Author Produced

Detectar el Spirochete de la enfermedad de Lyme, Burgdorferi de Borrelia, de garrapatas mediante PCR anidado

Biology
 

Summary

PCR anidada es una técnica sensible, específica y directa que se puede aplicar a garrapata que extractos de ADN para sonda de burgdorferi de Borrelia, el agente causativo de la enfermedad de Lyme. El experimento inicial de PCR utiliza cartillas gene-específicas para generar amplicones de largo, que luego se convierten en plantillas para una posterior reacción usando cebadores internos.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Wills, M. K., Kirby, A. M., Lloyd, V. K. Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR. J. Vis. Exp. (132), e56471, doi:10.3791/56471 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La enfermedad de Lyme es una infección grave transmitida por vectores que es causada por la Borrelia burgdorferi sensu lato familia de las espiroquetas, que son transmitidos a los seres humanos a través de la picadura de garrapatas Ixodes infectadas. El agente etiológico primario en América del norte es stricto del sensu del burgdorferi del Borrelia . Como amplían las regiones geográficas de riesgo, es prudente apoyar los programas de vigilancia robusta que pueden medir las tasas de infección de la garrapata y comunicar los resultados a los médicos, veterinarios y público en general. La técnica molecular de reacción en cadena jerarquizada de polimerasa (nPCR) ha sido utilizada para este propósito, y sigue siendo un enfoque central, barato y robusto en la detección de Borrelia en garrapatas y vida silvestre.

Este artículo demuestra la aplicación de nPCR en extractos de ADN para identificar los ejemplares infectados de la señal. Independiente dos objetivos de B. burgdorferi , genes de codificación B flagelina (michelines) y exterior superficie proteína A (OspA), se han utilizado ampliamente con esta técnica. El protocolo trata de colección de la marca, la extracción de ADN y luego una ronda inicial de la PCR para detectar cada uno de los dos Borrelia-loci específicos. Reacción en cadena subsecuente de la polimerasa (PCR) utiliza el producto de la primera reacción como una nueva plantilla para generar fragmentos de amplificación más pequeño e interno. El enfoque anidado mejora la especificidad y la sensibilidad de la PCR convencional. Una garrapata se considera positiva para el patógeno cuando amplicones de interior de ambos genes de Borrelia pueden ser detectada por electroforesis en gel de agarosa.

Introduction

La enfermedad de Lyme (LD) es la infección transmitida por vectores más frecuente en el hemisferio norte, y su incidencia sigue aumentando1. Esta enfermedad debilitante es causada por patógenos spirocheteal de la borreliosis de Lyme (LB) complejo (comúnmente referido como Borrelia burgdorferi sensu lato, s.l.), que comprende históricamente el patógeno predominante de América del norte, B. burgdorferi sensu stricto (s.s), además de B. afzelii y B. garinii, que están extendidos por toda Europa y Asia y son especies de emergente importancia clínica2,3. Estas bacterias se transmiten a los seres humanos a través de la picadura de infectado Ixodes garrapatas2. Aunque los vectores principales de América del norte son I. scapularis e I. pacificus, múltiples especies dentro de este género se han encontrado para abrigar y transmitir la bacteria4. En los seres humanos, B. burgdorferi puede causar síntomas del multisistema que afectan a la piel, articulaciones, corazón, sistema nervioso, glándulas endocrinas, aparato gastrointestinal y órganos internos5,6,7, 8,9,10. Actualmente, el centro de Control y prevención de enfermedades calcula más de 300.000 nuevos casos humanos anuales en los Estados Unidos11,12. Mientras que el pronóstico suele ser favorable cuando la enfermedad es diagnosticada y tratada en las primeras etapas, los estudios han sugerido en cualquier lugar entre 10% y el 60% de los pacientes que recibieron el régimen antibiótico recomendado continuado sufriendo síntomas después de terapia cesación, en un fenómeno había denominado síndrome de la enfermedad de Lyme de Post tratamiento (PTLDS)13,14,15. Por otra parte, retrasos en la intervención clínica pueden presentarse como resultado de la falta de conciencia de una picadura de garrapata, la presentación no específica de la enfermedad inicial y la baja sensibilidad del diagnóstico basado en la serología tradicional cuando se utiliza en el inicio de la infección. Si no se tratan rápida y adecuadamente permite la progresión de síntomas que puede manifestar en cada vez más debilitantes complicaciones16,17. Prevención de la enfermedad de Lyme es una piedra angular de la gestión del riesgo. Estrategias para combatir esta creciente amenaza incluyen medidas de vigilancia sólido para indicar que la prevalencia del patógeno en las garrapatas e identifican las regiones geográficas de interés.

Este artículo demuestra la utilidad de la reacción en cadena jerarquizada de polimerasa (nPCR) como una herramienta de detección molecular mediante el cual se identifican las garrapatas infectadas. Para aumentar la especificidad, dos genes de Borrelia se utilizan para la amplificación de paralelo. B de flagelina (FlaB) codifica una proteína de gran filamento del flagelo18, y el gen se encuentra en el único cromosoma lineal, mientras que el producto de la lipoproteína de exterior superficie proteína A (OspA) media del midgut de la garrapata colonización, y es codificada por el plásmido19,20. El flujo de trabajo consiste en colección de garrapata, la extracción de ADN y luego una ronda inicial de la PCR para detectar Borrelia-loci específicos. Posterior PCR utiliza el producto de la primera reacción como una nueva plantilla para generar fragmentos de amplificación más pequeño e interno. Una garrapata se considera positiva para Borrelia burgdorferi cuando amplicones de interior de ambos genes de Borrelia pueden ser detectada por electroforesis en gel de agarosa.

La técnica de nPCR y FlaB y objetivos de gen OspA , han sido ampliamente utilizados para la vigilancia ecológica y detección clínica de la espiroqueta de Lyme desde principios del decenio de 199021,22,23 ,24,25. Antes del desarrollo de protocolos moleculares, las garrapatas fueron evaluadas al someter contenido estomacal a anti -Borrelia inmunofluorescencia (IF) de tinción, cultivo microbiano o una combinación de éstos26. Estos enfoques adolecen de limitaciones inherentes, incluyendo el crecimiento lento y la naturaleza fastidiosa de Borrelia27problemas de performance de anticuerpo y el requisito de garrapatas vivo IF proceso21. PCR fue posteriormente adoptado para identificación rápida, sensible y específico de vectores infectados. Ofreció mejoras marcadas en la metodología tradicional, incluyendo la aplicación directa de la cultura-independiente a tipos de muestras diversas, como las garrapatas muertas y archivados que serían inadecuadas para la prueba de21,22 . Diseños experimentales anidados más lejos mejoran la especificidad y sensibilidad de la PCR clásica empleando dos conjuntos distintos de cartillas gene-específicas en dos rondas consecutivas de amplificación25,28.

Éxito experimental es críticamente dependiente de diseño selección y productos estratégicos gene. Para estimar con precisión la presencia de Borrelia burgdorferi, cartillas deberán detectar los patógenos pertinentes sin antigénico con la espiroqueta de la fiebre recurrente también en el género Borrelia . En el caso del FlaB, esta especificidad se logra apuntando a una región interna variable del gen, en lugar de las secuencias flanqueantes relativamente conservadas que son compartidas por diversas bacterias (figura 1)24,29 , 30.

Figure 1
Figura 1: el concepto de nPCR, tal como se ilustra usando Borrelia FlaB gene como objetivo. El termini de 5' y 3' del gen es comunes a los organismos más allá de burgdorferi de Borrelia s.l., representación de estas regiones no aptos para la evaluación específica de los agentes patógenos causantes de Lyme. Usando las secuencias interiores conservan menos como objetivos de la cartilla, se ejecutan dos rondas de PCR para detectar un amplicon final, interna. Haga clic aquí para ver una versión más grande de esta figura.

En una prueba de su capacidad discriminatoria, interior FlaB cartillas fueron evaluadas con más de 80 diferentes cepas de Borrelia y encontró a identificar sólo aquellos asociados con la enfermedad de Lyme24. El límite inferior de detección de nPCR se ha documentado en entre seis24 y diez31 bacterias de cultivo puro, aunque la sensibilidad puede mejorarse por borrar el amplicon sur y cruza por hibridación una radiomarcados o sonda quimioluminiscente. Las técnicas de acoplamiento reduce el umbral de detección a un spirochete solo31. Por comparación directa, PCR solo redondo convencional, unprobed fue encontrado para informar de la presencia de un mínimo de 104 espiroquetas31. Sin embargo, cabe señalar que la sensibilidad del ensayo será menor cuando se trabaja con muestras ambientales y clínicas complejas, debido a la abrumadora presencia de ADN no relacionado y posibles sustancias inhibidoras. Estos desafíos pueden eludirse en gran parte por el uso de nPCR.

A pesar de avances en las tecnologías moleculares en las últimas décadas, nPCR sigue siendo una técnica básica en esfuerzos de vigilancia moderna. Si se tiene cuidado en el diseño y ejecución de este protocolo, es un enfoque potente, adaptable y relativamente sencillo para capturar la presencia de patógenos en vectores de garrapatas.

Protocol

1. ADN aislado de las garrapatas

  1. Adquirir las garrapatas mediante colección de campo, o vigilancia pasiva de veterinarios y miembros del público. Garrapatas deben matadas congelando, colocadas en una bolsa sellada y enviadas a temperatura ambiente.
    1. Utilizando un formulario de presentación, recabar información sobre la fecha y la ubicación geográfica del encuentro, estado del accesorio de garrapata, especie e historia de viaje reciente de la hostia.
    2. Puesto que la polimerización en cadena jerarquizada es intrínsecamente vulnerable a la contaminación, asegúrese de que está configurado el espacio de trabajo de laboratorio para minimizar la Cruz-exposición de muestras. Esto implica ejecutar diferentes elementos del protocolo en espacios separados, dedicados bien aislados entre sí completamente limpiados y esterilizados, y asegurando que todos los instrumentos son libres de contaminantes.
    3. Al recibir a la muestra, fotografiar los ticks y determinar la especie, etapa de desarrollo, sexo y estado de ingurgitación en comparación a una identificación dominante32 .
    4. Bajo condiciones asépticas, biseca la garrapata con una hoja de afeitar estéril o bisturí y colocar los fragmentos de dos garrapatas en tubos de microcentrífuga separado.
  2. Para extraer el ADN total, utilizar cualquier procedimiento de aislamiento que produce la plantilla compatible con PCR; Este protocolo muestra una sencilla estrategia basada en la quelación.
    1. Comenzar agregando un volumen apropiado (a menudo entre los 50-200 μL) de un reactivo lítico quelación al fragmento de garrapata. El monto específico dependerá de la condición ejemplar de tamaño y congestión; directrices deben ser provistas por el fabricante. Homogeneizar con un mortero de microtubo.
    2. Incubar las muestras en un baño de agua a 60 ° C durante 45 minutos y agitar brevemente.
    3. Centrifugar las muestras durante 4 minutos a 16.276 x g (13.300 rpm) en una microcentrífuga de sobremesa.
    4. Transferir el sobrenadante a un microtubo fresco, rotulado conteniendo 50 de μl isopropanol, mezclar por inversión y volver a centrifugar como en (1.2.3).
    5. Decantar el sobrenadante y lavar el pellet de ADN con 50 μl de etanol al 70%.
    6. Quitar exceso etanol con una pipeta y permiten la pelotilla airear por 15 min a temperatura ambiente.
    7. Para Resuspender el ADN, añada 50 μl de 1 mM de Tris de pH 7.0 e incubar las muestras en un baño de agua durante 1 h a 60 ° C. Ahora, el ADN puede almacenarse a-20 ° C para futuros análisis molecular.

2. nested PCR detección de Borrelia OspA y FlaB.

Nota: Se proporciona un resumen general PCR principios y prácticas de Lorenz, 201233.

  1. Sintetizar u obtener cartillas de gene-específicas del oligonucleótido exterior e interior de Borrelia . Vea la tabla 1 para primer conjuntos, sus respectivos productos tamaños y temperatura de fusión.
Primer nombre Objetivo gene Secuencia (5' - 3') Tamaño de amplicón Temperatura de recocido
FlaB a Fw FlaB gcatcactttcagggtctca 503 bp 55° C
FlaB a Rv FlaB tggggaacttgattagcctg
FlaB en Fw FlaB ctttaagagttcatgttggag 447 bp 58° C
FlaB en Rv FlaB tcattgccattgcagattgt
OspA a Fw OspA cttgaagttttcaaagaagat 487 bp 55° C
OspA fuera Rv OspA caactgctgacccctctaat
OspA en Fw OspA acaagagcagacggaaccag 350 bp 58° C
OspA en Rv OspA ttggtgccatttgagtcgta

Tabla 1: Cartillas interiores y exteriores para nPCR de Borrelia burgdorferiFlaB y OspA.
En la práctica, los iniciadores del FlaB detectan B. burgdorferi s.s. y otros estrechamente relacionados genospecies de Borrelia , mientras OspA cartillas capturan sólo B. burgdorferi s.s. amplificación de ambos loci indicaría B. burgdorferi. s.s.

  1. Esterilizar previamente un gabinete PCR con UV luz y 70% etanol.
    Nota: Para minimizar la potencial contaminación de las muestras, este espacio de trabajo debe ser distinto de la localización de la disección de la garrapata, la extracción de ADN y electrophoresis del gel.
    1. Para el funcionamiento inicial de la PCR, utilizar los iniciadores externos junto con la plantilla de ADN recuperado en el paso 1.0 anterior y establece la mezcla de reacción según se describe en la tabla 2. En paralelo, realizar positivos control funciona de verificado Borrelia DNA y control negativo funciona incluyendo reacciones no-plantilla para detectar contaminación del reactivo y el aerosol. Añadir ADN al final para minimizar la contaminación potencial de los reactivos. Asegurar que cada tubo está cerrado en todo momento cuando los reactivos no se agregan y cerrar tubos inmediatamente después de la adición de ADN y antes de que se abran otros tubos.
    2. Un termociclador de programa como sigue: 95 ° C por 5 min; 40 ciclos de 95 ° C por 15 s, recocido temperatura por 30 s, 72 ° C por 45 s; 72 ° C por 5 min; y mantener a 4 ° C.
  2. Realizar la segunda ronda de PCR similar a la primera reacción, excepto utilizar imprimaciones interiores con 2 μl del producto PCR primer (producido en 2.2.2).
    Nota: Los volúmenes de reacción otra vez son proporcionados en la tabla 2. Debe tenerse cuidado para evitar la contaminación con amplicones que DNA de la plantilla se agrega último y que solamente los tubos correspondientes a una muestra están abiertos a la vez.
     
    Componente Volúmenes PCR # 1 Polimerización en cadena # 2 volúmenes
    Taq polimerasa Master Mix 2 X 12.5 ΜL 12.5 ΜL
    Agua libre de nucleasas 8,5 ΜL 8,5 ΜL
    10 μm cartillas de avance y retroceso 1,0 μL iniciadores exterior Cartillas interior 1,0 μL
    Plantilla de la DNA 2.0 μL, de la extracción de la muestra (1.2.7) 2.0 μL, 1 ronda de PCR (2.2.2)
    Tabla 2: Mezclas de reacción de PCR para amplificaciones primeras y segunda.
     
    1. Programar al termociclador como antes, pero ajustar la temperatura de recocido para acomodar los cebadores internos (véase cuadro 1).

3. proyección de imagen y electroforesis en Gel de agarosa

Nota: Para instrucciones básicas de separación de ADN por electroforesis, ver Lee et al., 201234.

  1. Preparar un gel de agarosa al 1.2% con buffer de SB X 20 0.2 M NaOH, 0,8 M ácido bórico pH 8, diluido al 1 X y añadir aproximadamente 5 μl de una tinción de ADN, antes de verter, si se desea la tinción del gel.
  2. Cargar 10 μl del producto de la segunda reacción de PCR (interna) de cada uno experimental y la muestra de control, junto a una escalera de bp 100 (5 μl).
    1. Electrophorese por 1 h a 107 V (5V/cm).
  3. Vista y documento el gel utilizando un transiluminador y asociados de la cámara y el software.

Representative Results

nPCR es un enfoque elegante para aumentar la especificidad y la sensibilidad de detección de patógenos, sobre todo cuando muestras ambientales complejas están bajo investigación. Como se muestra en la figura 1, dos rondas de PCR dirigidos a una región estratégica de la Borrelia FlaB locus (y OspA, no en la foto) pueden reportar la presencia de la bacteria Borrelia burgdorferi mediante la generación de corto interno amplicones. Cuando resolvieron por electroforesis en gel, los productos de reacción FlaB y OspA de cada señal pueden ser visualmente anotó y Comparado con controles. En la figura 2, identificadores de ejemplar único se proporcionan a lo largo de la parte superior de cada gel y controles no-plantilla y aerosol están representados a la izquierda y derecha, respectivamente, junto a las escaleras.

Sólido amplicón bandas son claramente visibles en seleccionadas muestras experimentales, y se distinguen fácilmente de cartillas sobrantes y ADN residual (figura 2). Basado en los principios de diseño experimental establecidos, una garrapata se considera positiva para Borrelia cuando paralelo controles negativos no demuestran amplificación, y amplicones internos se producen de cartillas FlaB y OspA . En este caso, muestras T907 T604 y T606 cumplieron los criterios de vigilancia para el patógeno de Lyme (figura 2). By Contrast, T923 sólo era positivo para la OspA, un resultado que hay varias posibles explicaciones: A) la señal de origen era negativa para Borrelia, pero la preparación interior o exterior de la OspA PCR cifra estaba contaminada con ADN de plantilla (nota que contaminación sistémica de los reactivos fue eliminada mediante controles negativos), B) la garrapata lleva a Lyme Borrelia, pero cantidades bajas de la plantilla o error experimental previno amplificación del FlaB, o C) un organismo estuvo presente contiene la secuencia conservada de la OspA , pero carecía de flagelina o tenía identidad insuficiente en la región específica del FlaB a templar a los iniciadores. De hecho, las similitudes de secuencia OspA se han observado en una variedad de organismos, incluyendo animales y plantas28. La situación de converse, la amplificación de más conserva el gen de la flagelina , pero no el gen OspA , podría indicar una especie relacionada de Borrelia . En la práctica, este protocolo rinde más los resultados positivos solo de la OspA de los iniciadores del FlaB , sugiriendo que el escenario 'A' es la explicación menos probable de hacer. Sin más análisis experimental de la muestra discutible, sin embargo, no es posible determinar la fuente del resultado positivo solo. Aumentar el número de repeticiones técnicas en muestras ambiguas puede ayudar a reconciliar su estado verdadero, ya que cualquier contaminante que cifra se introdujeron a las reacciones anteriores no estaría presente en el ADN archivado. Sin embargo, si las reacciones posteriores con estos iniciadores no proporcionan resultados concluyentes, otros loci de Borrelia podían ser investigados por PCR. Amplicones generados a partir de estas reacciones también podrían ordenados y comparados entre aislamientos para ayudar a asignar identidad y estimar el grado de divergencia de la tensión. SAPI y sus colegas proporcionan un ejemplo de este flujo de trabajo utilizando muestras clínicas humanas35.

Todos los factores considerados, los criterios de protocolo e interpretación se han estimado a producir falsos positivas y falsas negativas tasas de 0.17% y 0.0063%, respectivamente.

Figure 2
Figura 2 : Detección de Borrelia burgdorferi en garrapatas individuales por nPCR de FlaB y OspA. Códigos asignados a cada tick se representan en la parte superior de los geles y las identidades alinean verticalmente para reportar la detección de la OspA y michelines en cada muestra. Carriles derecho B a la izquierda de las imagen representan plantilla no los controles, mientras que un (carriles de mano derecha) son controles de aerosol para capturar la contaminación del medio ambiente de laboratorio. Haga clic aquí para ver una versión más grande de esta figura.

Discussion

Décadas de uso, técnicas basadas en PCR han demostrado ser constantemente su valor en la detección de Borrelia de muestras de artrópodos y mamíferas, si Borrelia provienen de origen clínico o ambiental. PCR ofrece muchas mejoras sobre enfoques existentes para la vigilancia. En particular, no es dependiente en el desarrollo y rendimiento de los reactivos de anticuerpos y en su lugar puede ser fácilmente adaptado para detectar nuevos objetivos de interés simplemente modificando secuencias de la cartilla. PCR también tiene capacidad para la evaluación de múltiples loci en paralelo, ya sea independientemente o a través de una reacción multiplex. Puede ser aplicado a las entradas de diversas muestras, incluyendo garrapatas fresco y archivados22, animal o humanos fluidos corporales y tejido resecado25. PCR también rinde amplicones que pueden ser procesados, por ejemplo por enzima de la restricción digestión, sonda hibridación o secuenciación, para proporcionar la mayor penetración en la identidad microbiana21.

Como una herramienta clínica, la PCR es expresiones preferible para el diagnóstico serológico estándar, ya que proporciona una indicación directa de presencia bacteriana, en lugar de confiar en la respuesta inmune del huésped como medida secundaria de la infección. Sin embargo, borreliosis de Lyme se asocia con una carga microbiana relativamente modesta (< 50 organismos/mL de orina o plasma) y25spirochetemia transitoria, que puede dar lugar a falsos negativos. La sensibilidad de esta técnica en la clínica varía considerablemente dependiendo del tipo de tejido, etapa de la infección y la condición de la muestra, comprendida entre 12,5% y 62% en los estudios de sangre, líquido cefalorraquídeo y tejido hecho una biopsia36. Limitaciones de sensibilidad molecular no son una preocupación si PCR se lleva a cabo con posterioridad a la cultura bacteriana, sin embargo la recuperación de la espiroqueta viable de especímenes clínicos se ha demostrado igualmente desafiante. Sólo recientemente se han optimizado los protocolos para mayor rendimiento35. Mientras tanto, la tripa de una garrapata adulta infectada puede albergar en promedio en cualquier lugar de 2.000 a más de 50.000 Borrelia37,38,39, que es firmemente dentro de la gama de detección de nPCR. Así, el protocolo es idóneo para esfuerzos de vigilancia de la garrapata.

A pesar de sus muchas ventajas, nPCR plantean ciertos retos y la capacidad de esta técnica para informar con precisión infección de garrapata por lo tanto depende de la estratégica selección de genes y amplicones, flujos de trabajo experimentales meticuloso que recuperan ADN de calidad de especímenes y reducir al mínimo la Cruz-exposición de muestras y el uso de los controles adecuados que pueden contaminantes en el ambiente de laboratorio y reactivos. Antes de cualquier experimentación, el alcance y la intención de la investigación debe definirse claramente para que lugares geométricos genéticos apropiados y regiones, se pueden seleccionar. Si el objetivo es proporcionar una pantalla imparcial para los causantes de Lyme burgdorferi de Borrelia s.l. complejo, imprimaciones deben crearse para detectar todas las cepas asociadas con similar afinidad y eficiencia de amplificación, sin capturarlos sin relación organismos25. Nuevas cartillas pueden ser diseñadas y evaluado en silico utilizando herramientas de software como el Primer chorro40, aunque también debe ser validados experimentalmente contra referencia estándar aislantes antes de ser aplicados a muestras no caracterizadas. El procedimiento de extracción de ADN pretende recuperar intacto plantilla microbiana de una muestra ambiental mixta (homogeneizado de garrapata). Un paso opcional antes de proceder con la PCR es evaluar la integridad del ADN extraído. Además, se podrían configurar reacciones paralelas a un gen de la limpieza en la señal de destino. Este último método también puede indicar la presencia de inhibidores en la mezcla de reacción, proporcionando mayor confianza que las reacciones negativas de Borrelia son debido a la ausencia del organismo y no a la presencia de un inhibidor de contaminantes.

El aumento de la sensibilidad de la estrategia PCR anidada viene a expensas de la posible contaminación que genera resultados falsos positivos. Plantilla de exógeno podría introducirse a una muestra durante la disección de la garrapata y la recuperación de ADN, o en el proceso de creación de las reacciones de amplificación externa e interna. Por lo tanto es especialmente importante seguir mejores protocolos de práctica para PCR evitar la plantilla o amplicones contaminación cruzada. Estos incluyen el uso de estaciones de trabajo separadas con corrientes de aire independiente, contención en PCR y gabinetes de seguridad biológica en su caso, cuidadosa química física limpieza y esterilización de superficies y reactivos y prudente manejo de ADN 41. No-plantilla controles también son vitales en la identificación de contaminación de los reactivos comunes. Una vulnerabilidad particular de nPCR es el amplicon manipulación que se produce al transferir los productos de la primera reacción en el segundo recipiente de polimerización en cadena. Puesto que el ADN diana ya ha sufrido enriquecimiento exponencial en las muestras positivas, este paso es especialmente propenso a la contaminación cruzada, y se ha desarrollado un protocolo del solo-tubo nPCR para sortear esta limitación. En este enfoque, ambos juegos de cebadores para un gen dado se suman a un tubo de reacción que queda sellado para dos rondas de PCR31. Los pares de imprimación interior y exterior deben ser termodinámicamente distintos, tal que el par externo amplifica la plantilla a una alta temperatura de recocido que es prohibitiva para los cebadores internos. En la segunda vuelta, se baja la temperatura de recocido para acomodar al par interno. No sólo hace de este puente un paso potencialmente confusión, también permite el uso de más medidas de lucha contra la contaminación de31,42. Sin embargo, esta modificación puede sacrificar cierta sensibilidad del ensayo. Independientemente del enfoque, aumentando el número de repeticiones técnicas realizado independientemente en una muestra le ayudará a identificar contaminación espuria.

Técnicas moleculares han continuado evolucionando desde la introducción del nPCR y estos enfoques más recientes ofrecen seleccionarlos ventajas sobre los diseños originales, aunque en mayor gastos financieros. Como su nombre indica, PCR cuantitativa (qPCR o real tiempo (RT)-PCR) permite la enumeración de patógenos en una muestra, mientras que las técnicas convencionales son cualitativas en naturaleza43. La sensibilidad de qPCR es presuntamente similar a la de nPCR38, aunque puede variar dependiendo de la imprimación de características28. Una variación de qPCR que utiliza balizas moleculares (MB) en lugar de sondas TaqMan convencionales también ha demostrado promesa en la detección de Borrelia en muestras clínicas44,45,46. Debido a su estructura secundaria única, moleculares beacons al parecer producen fluorescencia del fondo inferior y superiores señales legítimas, proporcionando así una sensibilidad superior47. Evaluaciones preclínicas sugieren un potencial umbral de detección de entre uno y diez las espiroquetas44,45. Por otra parte, la técnica se ha aplicado con éxito en reacciones multiplexores para detectar simultáneamente un huésped mamífero gen44 y otros patógenos tick-borne45, que no es fácilmente alcanzable con nPCR. Otras modificaciones en el diseño incluyen gota PCR (ddPCR) la tecnología digital, que puede cuantificar ADN sin el uso de una curva estándar39,48. El límite inferior de detección de esta técnica para Borrelia es además alrededor de diez muestra espiroquetas39. En comparación con nPCR, estos enfoques también tienen la ventaja de reducido potencial para la contaminación, ya que sólo requieren un protocolo de amplificación individuales.

Si el objetivo de la vigilancia es en lugar de otro perfil el contenido bacteriano variado de una garrapata, 16S rRNA metagenómica es un atractivo49. Aunque este enfoque es más costoso, requiere especializados secuenciadores de ADN que no se encuentra en todos los laboratorios de biología molecular y exige una interpretación más sofisticada basada en la bioinformática, puede capturar un amplio espectro de microbios más exactamente representa la carga del patógeno del vector.

QPCR y sus derivados son métodos de elección para aplicaciones cuantitativas y metagenómica pantallas proporcionan amplios inventarios del microbioma de la garrapata, esfuerzos de vigilancia específica a menudo se refieren a información binaria de la presencia o ausencia de uno o varios patógenos en un vector. Bajo tales circunstancias, estos enfoques nuevos y más elaborados pueden introducir complejidad innecesaria y carga financiera en el proceso. Por estas razones, nPCR ha resistido la prueba del tiempo como una técnica fundamental en señal de prueba.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Los autores desean dar las gracias a Kami Harris para el primer diseño, Ashley McKibbon y Jessica Thomas-Ebbett para rodaje, John Blakely, Alexandra Foley-Eby, Chris Langley, Julie Lewis, Kelsey McIntyre, Ashley McKibbon, Chris Zinck y Rosie el perro que aparece en la video. A. M. K. fue apoyado por la Fundación Canadiense de investigación de la enfermedad de Lyme, y financiación del proyecto fue proporcionada por las ciencias naturales e Ingeniería investigación Consejo de Canadá (NSERC). M. K. B. W. había recibido sueldo fondos de la Fundación de innovación de Nuevo Brunswick (NBIF).

Materials

Name Company Catalog Number Comments
LabGard Class II, Type A2 biological safety cabinet Nuaire ES AIR NU-543 
Razor blades VWR 55411-050 0.22 mm thickness
Microfuge Tubes (Microtubes 1.5 mL) Axygen 311-08-051
AquaGenomic  MultiTarget Pharmaceuticals 2030 DNA extraction reagent
Microtube Pestle Diamed DIATEC610-1551 Designed for 1.5 ml tubes
Water bath - Isotemp 202 Fishse Scientific 15-462-2
Vortex Labnet S0100 CAN
Spectrafuge 24D Digital Microcentrifuge Labnet C2400
Isopropanol Sigma-Aldrich 190764
BIS-TRIS Sigma-Aldrich B9754
Primer Synthesis Sigma-Aldrich OLIGO
PCR Cabinet Misonix PCR6-482
PCR tube with attached flat caps 0.2mL VWR 20170-012
GoTaq Green Master Mix 2x Promega M7123
Nuclease-free water Promega M7123 The water comes with the GTG
Spectrafuge Mini Labnet C1301
SYBR Safe DNA Stain 10,000X Concentration EDVOTEK 608
Froggarose LE (Molecular Biology Grade Agarose) FroggaBio A87-500G
GD 100 bp DNA Ladder FroggaBio DM001-R500 
Electrophoresis power pack  VWR VWR 105 EC Apparatus Corporation
Fluor-S MultiImager  BioRad 170-7700 (Serial number 433B0154)
Quantity One 1-D Analysis Software (V. 4.5.2) BioRad 1709600

DOWNLOAD MATERIALS LIST

References

  1. Schotthoefer, A. M., Frost, H. M. Ecology and epidemiology of Lyme borreliosis. Clin. Lab. Med. 35, (4), 723-743 (2015).
  2. Franke, J., Hildebrandt, A., Dorn, W. Exploring gaps in our knowledge on Lyme borreliosis spirochaetes - Updates on complex heterogeneity, ecology, and pathogenicity. Ticks Tick Borne Dis. 4, (1-2), 11-25 (2013).
  3. Rudenko, N., Golovchenko, M., Vancova, M., Clark, K., Grubhoffer, L., Oliver, J. H. Jr Isolation of live Borrelia burgdorferi sensu lato spirochaetes from patients with undefined disorders and symptoms not typical for Lyme borreliosis. Clin. Microbiol. Infect. 22, (3), 267.e9-267.e15 (2016).
  4. Scott, J. D., Clark, K. L., Anderson, J. F., Foley, J. E., Young, M. R., Durden, L. A. Lyme Disease Bacterium, Borrelia burgdorferi Sensu Lato, Detected in Multiple Tick Species at Species at Kenora, Ontario, Canada. J Bacteriol Parasitol. 08, (01), 1-10 (2017).
  5. Sperling, J., Middelveen, M., Klein, D., Sperling, F. Evolving perspectives on lyme borreliosis in Canada. Open Neurol J. 6, 94-103 (2012).
  6. Pachner, A. R. Early disseminated Lyme disease: Lyme meningitis. Am. J. Med. 98, (Supplement 1), 30S-43S (1995).
  7. Mikkilä, H. O., Seppälä, I. J., Viljanen, M. K., Peltomaa, M. P., Karma, A. The expanding clinical spectrum of ocular lyme borreliosis. Ophthalmology. 107, (3), 581-587 (2000).
  8. Mc Causland, F. R., Niedermaier, S., Bijol, V., Rennke, H. G., Choi, M. E., Forman, J. P. Lyme disease-associated glomerulonephritis. Nephrol. Dial. Transplant. 26, (9), 3054-3056 (2011).
  9. Tunev, S. S., Hastey, C. J., Hodzic, E., Feng, S., Barthold, S. W., Baumgarth, N. Lymphoadenopathy during Lyme Borreliosis Is Caused by Spirochete Migration-Induced Specific B Cell Activation. PLoS Pathog. 7, (5), e1002066-e1002014 (2011).
  10. Kostić, T., et al. Manifestations of Lyme carditis. Int. J. Cardiol. 232, 24-32 (2017).
  11. Hinckley, A. F., et al. Lyme Disease Testing by Large Commercial Laboratories in the United States. Clin. Infect. Dis. 59, (5), 676-681 (2014).
  12. Nelson, C. A., et al. Incidence of Clinician-Diagnosed Lyme Disease, United States 2005-2010. Emerg. Infect. Dis. 21, (9), 1625-1631 (2015).
  13. Aucott, J. N., Rebman, A. W., Crowder, L. A., Kortte, K. B. Post-treatment Lyme disease syndrome symptomatology and the impact on life functioning: is there something here? Qual Life Res. 22, (1), 75-84 (2012).
  14. Aucott, J. N., Crowder, L. A., Kortte, K. B. Development of a foundation for a case definition of post-treatment Lyme disease syndrome. Int. J. Infect. Dis. 17, (6), e443-e449 (2013).
  15. Adrion, E. R., Aucott, J., Lemke, K. W., Weiner, J. P. Health care costs, utilization and patterns of care following Lyme disease. PLoS ONE. (2015).
  16. Cameron, D. J. Consequences of treatment delay in Lyme disease. Journal of Evaluation in Clinical Practice. 13, (3), 470-472 (2007).
  17. Johnson, L., Aylward, A., Stricker, R. B. Healthcare access and burden of care for patients with Lyme disease: a large United States survey. Health policy. 102, (1), 64-71 (2011).
  18. Motaleb, M. A., et al. Borrelia burgdorferi periplasmic flagella have both skeletal and motility functions. Proc. Natl. Acad. Sci. U.S.A. 97, (20), 10899-10904 (2000).
  19. Rosa, P. A., Tilly, K., Stewart, P. E. The burgeoning molecular genetics of the Lyme disease spirochaete. Nat. Rev. Microbiol. 3, (2), 129-143 (2005).
  20. Kenedy, M. R., Lenhart, T. R., Akins, D. R. The role of Borrelia burgdorferi outer surface proteins. FEMS Immunol. Med. Microbiol. 66, (1), 1-19 (2012).
  21. Persing, D. H., Telford, S. R., Spielman, A., Barthold, S. W. Detection of Borrelia burgdorferi infection in Ixodes dammini ticks with the polymerase chain reaction. J. Clin. Microbiol. 28, (3), 566-572 (1990).
  22. Persing, D. H., et al. Detection of Borrelia burgdorferi DNA in museum specimens of Ixodes dammini ticks. Science. 249, (4975), 1420-1423 (1990).
  23. Wise, D. J., Weaver, T. L. Detection of the Lyme disease bacterium, Borrelia burgdorferi, by using the polymerase chain reaction and a nonradioisotopic gene probe. J. Clin. Microbiol. 29, (7), 1523-1526 (1991).
  24. Johnson, B. J., Happ, C. M., Mayer, L. W., Piesman, J. Detection of Borrelia burgdorferi in ticks by species-specific amplification of the flagellin gene. Am. J. Trop. Med. Hyg. 47, (6), 730-741 (1992).
  25. Schmidt, B. L. PCR in laboratory diagnosis of human Borrelia burgdorferi infections. Clin. Microbiol. Rev. 10, (1), 185-201 (1997).
  26. Ogden, N. H., et al. Ixodes scapularis ticks collected by passive surveillance in Canada: analysis of geographic distribution and infection with Lyme borreliosis agent Borrelia burgdorferi. J. Med. Entomol. 43, (3), 600-609 (2006).
  27. Doern, G. V. Detection of selected fastidious bacteria. Clin. Infect. Dis. 30, (1), 166-173 (2000).
  28. Nolte, O. Nucleic Acid Amplification Based Diagnostic of Lyme (Neuro-)borreliosis - Lost in the Jungle of Methods, Targets, and Assays? Open Neurol J. 6, (1), 129-139 (2012).
  29. Wallich, R., Moter, S. E., Simon, M. M., Ebnet, K., Heiberger, A., Kramer, M. D. The Borrelia burgdorferi flagellum-associated 41-kilodalton antigen (flagellin): molecular cloning, expression, and amplification of the gene. Infect. Immun. 58, (6), 1711-1719 (1990).
  30. Picken, R. N. Polymerase chain reaction primers and probes derived from flagellin gene sequences for specific detection of the agents of Lyme disease and North American relapsing fever. J. Clin. Microbiol. 30, (1), 99-114 (1992).
  31. Picken, M. M., Picken, R. N., Han, D., Cheng, Y., Strle, F. Single-tube nested polymerase chain reaction assay based on flagellin gene sequences for detection ofBorrelia burgdorferi sensu lato. Eur. J. Clin. Microbiol. Infect. Dis. 15, (6), 489-498 (1996).
  32. Keirans, J. E., Litwak, T. R. Pictorial key to the adults of hard ticks, family Ixodidae (Ixodida: Ixodoidea), east of the Mississippi River. J. Med. Entomol. 26, (5), 435-448 (1989).
  33. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J Vis Exp. (63), e3998 (2012).
  34. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose Gel Electrophoresis for the Separation of DNA Fragments. J Vis Exp. (62), e3923 (2012).
  35. Sapi, E., Pabbati, N., Datar, A., Davies, E. M., Rattelle, A., Kuo, B. A. Improved culture conditions for the growth and detection of Borrelia from human serum. Int J Med Sci. 10, (4), 362-376 (2013).
  36. Waddell, L. A., Greig, J., Mascarenhas, M., Harding, S., Lindsay, R., Ogden, N. The Accuracy of Diagnostic Tests for Lyme Disease in Humans, A Systematic Review and Meta-Analysis of North American Research. PLoS ONE. 11, (12), e0168613-e0168623 (2016).
  37. Brunet, L. R., Spielman, A., Telford, S. R. III Density of Lyme disease spirochetes within deer ticks collected from zoonotic sites. Am. J. Trop. Med. Hyg. 53, (3), 300-302 (1995).
  38. Wang, G., et al. Real-time PCR for simultaneous detection and quantification of Borrelia burgdorferi in field-collected Ixodes scapularis ticks from the Northeastern United States. Appl. Environ. Microbiol. 69, (8), 4561-4565 (2003).
  39. King, J. L., Smith, A. D., Mitchell, E. A., Allen, M. S. Validation of droplet digital PCR for the detection and absolute quantification of Borrelia DNA in Ixodes scapularis ticks. Parasitology. 144, (4), 359-367 (2017).
  40. Ye, J., Coulouris, G., Zaretskaya, I., Cutcutache, I., Rozen, S., Madden, T. L. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 13, (1), 134 (2012).
  41. Kwok, S., Higuchi, R. Avoiding false positives with PCR. Nature. 339, (6221), 237-238 (1989).
  42. Rys, P. N., Persing, D. H. Preventing false positives: quantitative evaluation of three protocols for inactivation of polymerase chain reaction amplification products. J. Clin. Microbiol. 31, (9), 2356-2360 (1993).
  43. Pahl, A., Kühlbrandt, U., Brune, K., Röllinghoff, M., Gessner, A. Quantitative detection of Borrelia burgdorferi by real-time PCR. J. Clin. Microbiol. 37, (6), 1958-1963 (1999).
  44. Saidac, D. S., Marras, S. A. E., Parveen, N. Detection and quantification of Lyme spirochetes using sensitive and specific molecular beacon probes. BMC Microbiol. 9, (1), 43 (2009).
  45. Chan, K., Marras, S. A. E., Parveen, N. Sensitive multiplex PCR assay to differentiate Lyme spirochetes and emerging pathogens Anaplasma phagocytophilum and Babesia microti. BMC Microbiol. 13, (1), 295 (2013).
  46. Schlachter, S., Chan, K., Marras, S. A. E., Parveen, N. Detection and Differentiation of Lyme Spirochetes and Other Tick-Borne Pathogens from Blood Using Real-Time PCR with Molecular Beacons. Methods Mol. Biol. 1616, 155-170 (2017).
  47. Wang, L., Blasic, J. R. Jr, Holden, M. J., Pires, R. Sensitivity comparison of real-time PCR probe designs on a model DNA plasmid. Anal. Biochem. 344, (2), 257-265 (2005).
  48. Sze, M. A., Abbasi, M., Hogg, J. C., Sin, D. D. A Comparison between Droplet Digital and Quantitative PCR in the Analysis of Bacterial 16S Load in Lung Tissue Samples from Control and COPD GOLD 2. PLos ONE. 9, (10), e110351-e110356 (2014).
  49. Sperling, J. L., et al. Comparison of bacterial 16S rRNA variable regions for microbiome surveys of ticks. Ticks Tick Borne Dis. 1-9 (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics