Author Produced

लाइम रोग Spirochete, अरै Burgdorferiका पता लगाने में, नेस्टेड पीसीआर का उपयोग टिक में

Biology
JoVE Journal
Biology
AccessviaTrial
 

Summary

नेस्टेड पीसीआर एक संवेदनशील, विशिष्ट, और सरल तकनीक है कि डीएनए निष्कर्षों को टिक अरै burgdorferi, लाइम रोग के प्रेरणा का एजेंट के लिए जांच करने के लिए लागू किया जा सकता है । प्रारंभिक पीसीआर प्रयोग जीन विशिष्ट प्राइमरों का उपयोग करता है के लिए लंबे amplicons है, जो फिर एक बाद प्रतिक्रिया के लिए टेंपलेट्स बन उत्पंन आंतरिक प्राइमरों का उपयोग ।

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Wills, M. K. B., Kirby, A. M., Lloyd, V. K. Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR. J. Vis. Exp. (132), e56471, doi:10.3791/56471 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

लाइम रोग एक गंभीर वेक्टर जनित संक्रमण है जो कि spirochetes के अरै burgdorferi कामुक लाटो परिवार के कारण होता है, जो संक्रमित Ixodes ticks के काटने के माध्यम से मनुष्यों को फैलता है । उत्तरी अमेरिका में प्राथमिक etiological एजेंट अरै burgdorferi कामुक stricto है । के रूप में भौगोलिक जोखिम क्षेत्रों का विस्तार, यह मजबूत निगरानी प्रोग्राम है कि टिक संक्रमण दर उपाय कर सकते है समर्थन विवेकपूर्ण है, और चिकित्सकों, पशु चिकित्सकों, और आम जनता के लिए निष्कर्षों संवाद । नेस्टेड पोलीमरेज़ चेन रिएक्शन (nPCR) की आणविक तकनीक लंबे समय से इस प्रयोजन के लिए इस्तेमाल किया गया है, और यह एक केंद्रीय, सस्ता, और मजबूत दृष्टिकोण अरै दोनों ticks और वंय जीवन में का पता लगाने में रहता है ।

यह लेख nPCR के आवेदन को दर्शाता है डीएनए निष्कर्षों को टिक करने के लिए संक्रमित नमूनों की पहचान । दो स्वतंत्र बी burgdorferi लक्ष्य, जीन एंकोडिंग Flagellin बी (FlaB) और बाहरी सतह प्रोटीन एक (OspA), इस तकनीक के साथ बड़े पैमाने पर इस्तेमाल किया गया है । प्रोटोकॉल टिक संग्रह, डीएनए निष्कर्षण शामिल है, और फिर पीसीआर के एक प्रारंभिक दौर में प्रत्येक दो अरै-विशिष्ट loci का पता लगाने के लिए । बाद में पोलीमरेज़ चेन रिएक्शन (पीसीआर) एक नए के रूप में पहली प्रतिक्रिया के उत्पाद का उपयोग करता है छोटे, आंतरिक प्रवर्धन टुकड़े उत्पंन खाके । नेस्टेड दृष्टिकोण दोनों विशिष्टता और पारंपरिक पीसीआर की संवेदनशीलता पर सुधार । एक टिक रोगज़नक़ के लिए सकारात्मक माना जाता है जब दोनों अरै जीन से भीतरी amplicons agarose जेल ट्रो द्वारा पता लगाया जा सकता है ।

Introduction

लाइम रोग (एलडी) उत्तरी गोलार्द्ध में सबसे अधिक प्रचलित वेक्टर जनित संक्रमण है, और इसकी घटनाओं में1वृद्धि जारी है । यह दुर्बल बीमारी लाइम लाइम (पौंड) परिसर के spirocheteal रोगजनकों के कारण होता है (सामांयतः अरै burgdorferi कामुक लाटो, या s.l. के रूप में जाना जाता है), जो ऐतिहासिक रूप से प्रमुख उत्तर अमेरिकी रोगज़नक़, बी शामिल है burgdorferi कामुक stricto (एस. एस.), बी afzelii और बी garinii, जो यूरोप और एशिया भर में बड़े पैमाने पर कर रहे है के अलावा, और उभरते नैदानिक प्रासंगिकता2,3की प्रजातियों हैं । ये जीवाणु संक्रमित Ixodes ticks2के काटने के माध्यम से मनुष्यों को प्रेषित कर रहे हैं हालांकि मुख्य उत्तर अमेरिकी वैक्टर scapularis और pacificusहैं, इस जीनस के भीतर कई प्रजातियों बंदरगाह के लिए पाया गया है और जीवाणु4संचारित । मनुष्यों में, बी burgdorferi त्वचा, जोड़ों, दिल, तंत्रिका तंत्र, अंत में ग्रंथि, जठरांत्र संबंधी मार्ग, और आंतरिक अंगों5,6,7को प्रभावित करने के लक्षण पैदा कर सकता है, 8,9,10. रोग नियंत्रण और रोकथाम के लिए केंद्र वर्तमान में संयुक्त राज्य अमेरिका11,12में सालाना ३००,००० नए मानव मामलों पर अनुमान है । जबकि रोग का निदान अक्सर अनुकूल है जब बीमारी का पता चला है और प्रारंभिक अवस्था में इलाज किया है, अध्ययनों से सुझाव दिया है कि कहीं भी 10% और रोगियों की सिफारिश की एंटीबायोटिक आहार प्राप्त की ६०% के बीच चिकित्सा के बाद लक्षण अनुभव करने के लिए जारी प्रेक्टिस, एक घटना में पद उपचार लाइम रोग सिंड्रोम (PTLDS)13,14,15। इसके अलावा, नैदानिक हस्तक्षेप में देरी एक टिक काटने के बारे में जागरूकता की कमी का एक परिणाम के रूप में पैदा कर सकते हैं, प्रारंभिक बीमारी के गैर विशिष्ट प्रस्तुति, और संक्रमण की शुरुआत में इस्तेमाल किया जब पारंपरिक सीरोलॉजी-आधारित निदान की कम संवेदनशीलता. तेजी से इलाज के लिए विफलता और उचित लक्षण प्रगति है कि तेजी से दुर्बलता में प्रकट कर सकते हैं सक्षम बनाता है16,17जटिलताओं । लाइम रोग निवारण इसलिए जोखिम प्रबंधन की आधारशिला है । इस बढ़ते खतरे से निपटने के लिए रणनीतियों में टिकर में रोगजनक प्रसार को इंगित करने के लिए मजबूत निगरानी उपाय शामिल हैं, और चिंता के भौगोलिक क्षेत्रों की पहचान करें ।

यह आलेख नेस्टेड पोलीमरेज़ चेन रिएक्शन (nPCR) की उपयोगिता को एक आणविक स्क्रीनिंग टूल के रूप में प्रदर्शित करता है जिसके द्वारा संक्रमित टिकरों की पहचान की जाती है. विशिष्टता बढ़ाने के लिए, समानांतर प्रवर्धन के लिए दो अरै जीन का उपयोग किया जाता है । Flagellin बी (FlaB) encodes flagellum के एक प्रमुख रेशा प्रोटीन18, और जीन एकल रैखिक गुणसूत्र पर स्थित है, जबकि बाहरी सतह प्रोटीन एक (OspA) मध्यस्थता टिक midgut के लिपोप्रोटीन उत्पाद औपनिवेशीकरण, और है प्लाज्मिड-इनकोडिंग19,20। कार्यप्रवाह टिक संग्रह, डीएनए निष्कर्षण, और फिर अरै-विशिष्ट loci का पता लगाने के लिए पीसीआर के एक प्रारंभिक दौर के होते हैं । बाद में पीसीआर एक नए के रूप में पहली प्रतिक्रिया के उत्पाद का उपयोग करता है छोटे, आंतरिक प्रवर्धन टुकड़े उत्पंन खाके । एक टिक अरै burgdorferi के लिए सकारात्मक माना जाता है जब दोनों अरै जीन से भीतरी amplicons agarose जेल ट्रो द्वारा पता लगाया जा सकता है ।

दोनों nPCR तकनीक, और FlaB और OspA जीन लक्ष्य, व्यापक रूप से 1990 के दशक21के बाद से पारिस्थितिकी निगरानी और लाइम spirochete के नैदानिक जांच के लिए इस्तेमाल किया गया है,22,23 ,24,25. आणविक प्रोटोकॉल के विकास से पहले, ticks विरोधी को आंत सामग्री-अरै इम्यूनोफ्लोरेसेंस (यदि) धुंधला, माइक्रोबियल संस्कृति, या तत्संबंधी संयोजन26के अधीन द्वारा मूल्यांकन किया गया । इन तरीकों अंतर्निहित सीमाओं से ग्रस्त हैं, अरै27की धीमी वृद्धि और दुराराध्य प्रकृति सहित, एंटीबॉडी प्रदर्शन के मुद्दों, और यदि प्रसंस्करण21के लिए जीना ticks की आवश्यकता । बाद में संक्रमित वैक्टर की तीव्र, संवेदनशील और विशिष्ट पहचान प्रदान करने के लिए पीसीआर को अपनाया गया । यह पारंपरिक पद्धति, संस्कृति सहित विविध प्रकार के नमूने के लिए स्वतंत्र प्रत्यक्ष आवेदन, जैसे मृत और संग्रहीत ticks है कि अंयथा21,22 के परीक्षण के लिए अनुपयुक्त होगा के रूप में चिह्नित सुधार की पेशकश की . नेस्टेड प्रयोगात्मक डिजाइन आगे25,28प्रवर्धन के दो लगातार दौर में जीन विशिष्ट प्राइमरों के दो अलग सेट को रोजगार से विशिष्टता और शास्त्रीय पीसीआर की संवेदनशीलता पर सुधार ।

प्रायोगिक सफलता सामरिक जीन चयन और amplicon डिजाइन पर गंभीर रूप से निर्भर है । सही अरै burgdorferiकी उपस्थिति का अनुमान लगाने के लिए, प्राइमरों को भी अरै जीनस में spirochetes के साथ परस्पर प्रतिक्रिया के बिना प्रासंगिक रोगजनकों का पता लगाना चाहिए । FlaBके मामले में, इस विशिष्टता जीन के एक चर आंतरिक क्षेत्र को लक्षित करने के बजाय अपेक्षाकृत संरक्षित है कि विविध जीवाणुओं द्वारा साझा कर रहे है क्रम से हासिल की है (चित्रा 1)24,29 , 30.

Figure 1
चित्रा 1: nPCR की अवधारणा, के रूप में सचित्र प्रयोग अरै FlaB जीन एक लक्ष्य के रूप में । जीन के 5 ' और 3 ' टर्मिनी अरै burgdorferi s.l. से परे जीवों के लिए आम हैं, लाइम के विशिष्ट आकलन के लिए इन क्षेत्रों अनुपयुक्त प्रतिपादन रोगजनकों के कारण । प्राइमरी लक्ष्य के रूप में कम संरक्षित इंटीरियर दृश्यों का उपयोग करना, पीसीआर के दो राउंड एक अंतिम, आंतरिक amplicon का पता लगाने के लिए निष्पादित कर रहे हैं । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

उनकी भेदभावपूर्ण क्षमता के परीक्षण में, इंटीरियर FlaB प्राइमरों से अधिक ८० अलग अरै पृथक के साथ मूल्यांकन किया गया है, और केवल लाइम रोग24के साथ जुड़े लोगों की पहचान करने के लिए पाया । nPCR के कम पता लगाने की सीमा के बीच में प्रलेखित किया गया है छह24 और दस शुद्ध संस्कृति से31 बैक्टीरिया, हालांकि संवेदनशीलता आगे दक्षिणी सोख्ता amplicon द्वारा सुधार किया जा सकता है, और hybridizing एक radiolabelled या chemiluminescent जांच की । युग्मन तकनीक एक एकल spirochete31के लिए खोज थ्रेशोल्ड कम कर देता है । प्रत्यक्ष तुलना, पारंपरिक, जांच एकल दौर पीसीआर द्वारा 104 spirochetes31की एक ंयूनतम की उपस्थिति की रिपोर्ट पाया गया । यह ध्यान दिया जाना चाहिए, तथापि, कि परख संवेदनशीलता कम हो जाएगा जब जटिल पर्यावरण और नैदानिक नमूनों के साथ काम, असंबंधित डीएनए और संभावित निरोधात्मक पदार्थों की भारी उपस्थिति के कारण । इन चुनौतियों को काफी हद तक nPCR के इस्तेमाल से दरकिनार किया जा सकता है.

पिछले दशकों में आणविक प्रौद्योगिकियों में अग्रिमों के बावजूद, nPCR आधुनिक निगरानी प्रयासों में एक प्रधान तकनीक बनी हुई है. यदि देखभाल डिजाइन और इस प्रोटोकॉल के निष्पादन में लिया जाता है, यह एक शक्तिशाली, अनुकूलनीय, और अपेक्षाकृत सीधा करने के लिए tick वैक्टर में रोगजनकों की उपस्थिति पर कब्जा दृष्टिकोण है ।

Protocol

1. डीएनए से अलगाव ticks

  1. क्षेत्र संग्रह, या पशु चिकित्सकों और जनता के सदस्यों से निष्क्रिय निगरानी के माध्यम से टिक प्राप्त करते हैं । ticks ठंड से मारे गए, एक सील बैग में रखा जाना चाहिए, और कमरे के तापमान पर भेज दिया ।
    1. एक सबमिशन प्रपत्र का उपयोग करना, मुठभेड़ की तारीख और भौगोलिक स्थिति पर जानकारी इकट्ठा, टिक लगाव की दशा, मेजबान प्रजातियों, और मेजबान के हाल ही में यात्रा के इतिहास ।
    2. के बाद से नेस्टेड पीसीआर स्वाभाविक संदूषण को कमजोर है, यह सुनिश्चित करें कि प्रयोगशाला कार्यक्षेत्र के नमूनों के पार जोखिम को कम करने के लिए स्थापित है । यह अलग, समर्पित रिक्त स्थान अच्छी तरह से एक दूसरे से अलग है कि अच्छी तरह से साफ कर रहे है और निष्फल, और सुनिश्चित करना है कि सभी उपकरणों के संदूषण से मुक्त है प्रोटोकॉल के विभिंन तत्वों को क्रियांवित करना शामिल है ।
    3. नमूना प्राप्त करने पर, फोटोग्राफ टिक और प्रजातियों का निर्धारण, विकासात्मक चरण, सेक्स, और एक पहचान कुंजी३२ की तुलना करके engorgement स्थिति ।
    4. रोकनेवाला शर्तों के तहत, bisect एक बाँझ उस्तरा ब्लेड या स्केलपेल का उपयोग कर टिक, और अलग microcentrifuge ट्यूबों में दो टिक टुकड़े जगह है ।
  2. कुल डीएनए निकालने के लिए, पीसीआर-संगत टेम्पलेट की पैदावार करने वाली किसी भी आइसोलेशन प्रक्रिया का उपयोग करें; यह प्रोटोकॉल एक साधारण केलेशनथेरेपी-आधारित दृष्टिकोण प्रदर्शित करता है ।
    1. एक उचित मात्रा जोड़कर शुरू (अक्सर ५०-२०० µ एल के बीच) के एक lytic केलेशनथेरेपी रिएजेंट के लिए टिक टुकड़ा । विशिष्ट राशि नमूना आकार और engorgement स्थिति पर निर्भर करेगा; दिशानिर्देश निर्माता द्वारा प्रदान किया जाना चाहिए । एक microtube खल का प्रयोग Homogenize ।
    2. ४५ मिनट के लिए ६० ° c में एक पानी स्नान में नमूनों की मशीन, और संक्षेप में भंवर ।
    3. एक डेस्कटॉप microcentrifuge में १६,२७६ x g (१३,३०० rpm) पर 4 मिनट के लिए नमूने केंद्रापसारक ।
    4. स्थानांतरण supernatant के लिए एक ताजा, microtube लेबल युक्त ५० µ l isopropanol, उलटा द्वारा मिश्रण, और पुनः के रूप में (1.2.3) में केंद्रापसारक ।
    5. supernatant खिचड़ी भाषा, और कुल्ला ७०% इथेनॉल के ५० µ एल के साथ डीएनए गोली ।
    6. एक पिपेट के साथ अतिरिक्त इथेनॉल निकालें, और हवा के लिए गोली की अनुमति-कमरे के तापमान पर 15 मिनट के लिए सूखी ।
    7. डीएनए reसस्पेंड करने के लिए, 1 मिमी Tris पीएच ७.० के ५० µ एल जोड़ने के लिए, और एक पानी स्नान में 1 एच के लिए ६० डिग्री सेल्सियस पर नमूने की मशीन । डीएनए अब भविष्य आणविक विश्लेषण के लिए-20 डिग्री सेल्सियस पर संग्रहित किया जा सकता है ।

2. अरै OspA और FlaBके नेस्टेड पीसीआर का पता लगाने ।

नोट: सामान्य पीसीआर सिद्धांतों और पद्धतियों का अवलोकन Lorenz, २०१२३३द्वारा प्रदान किया गया है ।

  1. संश्लेषित या अरै जीन विशिष्ट बाहरी और भीतरी oligonucleotide प्राइमरों प्राप्त करते हैं । प्राइमर सेट, उनके संबंधित amplicon आकार, और पिघलने तापमान के लिए तालिका 1 देखें ।
प्राइमरी का नाम जीन लक्ष्य अनुक्रम (5 '-3 ') Amplicon आकार एनीलिंग तापमान
FlaB आउट अग्रेषित करना flab gcatcactttcagggtctca ५०३ बीपी 55 ° c
FlaB आउट Rv flab tggggaacttgattagcctg
परिवार कल्याण में FlaB flab ctttaagagttcatgttggag ४४७ बीपी 58 ° c
Rv में FlaB flab tcattgccattgcagattgt
OspA आउट अग्रेषित करना OspA cttgaagttttcaaagaagat ४८७ बीपी 55 ° c
OspA आउट Rv OspA caactgctgacccctctaat
परिवार कल्याण में OspA OspA acaagagcagacggaaccag ३५० बीपी 58 ° c
Rv में OspA OspA ttggtgccatttgagtcgta

तालिका 1: अरै burgdorferiFlaB और OspA के nPCR के लिए भीतरी और बाहरी प्राइमर ।
अभ्यास में, FlaB प्राइमरों का पता लगाने बी burgdorferi एस और अंय बारीकी से संबंधित अरै genospecies, जबकि OspA प्राइमरों पर कब्जा केवल burgdorferi एस प्रवर्धन से दोनों loci का संकेत होगा बी । burgdorferi । एस

  1. पूर्व यूवी प्रकाश और ७०% इथेनॉल के साथ एक पीसीआर कैबिनेट बंध्याकरण ।
    नोट: संभावित नमूना संदूषण को कम करने के लिए, इस कार्यस्थान को टिक विच्छेदन, डीएनए निष्कर्षण, और जेल ट्रो के स्थान से अलग होना चाहिए ।
    1. प्रारंभिक पीसीआर चलाने के लिए, ऊपर चरण १.० में बरामद डीएनए टेंपलेट के साथ संयोजन के रूप में बाहरी प्राइमरों का उपयोग करें, और प्रतिक्रिया मिश्रण सेट के रूप में तालिका 2में वर्णित । समानांतर में, सकारात्मक नियंत्रण प्रदर्शन सत्यापित अरै डीएनए से मिलकर चलाता है, और नकारात्मक नियंत्रण नहीं-reएजेंट और एयरोसोल संदूषण का पता लगाने के लिए प्रतिक्रियाओं सहित चलाता है । अंत में डीएनए जोड़ें रिएजेंट के संभावित संदूषण को कम करने के लिए । सुनिश्चित करें कि प्रत्येक ट्यूब हर समय बंद कर दिया है, जब एजेंट नहीं जोड़ा जा रहा है और बंद ट्यूब तुरंत डीएनए के अलावा और इससे पहले अंय ट्यूबों खोल रहे हैं ।
    2. कार्यक्रम एक थर्मल साइकिल चालक निंनानुसार: ९५ ° c 5 मिनट के लिए; ४० के लिए ९५ ° c के चक्र 15 s, एनीलिंग तापमान के लिए 30 s, ७२ ° c के लिए ४५ s; 5 मिनट के लिए ७२ ° c; और 4 डिग्री सेल्सियस पर पकड़ो ।
  2. पहली प्रतिक्रिया के समान पीसीआर के दूसरे दौर प्रदर्शन, पहले पीसीआर उत्पाद के 2 µ एल के साथ इनर प्राइमरों का उपयोग करें ( -8 में उत्पादित) को छोड़कर ।
    नोट: प्रतिक्रिया खंड फिर से तालिका 2में प्रदान किए जाते हैं । देखभाल के पार से बचने के लिए लिया जाना चाहिए कि यह सुनिश्चित करने के टेंपलेट डीएनए और पिछले जोड़ा है कि केवल एक नमूना करने के लिए इसी ट्यूबों एक समय में खुले है द्वारा amplicons के संदूषण ।
     
    घटक पीसीआर # 1 खंड पीसीआर # 2 खंड
    Taq पोलीमरेज़ मास्टर मिश्रण 2x १२.५ µ l १२.५ µ l
    Nuclease-मुफ्त पानी ८.५ µ l ८.५ µ l
    10 µ एम फॉरवर्ड और रिवर्स प्राइमर १.० µ एल आउटर प्राइमरी १.० µ एल इनर प्राइमर
    डीएनए टेम्पलेट २.० µ एल, नमूना निष्कर्षण (1.2.7) से २.० µ एल, पीसीआर के राउंड 1 से ( -8)
    तालिका 2: पहली और दूसरी प्रवर्धन के लिए पीसीआर प्रतिक्रिया मिश्रण ।
     
    1. कार्यक्रम से पहले के रूप में थर्मल साइकिल चालक, लेकिन एनीलिंग तापमान को समायोजित करने के लिए इनर प्राइमरों को समायोजित (1 तालिका को देखें) ।

3. Agarose जेल ट्रो और इमेजिंग

नोट: ट्रो द्वारा डीएनए को अलग करने पर बुनियादी निर्देशों के लिए, देख ली एट अल, २०१२३४

  1. एक १.२% agarose 20X SB बफर (०.२ एम NaOH, ०.८ m बोरिक एसिड पीएच 8) का उपयोग कर जेल तैयार, 1x पतला, और एक डीएनए दाग के लगभग 5 µ एल जोड़ने के लिए, डालने से पहले, अगर पूर्व जेल के धुंधलाना वांछित है ।
  2. एक १०० बीपी सीढ़ी (5 µ एल) के साथ दूसरा (इनर) प्रत्येक प्रयोगात्मक और नियंत्रण नमूना से पीसीआर प्रतिक्रिया से उत्पाद के 10 µ एल लोड ।
    1. Electrophorese के लिए 1 घंटे में १०७ V (5v/
  3. देखें और एक transilluminator और संबंधित कैमरा और सॉफ्टवेयर का उपयोग कर जेल दस्तावेज़ ।

Representative Results

nPCR विशिष्ट और रोगज़नक़ का पता लगाने की संवेदनशीलता को बढ़ाने के लिए एक सुरुचिपूर्ण दृष्टिकोण है, विशेष रूप से जब जटिल पर्यावरणीय नमूने जांच के अधीन हैं । जैसा कि चित्रा 1में दर्शाया गया है, पीसीआर के दो दौर अरै FlaB लोकस (और OspA, चित्र नहीं) के एक रणनीतिक क्षेत्र को लक्षित करने के लघु भीतरी पीढ़ी के माध्यम से अरै burgdorferi बैक्टीरिया की उपस्थिति की रिपोर्ट कर सकते है amplicons । जब जेल ट्रो द्वारा हल, प्रत्येक टिक से FlaB और OspA प्रतिक्रिया उत्पादों नेत्रहीन रन बनाए और नियंत्रण के खिलाफ तुलना कर सकते हैं । चित्रा 2में, अद्वितीय नमूना पहचानकर्ता प्रत्येक जेल के शीर्ष के साथ प्रदान की जाती हैं, और कोई टेम्पलेट और एयरोसोल नियंत्रण दूर छोड़ दिया और सही में प्रतिनिधित्व कर रहे हैं, क्रमशः, सीढ़ी से सटे.

मजबूत amplicon बैंड का चयन प्रयोगात्मक नमूनों में स्पष्ट रूप से दिखाई दे रहे हैं, और वे आसानी से अधिशेष प्राइमरों और अवशिष्ट डीएनए से प्रतिष्ठित है (चित्रा 2) । प्रयोगात्मक डिजाइन सिद्धांतों आगे सेट के आधार पर, एक टिक अरै जब समानांतर नकारात्मक नियंत्रण नहीं प्रवर्धन प्रदर्शन के लिए सकारात्मक माना जाता है, और भीतरी amplicons दोनों FlaB और OspA प्राइमरों से उत्पादित कर रहे हैं । इस मामले में, नमूनों T907, T604, और T606 लाइम रोगज़नक़ (चित्रा 2) के लिए निगरानी मानदंडों से मुलाकात की । इसके विपरीत, T923 केवल OspAके लिए सकारात्मक था, एक परिणाम है जिसके लिए कई संभव स्पष्टीकरण कर रहे हैं: एक) मूल के टिक अरैके लिए नकारात्मक था, लेकिन बाहरी या भीतरी OspA पीसीआर की तैयारी के साथ प्रदूषित spuriously था टेंपलेट डीएनए (ध्यान दें कि पुनर्अभिकर्ताओं के प्रणालीगत संदूषण नकारात्मक नियंत्रण के माध्यम से शासन किया गया था), ख) टिक लाइम अरै, लेकिन कम टेंपलेट राशि या प्रयोगात्मक त्रुटि FlaBके प्रवर्धन रोका, या ग) एक जीव मौजूद था कि संरक्षित OspA अनुक्रम निहित है, लेकिन अभाव Flagellin या FlaB के लक्षित क्षेत्र में अपर्याप्त पहचान के लिए प्राइमरों को एनएन था । दरअसल, OspA अनुक्रम समानताएं पौधों और जानवरों28सहित जीवों की एक किस्म में उल्लेख किया गया है । बातचीत की स्थिति, अधिक संरक्षित Flagellin जीन के प्रवर्धन, लेकिन नहीं OspA जीन, एक संबंधित अरै प्रजातियों का संकेत सकता है । व्यवहार में, इस प्रोटोकॉल की पैदावार अधिक OspA एकल सकारात्मक परिणाम से FlaB प्राइमर, सुझाव है कि ' एक ' परिदृश्य है ंयूनतम विवरण की संभावना है । विवादास्पद नमूना के आगे प्रयोगात्मक विश्लेषण के बिना, तथापि, यह एक सकारात्मक परिणाम के स्रोत का निर्धारण करने के लिए संभव नहीं है । तकनीकी प्रतिकृति गोलमोल नमूनों पर प्रदर्शन की संख्या में वृद्धि उनकी सही स्थिति सामंजस्य करने में मदद कर सकते हैं, के बाद से किसी भी दूषित spuriously पिछले प्रतिक्रियाओं के लिए प्रस्तुत किए गए थे संग्रहीत डीएनए में मौजूद नहीं होगा । हालांकि, अगर इन प्राइमरों के साथ बाद प्रतिक्रियाओं निर्णायक परिणाम प्रदान करने में विफल, अंय अरै loci पीसीआर द्वारा जांच की जा सकती है । Amplicons इन प्रतिक्रियाओं से उत्पन्न भी अनुक्रम किया जा सकता है और पहचान को असाइन करने में मदद करने के लिए अलग के बीच तुलना, और तनाव विचलन की डिग्री का अनुमान. सापि और सहकर्मी मानव नैदानिक नमूनों३५का उपयोग कर इस वर्कफ़्लो का एक उदाहरण प्रदान करते हैं ।

सभी कारकों पर विचार किया, रेखांकित प्रोटोकॉल और व्याख्या मानदंड को ०.१७% और ०.००६३% की झूठी सकारात्मक और झूठी नकारात्मक दरों, क्रमशः उपज का अनुमान लगाया गया है ।

Figure 2
चित्र 2 : का पता लगाना अरै burgdorferi के nPCR द्वारा व्यक्तिगत ticks में FlaB और OspA । प्रत्येक टिक को असाइन किए गए कोड जैल के शीर्ष पर प्रस्तुत किए जाते हैं, और पहचान प्रत्येक नमूने में OspA और FlaB का पता लगाने के लिए अनुलंब रूप से संरेखित होती है । छवि के बाईं ओर में बी हकदार गलियों नहीं, नियंत्रण टेंपलेट का प्रतिनिधित्व करते हैं, जबकि एक (दाहिने हाथ लेन) एयरोसोल को प्रयोगशाला पर्यावरण के संदूषण पर कब्जा नियंत्रण कर रहे हैं । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Discussion

उपयोग के दशकों में, पीसीआर आधारित तकनीक लगातार सन्धिपाद और स्तनधारी नमूनों से अरै का पता लगाने में अपने मूल्य साबित कर दिया है, चाहे अरै पर्यावरण या नैदानिक मूल से आते हैं । पीसीआर निगरानी के लिए पूर्व मौजूदा दृष्टिकोण पर कई सुधार प्रदान करता है । विशेष रूप से, यह एंटीबॉडी रिएजेंट के विकास और प्रदर्शन पर निर्भर नहीं है, और इसके बजाय आसानी से केवल प्राइमरी दृश्यों को संशोधित करके ब्याज के नए लक्ष्य का पता लगाने के लिए अनुकूलित किया जा सकता है । पीसीआर भी या तो स्वतंत्र रूप से या एक मल्टीप्लेक्स प्रतिक्रिया के माध्यम से समानांतर में कई loci के मूल्यांकन को समायोजित । यह विविध नमूना आदानों के लिए लागू किया जा सकता है, सहित ताजा और संग्रहीत ticks22, पशु या मानव शारीरिक तरल पदार्थ, और प्रतिच्छेदित ऊतक25. पीसीआर भी पैदावार amplicons कि आगे संसाधित किया जा सकता है, उदाहरण के लिए प्रतिबंध एंजाइम पाचन, जांच संकरण, या अनुक्रमण द्वारा, माइक्रोबियल पहचान21में वृद्धि की अंतर्दृष्टि प्रदान करते हैं ।

एक नैदानिक उपकरण के रूप में, पीसीआर मानक सीरम निदान के लिए वैचारिक रूप से बेहतर है, के रूप में यह जीवाणु उपस्थिति का एक सीधा संकेत प्रदान करता है, बजाय संक्रमण के एक द्वितीयक उपाय के रूप में मेजबान प्रतिरक्षा प्रतिक्रिया पर निर्भर है । हालांकि, लाइम लाइम एक अपेक्षाकृत मामूली माइक्रोबियल बोझ के साथ जुड़ा हुआ है (< 50 जीवों/एमएल या प्लाज्मा) और क्षणिक spirochetemia, जो झूठी नकारात्मक परिणाम को जन्म दे सकता है25। क्लिनिक में इस तकनीक की संवेदनशीलता ऊतक प्रकार, संक्रमण की अवस्था, और नमूना स्थिति के आधार पर काफी भिन्न होता है, १२.५% और रक्त के मौजूदा अध्ययनों में ६२% के बीच गिरने, मस्तिष्कमेरु द्रव, और biopsied ऊतक३६. आणविक संवेदनशीलता सीमाएं चिंता का विषय नहीं हैं, तो पीसीआर बैक्टीरियल संस्कृति के लिए बाद में किया जाता है, लेकिन नैदानिक नमूनों से व्यवहार्य spirochetes की वसूली इसी तरह चुनौतीपूर्ण साबित कर दिया है । हाल ही में प्रोटोकॉल उच्च यील्ड३५के लिए ऑप्टिमाइज़ किया गया है । इस बीच, एक संक्रमित वयस्क टिक के आंत औसत पर कहीं भी २,००० से ५०,००० अरै३७,३८,३९, जो nPCR का पता लगाने की सीमा के भीतर ठोस है पर बंदरगाह कर सकते हैं । इस प्रकार, प्रोटोकॉल अच्छी तरह से निगरानी के प्रयासों को टिक करने के लिए अनुकूल है ।

इसके कई फायदे के बावजूद, nPCR कुछ चुनौतियों का सामना करता है, और इस तकनीक की क्षमता को सही ढंग से टिक संक्रमण रिपोर्ट इसलिए जीन और amplicons की रणनीतिक चयन पर निर्भर करता है, जटिल प्रयोगात्मक कार्यप्रवाह कि गुणवत्ता डीएनए की वसूली नमूनों से, जबकि नमूने के पार जोखिम को कम करने, और उचित नियंत्रण है कि प्रयोगशाला वातावरण और रिएजेंट में दूषित पदार्थों की रिपोर्ट कर सकते हैं का उपयोग करें. किसी भी प्रयोग से पहले, गुंजाइश और जांच के इरादे स्पष्ट रूप से परिभाषित किया जाना चाहिए ताकि उचित आनुवंशिक loci, और क्षेत्रों में, चुना जा सकता है । यदि उद्देश्य लाइम के लिए एक निष्पक्ष स्क्रीन प्रदान करने के लिए है-कारण अरै burgdorferi s.l. जटिल, प्राइमरों समान संबध और प्रवर्धन दक्षता के साथ संबद्ध उपभेदों के सभी का पता लगाने के लिए बनाया जाना चाहिए, असंबंधित कब्जा के बिना जीवों को25. नई प्राइमर डिजाइन और इस तरह के प्राइमर के रूप में सॉफ्टवेयर उपकरणों का उपयोग silico में मूल्यांकन किया जा सकता है-विस्फोट४०, हालांकि वे भी प्रयोग मानक संदर्भ के खिलाफ अलग से मांय किया जाना चाहिए से पहले विलक्षण नमूनों पर लागू किया जा रहा है । डीएनए निष्कर्षण प्रक्रिया का लक्ष्य एक मिश्रित पर्यावरणीय नमूना (टिक homogenate) से बरकरार माइक्रोबियल टेम्पलेट को ठीक करने के लिए है । पीसीआर के साथ आगे बढ़ने से पहले एक वैकल्पिक कदम के लिए निकाली डीएनए की अखंडता का मूल्यांकन है । इसके अतिरिक्त, समानांतर प्रतिक्रियाओं की स्थापना के लिए टिक में एक गृह व्यवस्था जीन लक्ष्य हो सकता है । उत्तरार्द्ध विधि भी प्रतिक्रिया मिश्रण में अवरोधकों की उपस्थिति का संकेत कर सकते हैं, बढ़ा विश्वास है कि नकारात्मक अरै प्रतिक्रियाओं जीव के अभाव के कारण कर रहे हैं, और एक निरोधात्मक contaminant की उपस्थिति के लिए नहीं प्रदान करते हैं ।

नेस्टेड पीसीआर दृष्टिकोण की वृद्धि की संवेदनशीलता संभावित संदूषण है कि झूठी सकारात्मक परिणाम उत्पंन की कीमत पर आता है । Exogenous टेम्पलेट टिक विच्छेदन और डीएनए वसूली के दौरान एक नमूने के लिए पेश किया जा सकता है, या बाहरी और भीतरी प्रवर्धन प्रतिक्रियाओं की स्थापना की प्रक्रिया में. इसलिए यह विशेष रूप से पीसीआर के लिए सबसे अच्छा अभ्यास प्रोटोकॉल का पालन करने के लिए टेंपलेट या amplicon पार संदूषण से बचने के महत्वपूर्ण है । इन स्वतंत्र airflows, पीसीआर और जैविक सुरक्षा अलमारियां जहां उपयुक्त, पूरी तरह से रासायनिक और शारीरिक सफाई और सतहों और रिएजेंट की नसबंदी, और डीएनए के सतर्क हैंडलिंग में रोकथाम के साथ अलग काम स्टेशनों के उपयोग में शामिल हैं ४१. No-टेम्पलेट नियंत्रण भी स्टॉक रिएजेंट के संदूषण की पहचान करने में महत्वपूर्ण हैं । nPCR की एक विशेष भेद्यता amplicon हैंडलिंग है कि जब दूसरी पीसीआर पोत में पहली प्रतिक्रिया के उत्पादों को स्थानांतरित होता है । लक्ष्य डीएनए के बाद से पहले से ही सकारात्मक नमूनों में घातीय संवर्धन आया है, यह कदम विशेष रूप से पार करने के लिए प्रवण है संदूषण, और एक एकल ट्यूब nPCR प्रोटोकॉल इस सीमा को दरकिनार करने के लिए विकसित किया गया है । इस दृष्टिकोण में, एक दिया जीन के लिए प्राइमरों के दोनों सेट एक प्रतिक्रिया ट्यूब है कि पीसीआर31के दोनों राउंड के लिए सील रहता है के लिए एक साथ जोड़ रहे हैं । बाहरी और भीतरी प्राइमर जोड़े, इस तरह के एक उच्च एनीलिंग तापमान है कि भीतरी प्राइमरों के लिए निषेध है पर टेम्पलेट को प्रवर्धित कि इस प्रकार के विशेष रूप से अलग किया जाना चाहिए । दूसरे दौर में, एनीलिंग तापमान आंतरिक जोड़ी को समायोजित करने के लिए कम है । न केवल इस बाईपास एक संभावित कदम है, यह भी अतिरिक्त विरोधी के उपयोग की अनुमति-प्रदूषित उपाय31,४२। हालांकि, इस संशोधन कुछ परख संवेदनशीलता बलिदान कर सकते हैं । दृष्टिकोण के बावजूद, तकनीकी दोहराने की संख्या में वृद्धि स्वतंत्र रूप से एक नमूने पर प्रदर्शन नकली संदूषण की पहचान करने में मदद मिलेगी ।

आणविक तकनीक nPCR की शुरूआत के बाद से विकसित करने के लिए जारी रखा है, और इन नए दृष्टिकोण मूल डिजाइन पर चुनिंदा लाभ प्रदान करते हैं, हालांकि वृद्धि की वित्तीय खर्च पर । जैसा कि नाम से पता चलता है, मात्रात्मक पीसीआर (qPCR या रीयल टाइम (RT)-पीसीआर) एक नमूने में रोगजनकों के गणन के लिए अनुमति देता है, जबकि पारंपरिक तकनीक प्रकृति में गुणात्मक४३। qPCR की संवेदनशीलता कथित तौर पर nPCR३८की है कि इसी तरह की है, हालांकि यह28प्राइमर विशेषताओं के आधार पर उतार चढ़ाव कर सकते हैं । पारंपरिक TaqMan जांचों के स्थान पर आणविक बीकन (एमबी) का उपयोग करने qPCR की भिन्नता का पता लगाने में भी वादा दिखाया गया है अरै नैदानिक नमूनों में४४,४५,४६. उनके अद्वितीय माध्यमिक संरचना के कारण, आणविक बीकन कथित तौर पर कम पृष्ठभूमि प्रतिदीप्ति और उच्च वैध संकेतों का उत्पादन, जिससे बेहतर संवेदनशीलता४७प्रदान । पूर्व नैदानिक मूल्यांकन एक और दस spirochetes४४,४५के बीच की एक संभावित पता लगाने की दहलीज सुझाव है । इसके अलावा, तकनीक सफलतापूर्वक मल्टीप्लेक्स प्रतिक्रियाओं में लागू किया गया है एक साथ एक स्तनधारी मेजबान जीन४४ और अंय टिक-जनित रोगजनकों४५है, जो nPCR के साथ के रूप में आसानी से प्राप्त नहीं है का पता लगाने के लिए । अंय डिजाइन संशोधनों छोटी बूंद डिजिटल पीसीआर (ddPCR) प्रौद्योगिकी, जो एक मानक वक्र३९,४८के उपयोग के बिना डीएनए यों तो कर सकते है शामिल हैं । अरै के लिए इस तकनीक का कम पता लगाने की सीमा इसी तरह के आसपास है दस spirochetes/३९नमूना । nPCR की तुलना में, इन दृष्टिकोण भी संदूषण के लिए कम क्षमता का लाभ है, के रूप में वे केवल एक प्रवर्धन प्रोटोकॉल की आवश्यकता है ।

यदि निगरानी के उद्देश्य के बजाय एक टिक के विभिंन बैक्टीरियल सामग्री प्रोफ़ाइल करने के लिए है, 16S rRNA metagenomic स्क्रीनिंग एक आकर्षक विकल्प४९है । हालांकि इस दृष्टिकोण महंगा है, विशेष डीएनए सभी आणविक जीव प्रयोगशालाओं में नहीं पाया sequencers की आवश्यकता है, और आवश्यक अधिक परिष्कृत bioinformatics आधारित व्याख्या, यह अधिक सही करने के लिए रोगाणुओं की एक व्यापक स्पेक्ट्रम पर कब्जा कर सकते हैं वेक्टर के रोगज़नक़ लोड का प्रतिनिधित्व करते हैं ।

जबकि qPCR और उसके डेरिवेटिव मात्रात्मक अनुप्रयोगों के लिए पसंद के तरीके हैं, और metagenomics स्क्रीन टिक microbiome की व्यापक सूची प्रदान करते हैं, लक्षित निगरानी प्रयासों अक्सर उपस्थिति या की अनुपस्थिति के बाइनरी रिपोर्टिंग के साथ संबंध हैं एक या एक सदिश में कुछ रोगजनकों । ऐसी परिस्थितियों में, इन नए, और अधिक विस्तृत दृष्टिकोण प्रक्रिया में अनावश्यक जटिलता और वित्तीय बोझ को लागू कर सकते हैं । इन कारणों के लिए, nPCR समय की कसौटी पर टिक परीक्षण में एक निर्णायक तकनीक के रूप में झेल है ।

Disclosures

लेखकों का खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

लेखकों को प्राइमर डिजाइन, एशले McKibbon और जेसिका थॉमस के लिए कमि हैरिस-Ebbett फिल्माने के लिए शुक्रिया अदा करना चाहते हैं, और जॉन ब्लेक, एलेक्जेंड्रा Foley-Eby, क्रिस लैंगली, जूली लुईस, Kelsey McIntyre, एशले McKibbon, क्रिस Zinck, और रोजी में दिखने के लिए कुत्ता वीडियो. ए. एम. के. ने कनाडाई लाइम रोग अनुसंधान फाउंडेशन का समर्थन किया था, और परियोजना के वित्तपोषण को प्राकृतिक विज्ञान और इंजीनियरिंग अनुसंधान परिषद कनाडा (NSERC) द्वारा प्रदान किया गया था । एम. के. बी. डब्ल्यू. ने न्यू ब्राउनश्विक इनोवेशन फाउंडेशन (NBIF) से वेतन अनुदान प्राप्त किया.

Materials

Name Company Catalog Number Comments
LabGard Class II, Type A2 biological safety cabinet Nuaire ES AIR NU-543 
Razor blades VWR 55411-050 0.22 mm thickness
Microfuge Tubes (Microtubes 1.5 mL) Axygen 311-08-051
AquaGenomic  MultiTarget Pharmaceuticals 2030 DNA extraction reagent
Microtube Pestle Diamed DIATEC610-1551 Designed for 1.5 ml tubes
Water bath - Isotemp 202 Fishse Scientific 15-462-2
Vortex Labnet S0100 CAN
Spectrafuge 24D Digital Microcentrifuge Labnet C2400
Isopropanol Sigma-Aldrich 190764
BIS-TRIS Sigma-Aldrich B9754
Primer Synthesis Sigma-Aldrich OLIGO
PCR Cabinet Misonix PCR6-482
PCR tube with attached flat caps 0.2mL VWR 20170-012
GoTaq Green Master Mix 2x Promega M7123
Nuclease-free water Promega M7123 The water comes with the GTG
Spectrafuge Mini Labnet C1301
SYBR Safe DNA Stain 10,000X Concentration EDVOTEK 608
Froggarose LE (Molecular Biology Grade Agarose) FroggaBio A87-500G
GD 100 bp DNA Ladder FroggaBio DM001-R500 
Electrophoresis power pack  VWR VWR 105 EC Apparatus Corporation
Fluor-S MultiImager  BioRad 170-7700 (Serial number 433B0154)
Quantity One 1-D Analysis Software (V. 4.5.2) BioRad 1709600

DOWNLOAD MATERIALS LIST

References

  1. Schotthoefer, A. M., Frost, H. M. Ecology and epidemiology of Lyme borreliosis. Clin. Lab. Med. 35, (4), 723-743 (2015).
  2. Franke, J., Hildebrandt, A., Dorn, W. Exploring gaps in our knowledge on Lyme borreliosis spirochaetes - Updates on complex heterogeneity, ecology, and pathogenicity. Ticks Tick Borne Dis. 4, (1-2), 11-25 (2013).
  3. Rudenko, N., Golovchenko, M., Vancova, M., Clark, K., Grubhoffer, L., Oliver, J. H. Jr Isolation of live Borrelia burgdorferi sensu lato spirochaetes from patients with undefined disorders and symptoms not typical for Lyme borreliosis. Clin. Microbiol. Infect. 22, (3), 267.e9-267.e15 (2016).
  4. Scott, J. D., Clark, K. L., Anderson, J. F., Foley, J. E., Young, M. R., Durden, L. A. Lyme Disease Bacterium, Borrelia burgdorferi Sensu Lato, Detected in Multiple Tick Species at Species at Kenora, Ontario, Canada. J Bacteriol Parasitol. 08, (01), 1-10 (2017).
  5. Sperling, J., Middelveen, M., Klein, D., Sperling, F. Evolving perspectives on lyme borreliosis in Canada. Open Neurol J. 6, 94-103 (2012).
  6. Pachner, A. R. Early disseminated Lyme disease: Lyme meningitis. Am. J. Med. 98, (Supplement 1), 30S-43S (1995).
  7. Mikkilä, H. O., Seppälä, I. J., Viljanen, M. K., Peltomaa, M. P., Karma, A. The expanding clinical spectrum of ocular lyme borreliosis. Ophthalmology. 107, (3), 581-587 (2000).
  8. Mc Causland, F. R., Niedermaier, S., Bijol, V., Rennke, H. G., Choi, M. E., Forman, J. P. Lyme disease-associated glomerulonephritis. Nephrol. Dial. Transplant. 26, (9), 3054-3056 (2011).
  9. Tunev, S. S., Hastey, C. J., Hodzic, E., Feng, S., Barthold, S. W., Baumgarth, N. Lymphoadenopathy during Lyme Borreliosis Is Caused by Spirochete Migration-Induced Specific B Cell Activation. PLoS Pathog. 7, (5), e1002066-e1002014 (2011).
  10. Kostić, T., et al. Manifestations of Lyme carditis. Int. J. Cardiol. 232, 24-32 (2017).
  11. Hinckley, A. F., et al. Lyme Disease Testing by Large Commercial Laboratories in the United States. Clin. Infect. Dis. 59, (5), 676-681 (2014).
  12. Nelson, C. A., et al. Incidence of Clinician-Diagnosed Lyme Disease, United States 2005-2010. Emerg. Infect. Dis. 21, (9), 1625-1631 (2015).
  13. Aucott, J. N., Rebman, A. W., Crowder, L. A., Kortte, K. B. Post-treatment Lyme disease syndrome symptomatology and the impact on life functioning: is there something here? Qual Life Res. 22, (1), 75-84 (2012).
  14. Aucott, J. N., Crowder, L. A., Kortte, K. B. Development of a foundation for a case definition of post-treatment Lyme disease syndrome. Int. J. Infect. Dis. 17, (6), e443-e449 (2013).
  15. Adrion, E. R., Aucott, J., Lemke, K. W., Weiner, J. P. Health care costs, utilization and patterns of care following Lyme disease. PLoS ONE. (2015).
  16. Cameron, D. J. Consequences of treatment delay in Lyme disease. Journal of Evaluation in Clinical Practice. 13, (3), 470-472 (2007).
  17. Johnson, L., Aylward, A., Stricker, R. B. Healthcare access and burden of care for patients with Lyme disease: a large United States survey. Health policy. 102, (1), 64-71 (2011).
  18. Motaleb, M. A., et al. Borrelia burgdorferi periplasmic flagella have both skeletal and motility functions. Proc. Natl. Acad. Sci. U.S.A. 97, (20), 10899-10904 (2000).
  19. Rosa, P. A., Tilly, K., Stewart, P. E. The burgeoning molecular genetics of the Lyme disease spirochaete. Nat. Rev. Microbiol. 3, (2), 129-143 (2005).
  20. Kenedy, M. R., Lenhart, T. R., Akins, D. R. The role of Borrelia burgdorferi outer surface proteins. FEMS Immunol. Med. Microbiol. 66, (1), 1-19 (2012).
  21. Persing, D. H., Telford, S. R., Spielman, A., Barthold, S. W. Detection of Borrelia burgdorferi infection in Ixodes dammini ticks with the polymerase chain reaction. J. Clin. Microbiol. 28, (3), 566-572 (1990).
  22. Persing, D. H., et al. Detection of Borrelia burgdorferi DNA in museum specimens of Ixodes dammini ticks. Science. 249, (4975), 1420-1423 (1990).
  23. Wise, D. J., Weaver, T. L. Detection of the Lyme disease bacterium, Borrelia burgdorferi, by using the polymerase chain reaction and a nonradioisotopic gene probe. J. Clin. Microbiol. 29, (7), 1523-1526 (1991).
  24. Johnson, B. J., Happ, C. M., Mayer, L. W., Piesman, J. Detection of Borrelia burgdorferi in ticks by species-specific amplification of the flagellin gene. Am. J. Trop. Med. Hyg. 47, (6), 730-741 (1992).
  25. Schmidt, B. L. PCR in laboratory diagnosis of human Borrelia burgdorferi infections. Clin. Microbiol. Rev. 10, (1), 185-201 (1997).
  26. Ogden, N. H., et al. Ixodes scapularis ticks collected by passive surveillance in Canada: analysis of geographic distribution and infection with Lyme borreliosis agent Borrelia burgdorferi. J. Med. Entomol. 43, (3), 600-609 (2006).
  27. Doern, G. V. Detection of selected fastidious bacteria. Clin. Infect. Dis. 30, (1), 166-173 (2000).
  28. Nolte, O. Nucleic Acid Amplification Based Diagnostic of Lyme (Neuro-)borreliosis - Lost in the Jungle of Methods, Targets, and Assays? Open Neurol J. 6, (1), 129-139 (2012).
  29. Wallich, R., Moter, S. E., Simon, M. M., Ebnet, K., Heiberger, A., Kramer, M. D. The Borrelia burgdorferi flagellum-associated 41-kilodalton antigen (flagellin): molecular cloning, expression, and amplification of the gene. Infect. Immun. 58, (6), 1711-1719 (1990).
  30. Picken, R. N. Polymerase chain reaction primers and probes derived from flagellin gene sequences for specific detection of the agents of Lyme disease and North American relapsing fever. J. Clin. Microbiol. 30, (1), 99-114 (1992).
  31. Picken, M. M., Picken, R. N., Han, D., Cheng, Y., Strle, F. Single-tube nested polymerase chain reaction assay based on flagellin gene sequences for detection ofBorrelia burgdorferi sensu lato. Eur. J. Clin. Microbiol. Infect. Dis. 15, (6), 489-498 (1996).
  32. Keirans, J. E., Litwak, T. R. Pictorial key to the adults of hard ticks, family Ixodidae (Ixodida: Ixodoidea), east of the Mississippi River. J. Med. Entomol. 26, (5), 435-448 (1989).
  33. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J Vis Exp. (63), e3998 (2012).
  34. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose Gel Electrophoresis for the Separation of DNA Fragments. J Vis Exp. (62), e3923 (2012).
  35. Sapi, E., Pabbati, N., Datar, A., Davies, E. M., Rattelle, A., Kuo, B. A. Improved culture conditions for the growth and detection of Borrelia from human serum. Int J Med Sci. 10, (4), 362-376 (2013).
  36. Waddell, L. A., Greig, J., Mascarenhas, M., Harding, S., Lindsay, R., Ogden, N. The Accuracy of Diagnostic Tests for Lyme Disease in Humans, A Systematic Review and Meta-Analysis of North American Research. PLoS ONE. 11, (12), e0168613-e0168623 (2016).
  37. Brunet, L. R., Spielman, A., Telford, S. R. III Density of Lyme disease spirochetes within deer ticks collected from zoonotic sites. Am. J. Trop. Med. Hyg. 53, (3), 300-302 (1995).
  38. Wang, G., et al. Real-time PCR for simultaneous detection and quantification of Borrelia burgdorferi in field-collected Ixodes scapularis ticks from the Northeastern United States. Appl. Environ. Microbiol. 69, (8), 4561-4565 (2003).
  39. King, J. L., Smith, A. D., Mitchell, E. A., Allen, M. S. Validation of droplet digital PCR for the detection and absolute quantification of Borrelia DNA in Ixodes scapularis ticks. Parasitology. 144, (4), 359-367 (2017).
  40. Ye, J., Coulouris, G., Zaretskaya, I., Cutcutache, I., Rozen, S., Madden, T. L. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 13, (1), 134 (2012).
  41. Kwok, S., Higuchi, R. Avoiding false positives with PCR. Nature. 339, (6221), 237-238 (1989).
  42. Rys, P. N., Persing, D. H. Preventing false positives: quantitative evaluation of three protocols for inactivation of polymerase chain reaction amplification products. J. Clin. Microbiol. 31, (9), 2356-2360 (1993).
  43. Pahl, A., Kühlbrandt, U., Brune, K., Röllinghoff, M., Gessner, A. Quantitative detection of Borrelia burgdorferi by real-time PCR. J. Clin. Microbiol. 37, (6), 1958-1963 (1999).
  44. Saidac, D. S., Marras, S. A. E., Parveen, N. Detection and quantification of Lyme spirochetes using sensitive and specific molecular beacon probes. BMC Microbiol. 9, (1), 43 (2009).
  45. Chan, K., Marras, S. A. E., Parveen, N. Sensitive multiplex PCR assay to differentiate Lyme spirochetes and emerging pathogens Anaplasma phagocytophilum and Babesia microti. BMC Microbiol. 13, (1), 295 (2013).
  46. Schlachter, S., Chan, K., Marras, S. A. E., Parveen, N. Detection and Differentiation of Lyme Spirochetes and Other Tick-Borne Pathogens from Blood Using Real-Time PCR with Molecular Beacons. Methods Mol. Biol. 1616, 155-170 (2017).
  47. Wang, L., Blasic, J. R. Jr, Holden, M. J., Pires, R. Sensitivity comparison of real-time PCR probe designs on a model DNA plasmid. Anal. Biochem. 344, (2), 257-265 (2005).
  48. Sze, M. A., Abbasi, M., Hogg, J. C., Sin, D. D. A Comparison between Droplet Digital and Quantitative PCR in the Analysis of Bacterial 16S Load in Lung Tissue Samples from Control and COPD GOLD 2. PLos ONE. 9, (10), e110351-e110356 (2014).
  49. Sperling, J. L., et al. Comparison of bacterial 16S rRNA variable regions for microbiome surveys of ticks. Ticks Tick Borne Dis. 1-9 (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics