip etmek önemlidir Çapraz bulaşma. Bunlar ayrı iş istasyonları ile bağımsız airflows, kapsama kullanımı PCR ve biyolojik Emanet dolapları uygun olan durumlarda, dahil kapsamlı kimyasal ve fiziksel temizlik ve sterilizasyon yüzeyler ve reaktifler ve DNA dikkatli işleme 41. No-şablonu denetimler de hisse senedi reaktifler kirlenme belirlenmesinde hayati vardır. NPCR belirli bir açığı bu işleme amplicon ilk tepki ürünleri ikinci PCR damar aktarma oluşur olduğunu. Hedef DNA zaten olumlu örnekler üstel zenginleştirme uğramıştır beri bu adımı Çapraz bulaşma özellikle eğilimli ve bir tek tüp nPCR protokol bu sınırlamayı aşmak için geliştirilmiştir. Bu yaklaşım, her iki kümesini astar için belirli bir gen de birlikte PCR31her iki tur için mühürlü kalacak bir tepki tüp eklenir. Öyle ki dış çift şablonu için iç astar yasak olduğunu yüksek tavlama sıcaklıkta yükselterek dış ve iç astar çiftleri thermodynamically farklı olması gerekir. İkinci turda, tavlama sıcaklığı iç çift karşılamak için indirilir. Sadece bu potansiyel karıştırıcı bir adım atlamak yok, Ayrıca ek kullanımına izin verir Anti-kirlenme ölçer31,42. Ancak, bu değişiklik bazı tahlil duyarlılık kurban. Yaklaşım ne olursa olsun, teknik çoğaltır bağımsız olarak bir örnek üzerinde gerçekleştirilen artırıldığında sahte kirlenme tanımlamak için yardımcı olacaktır.

Moleküler teknikleri nPCR giriş beri gelişmeye devam etmiştir ve bu yeni yaklaşımlar, mali gider artmış da olsa özgün tasarımlar, select avantajlar sunuyor. Adından da anlaşılacağı gibi kantitatif PCR (qPCR veya gerçek zaman (RT)-PCR) geleneksel teknikleri doğa43nitel olmakla birlikte bir örnek patojenler numaralandırılmasına olanak sağlar. QPCR duyarlılığını bildirildi nPCR38, benzer olsa da astar özellikleri28bağlı olarak değişebilir. Moleküler işaretleri (MB) geleneksel TaqMan sondalar yerine kullanır qPCR bir varyasyonu da Borrelia algılama içinde klinik örneklerin44,45,46söz göstermiştir. Kendi benzersiz ikincil yapı nedeniyle moleküler işaretleri bildirildi alt arka plan Floresans ve böylece üstün hassasiyet47sağlayarak daha yüksek meşru sinyalleri üretmek. Önceden klinik değerlendirme bir ve on spirochetes44,45arasında bir potansiyel algılama eşiği öneririz. Ayrıca, aynı anda bir memeli ev sahibi gen44 ve diğer kene patojenler45, hangi ile nPCR olarak kolayca ulaşılabilir değil algılamak için çok katmanlı reaksiyonlarda tekniği başarıyla uygulandı. Diğer tasarım değişiklikleri DNA bir standart eğri39,48kullanmadan ölçmek damlacık dijital PCR (ddPCR) teknolojisini içerir. Daha düşük algılama bu tekniğin için Borrelia aynı şekilde yaklaşık on spirochetes/örnek39sınırıdır. Onlar sadece bir tek amplifikasyon protokol gerektirir gibi nPCR için karşılaştırıldığında, bu yaklaşımlar da kontaminasyon için azaltılmış potansiyel avantajı var.

Gözetim amacı yerine bir kene çeşitli bakteri içeriğini profil ise, 16S rRNA metagenomic tarama bir çekici bir seçenek49olur. Bu yaklaşım costlier, tüm moleküler biyoloji laboratuvarlarında bulunamadı özel DNA sıralayıcılar için ve daha sofistike yorumu Biyoinformatik tabanlı gerektirir rağmen bu mikroplar daha geniş bir yelpazede doğru bir şekilde yakalayabilirsiniz vektör patojen yük temsil eder.

QPCR ve türevleri kantitatif uygulamaları için seçim yöntemlerini, metagenomics ekranlar kene microbiome geniş stoklar sunar iken ve hedeflenen gözetim çabalar kez varlığı ya da yokluğu ikili raporlama ile ilgili bir vektör bir veya bir kaç patojenler. Bu durumda, bu daha yeni, daha ayrıntılı yaklaşımların gereksiz karmaşıklık ve mali yük sürecine neden olabilir. Bu nedenlerden dolayı nPCR test kene önemli bir teknik olarak zaman test dayanmış.

Disclosures

Yazarlar ifşa gerek yok.

Acknowledgments

Yazarlar Kami Harris için astar tasarım, Ashley McKibbon ve Jessica Thomas-Ebbett filme ve John Blakely, Alexandra Foley-Münir, Chris Langley, Julie Lewis, Kelsey McIntyre, Ashley McKibbon, Chris Zinck ve Rosie köpek görünmesini için teşekkür etmek istiyorum video. A. M. K. Kanada Lyme hastalığı Araştırma Vakfı tarafından desteklenen ve proje finansman Doğa Bilimleri ve mühendislik Araştırma Konseyi, Kanada (NSERC) tarafından sağlandı. M. K. d. W. maaş New Brunswick yenilik Vakfı (NBIF) üzerinden fon aldı.

Materials

Name Company Catalog Number Comments
LabGard Class II, Type A2 biological safety cabinet Nuaire ES AIR NU-543 
Razor blades VWR 55411-050 0.22 mm thickness
Microfuge Tubes (Microtubes 1.5 mL) Axygen 311-08-051
AquaGenomic  MultiTarget Pharmaceuticals 2030 DNA extraction reagent
Microtube Pestle Diamed DIATEC610-1551 Designed for 1.5 ml tubes
Water bath - Isotemp 202 Fishse Scientific 15-462-2
Vortex Labnet S0100 CAN
Spectrafuge 24D Digital Microcentrifuge Labnet C2400
Isopropanol Sigma-Aldrich 190764
BIS-TRIS Sigma-Aldrich B9754
Primer Synthesis Sigma-Aldrich OLIGO
PCR Cabinet Misonix PCR6-482
PCR tube with attached flat caps 0.2mL VWR 20170-012
GoTaq Green Master Mix 2x Promega M7123
Nuclease-free water Promega M7123 The water comes with the GTG
Spectrafuge Mini Labnet C1301
SYBR Safe DNA Stain 10,000X Concentration EDVOTEK 608
Froggarose LE (Molecular Biology Grade Agarose) FroggaBio A87-500G
GD 100 bp DNA Ladder FroggaBio DM001-R500 
Electrophoresis power pack  VWR VWR 105 EC Apparatus Corporation
Fluor-S MultiImager  BioRad 170-7700 (Serial number 433B0154)
Quantity One 1-D Analysis Software (V. 4.5.2) BioRad 1709600

DOWNLOAD MATERIALS LIST

References

  1. Schotthoefer, A. M., Frost, H. M. Ecology and epidemiology of Lyme borreliosis. Clin. Lab. Med. 35, (4), 723-743 (2015).
  2. Franke, J., Hildebrandt, A., Dorn, W. Exploring gaps in our knowledge on Lyme borreliosis spirochaetes - Updates on complex heterogeneity, ecology, and pathogenicity. Ticks Tick Borne Dis. 4, (1-2), 11-25 (2013).
  3. Rudenko, N., Golovchenko, M., Vancova, M., Clark, K., Grubhoffer, L., Oliver, J. H. Jr Isolation of live Borrelia burgdorferi sensu lato spirochaetes from patients with undefined disorders and symptoms not typical for Lyme borreliosis. Clin. Microbiol. Infect. 22, (3), 267.e9-267.e15 (2016).
  4. Scott, J. D., Clark, K. L., Anderson, J. F., Foley, J. E., Young, M. R., Durden, L. A. Lyme Disease Bacterium, Borrelia burgdorferi Sensu Lato, Detected in Multiple Tick Species at Species at Kenora, Ontario, Canada. J Bacteriol Parasitol. 08, (01), 1-10 (2017).
  5. Sperling, J., Middelveen, M., Klein, D., Sperling, F. Evolving perspectives on lyme borreliosis in Canada. Open Neurol J. 6, 94-103 (2012).
  6. Pachner, A. R. Early disseminated Lyme disease: Lyme meningitis. Am. J. Med. 98, (Supplement 1), 30S-43S (1995).
  7. Mikkilä, H. O., Seppälä, I. J., Viljanen, M. K., Peltomaa, M. P., Karma, A. The expanding clinical spectrum of ocular lyme borreliosis. Ophthalmology. 107, (3), 581-587 (2000).
  8. Mc Causland, F. R., Niedermaier, S., Bijol, V., Rennke, H. G., Choi, M. E., Forman, J. P. Lyme disease-associated glomerulonephritis. Nephrol. Dial. Transplant. 26, (9), 3054-3056 (2011).
  9. Tunev, S. S., Hastey, C. J., Hodzic, E., Feng, S., Barthold, S. W., Baumgarth, N. Lymphoadenopathy during Lyme Borreliosis Is Caused by Spirochete Migration-Induced Specific B Cell Activation. PLoS Pathog. 7, (5), e1002066-e1002014 (2011).
  10. Kostić, T., et al. Manifestations of Lyme carditis. Int. J. Cardiol. 232, 24-32 (2017).
  11. Hinckley, A. F., et al. Lyme Disease Testing by Large Commercial Laboratories in the United States. Clin. Infect. Dis. 59, (5), 676-681 (2014).
  12. Nelson, C. A., et al. Incidence of Clinician-Diagnosed Lyme Disease, United States 2005-2010. Emerg. Infect. Dis. 21, (9), 1625-1631 (2015).
  13. Aucott, J. N., Rebman, A. W., Crowder, L. A., Kortte, K. B. Post-treatment Lyme disease syndrome symptomatology and the impact on life functioning: is there something here? Qual Life Res. 22, (1), 75-84 (2012).
  14. Aucott, J. N., Crowder, L. A., Kortte, K. B. Development of a foundation for a case definition of post-treatment Lyme disease syndrome. Int. J. Infect. Dis. 17, (6), e443-e449 (2013).
  15. Adrion, E. R., Aucott, J., Lemke, K. W., Weiner, J. P. Health care costs, utilization and patterns of care following Lyme disease. PLoS ONE. (2015).
  16. Cameron, D. J. Consequences of treatment delay in Lyme disease. Journal of Evaluation in Clinical Practice. 13, (3), 470-472 (2007).
  17. Johnson, L., Aylward, A., Stricker, R. B. Healthcare access and burden of care for patients with Lyme disease: a large United States survey. Health policy. 102, (1), 64-71 (2011).
  18. Motaleb, M. A., et al. Borrelia burgdorferi periplasmic flagella have both skeletal and motility functions. Proc. Natl. Acad. Sci. U.S.A. 97, (20), 10899-10904 (2000).
  19. Rosa, P. A., Tilly, K., Stewart, P. E. The burgeoning molecular genetics of the Lyme disease spirochaete. Nat. Rev. Microbiol. 3, (2), 129-143 (2005).
  20. Kenedy, M. R., Lenhart, T. R., Akins, D. R. The role of Borrelia burgdorferi outer surface proteins. FEMS Immunol. Med. Microbiol. 66, (1), 1-19 (2012).
  21. Persing, D. H., Telford, S. R., Spielman, A., Barthold, S. W. Detection of Borrelia burgdorferi infection in Ixodes dammini ticks with the polymerase chain reaction. J. Clin. Microbiol. 28, (3), 566-572 (1990).
  22. Persing, D. H., et al. Detection of Borrelia burgdorferi DNA in museum specimens of Ixodes dammini ticks. Science. 249, (4975), 1420-1423 (1990).
  23. Wise, D. J., Weaver, T. L. Detection of the Lyme disease bacterium, Borrelia burgdorferi, by using the polymerase chain reaction and a nonradioisotopic gene probe. J. Clin. Microbiol. 29, (7), 1523-1526 (1991).
  24. Johnson, B. J., Happ, C. M., Mayer, L. W., Piesman, J. Detection of Borrelia burgdorferi in ticks by species-specific amplification of the flagellin gene. Am. J. Trop. Med. Hyg. 47, (6), 730-741 (1992).
  25. Schmidt, B. L. PCR in laboratory diagnosis of human Borrelia burgdorferi infections. Clin. Microbiol. Rev. 10, (1), 185-201 (1997).
  26. Ogden, N. H., et al. Ixodes scapularis ticks collected by passive surveillance in Canada: analysis of geographic distribution and infection with Lyme borreliosis agent Borrelia burgdorferi. J. Med. Entomol. 43, (3), 600-609 (2006).
  27. Doern, G. V. Detection of selected fastidious bacteria. Clin. Infect. Dis. 30, (1), 166-173 (2000).
  28. Nolte, O. Nucleic Acid Amplification Based Diagnostic of Lyme (Neuro-)borreliosis - Lost in the Jungle of Methods, Targets, and Assays? Open Neurol J. 6, (1), 129-139 (2012).
  29. Wallich, R., Moter, S. E., Simon, M. M., Ebnet, K., Heiberger, A., Kramer, M. D. The Borrelia burgdorferi flagellum-associated 41-kilodalton antigen (flagellin): molecular cloning, expression, and amplification of the gene. Infect. Immun. 58, (6), 1711-1719 (1990).
  30. Picken, R. N. Polymerase chain reaction primers and probes derived from flagellin gene sequences for specific detection of the agents of Lyme disease and North American relapsing fever. J. Clin. Microbiol. 30, (1), 99-114 (1992).
  31. Picken, M. M., Picken, R. N., Han, D., Cheng, Y., Strle, F. Single-tube nested polymerase chain reaction assay based on flagellin gene sequences for detection ofBorrelia burgdorferi sensu lato. Eur. J. Clin. Microbiol. Infect. Dis. 15, (6), 489-498 (1996).
  32. Keirans, J. E., Litwak, T. R. Pictorial key to the adults of hard ticks, family Ixodidae (Ixodida: Ixodoidea), east of the Mississippi River. J. Med. Entomol. 26, (5), 435-448 (1989).
  33. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J Vis Exp. (63), e3998 (2012).
  34. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose Gel Electrophoresis for the Separation of DNA Fragments. J Vis Exp. (62), e3923 (2012).
  35. Sapi, E., Pabbati, N., Datar, A., Davies, E. M., Rattelle, A., Kuo, B. A. Improved culture conditions for the growth and detection of Borrelia from human serum. Int J Med Sci. 10, (4), 362-376 (2013).
  36. Waddell, L. A., Greig, J., Mascarenhas, M., Harding, S., Lindsay, R., Ogden, N. The Accuracy of Diagnostic Tests for Lyme Disease in Humans, A Systematic Review and Meta-Analysis of North American Research. PLoS ONE. 11, (12), e0168613-e0168623 (2016).
  37. Brunet, L. R., Spielman, A., Telford, S. R. III Density of Lyme disease spirochetes within deer ticks collected from zoonotic sites. Am. J. Trop. Med. Hyg. 53, (3), 300-302 (1995).
  38. Wang, G., et al. Real-time PCR for simultaneous detection and quantification of Borrelia burgdorferi in field-collected Ixodes scapularis ticks from the Northeastern United States. Appl. Environ. Microbiol. 69, (8), 4561-4565 (2003).
  39. King, J. L., Smith, A. D., Mitchell, E. A., Allen, M. S. Validation of droplet digital PCR for the detection and absolute quantification of Borrelia DNA in Ixodes scapularis ticks. Parasitology. 144, (4), 359-367 (2017).
  40. Ye, J., Coulouris, G., Zaretskaya, I., Cutcutache, I., Rozen, S., Madden, T. L. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 13, (1), 134 (2012).
  41. Kwok, S., Higuchi, R. Avoiding false positives with PCR. Nature. 339, (6221), 237-238 (1989).
  42. Rys, P. N., Persing, D. H. Preventing false positives: quantitative evaluation of three protocols for inactivation of polymerase chain reaction amplification products. J. Clin. Microbiol. 31, (9), 2356-2360 (1993).
  43. Pahl, A., Kühlbrandt, U., Brune, K., Röllinghoff, M., Gessner, A. Quantitative detection of Borrelia burgdorferi by real-time PCR. J. Clin. Microbiol. 37, (6), 1958-1963 (1999).
  44. Saidac, D. S., Marras, S. A. E., Parveen, N. Detection and quantification of Lyme spirochetes using sensitive and specific molecular beacon probes. BMC Microbiol. 9, (1), 43 (2009).
  45. Chan, K., Marras, S. A. E., Parveen, N. Sensitive multiplex PCR assay to differentiate Lyme spirochetes and emerging pathogens Anaplasma phagocytophilum and Babesia microti. BMC Microbiol. 13, (1), 295 (2013).
  46. Schlachter, S., Chan, K., Marras, S. A. E., Parveen, N. Detection and Differentiation of Lyme Spirochetes and Other Tick-Borne Pathogens from Blood Using Real-Time PCR with Molecular Beacons. Methods Mol. Biol. 1616, 155-170 (2017).
  47. Wang, L., Blasic, J. R. Jr, Holden, M. J., Pires, R. Sensitivity comparison of real-time PCR probe designs on a model DNA plasmid. Anal. Biochem. 344, (2), 257-265 (2005).
  48. Sze, M. A., Abbasi, M., Hogg, J. C., Sin, D. D. A Comparison between Droplet Digital and Quantitative PCR in the Analysis of Bacterial 16S Load in Lung Tissue Samples from Control and COPD GOLD 2. PLos ONE. 9, (10), e110351-e110356 (2014).
  49. Sperling, J. L., et al. Comparison of bacterial 16S rRNA variable regions for microbiome surveys of ticks. Ticks Tick Borne Dis. 1-9 (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics